ID: 1144516000

View in Genome Browser
Species Human (GRCh38)
Location 17:15917860-15917882
Sequence ACCCCAAACTTCGCCTGTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144515993_1144516000 0 Left 1144515993 17:15917837-15917859 CCAACCCCCTGCCACAGGAGGCC No data
Right 1144516000 17:15917860-15917882 ACCCCAAACTTCGCCTGTCCAGG No data
1144515988_1144516000 16 Left 1144515988 17:15917821-15917843 CCTTGGCTTAGGCTCCCCAACCC No data
Right 1144516000 17:15917860-15917882 ACCCCAAACTTCGCCTGTCCAGG No data
1144515990_1144516000 2 Left 1144515990 17:15917835-15917857 CCCCAACCCCCTGCCACAGGAGG No data
Right 1144516000 17:15917860-15917882 ACCCCAAACTTCGCCTGTCCAGG No data
1144515994_1144516000 -4 Left 1144515994 17:15917841-15917863 CCCCCTGCCACAGGAGGCCACCC No data
Right 1144516000 17:15917860-15917882 ACCCCAAACTTCGCCTGTCCAGG No data
1144515995_1144516000 -5 Left 1144515995 17:15917842-15917864 CCCCTGCCACAGGAGGCCACCCC No data
Right 1144516000 17:15917860-15917882 ACCCCAAACTTCGCCTGTCCAGG No data
1144515992_1144516000 1 Left 1144515992 17:15917836-15917858 CCCAACCCCCTGCCACAGGAGGC No data
Right 1144516000 17:15917860-15917882 ACCCCAAACTTCGCCTGTCCAGG No data
1144515996_1144516000 -6 Left 1144515996 17:15917843-15917865 CCCTGCCACAGGAGGCCACCCCA No data
Right 1144516000 17:15917860-15917882 ACCCCAAACTTCGCCTGTCCAGG No data
1144515985_1144516000 30 Left 1144515985 17:15917807-15917829 CCGCCTACTCGGCTCCTTGGCTT No data
Right 1144516000 17:15917860-15917882 ACCCCAAACTTCGCCTGTCCAGG No data
1144515997_1144516000 -7 Left 1144515997 17:15917844-15917866 CCTGCCACAGGAGGCCACCCCAA No data
Right 1144516000 17:15917860-15917882 ACCCCAAACTTCGCCTGTCCAGG No data
1144515986_1144516000 27 Left 1144515986 17:15917810-15917832 CCTACTCGGCTCCTTGGCTTAGG No data
Right 1144516000 17:15917860-15917882 ACCCCAAACTTCGCCTGTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144516000 Original CRISPR ACCCCAAACTTCGCCTGTCC AGG Intergenic