ID: 1144516007

View in Genome Browser
Species Human (GRCh38)
Location 17:15917877-15917899
Sequence TCCAGGCGAGTGCTCGGGCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144515990_1144516007 19 Left 1144515990 17:15917835-15917857 CCCCAACCCCCTGCCACAGGAGG No data
Right 1144516007 17:15917877-15917899 TCCAGGCGAGTGCTCGGGCTCGG No data
1144515996_1144516007 11 Left 1144515996 17:15917843-15917865 CCCTGCCACAGGAGGCCACCCCA No data
Right 1144516007 17:15917877-15917899 TCCAGGCGAGTGCTCGGGCTCGG No data
1144516002_1144516007 -8 Left 1144516002 17:15917862-15917884 CCCAAACTTCGCCTGTCCAGGCG No data
Right 1144516007 17:15917877-15917899 TCCAGGCGAGTGCTCGGGCTCGG No data
1144515999_1144516007 -4 Left 1144515999 17:15917858-15917880 CCACCCCAAACTTCGCCTGTCCA No data
Right 1144516007 17:15917877-15917899 TCCAGGCGAGTGCTCGGGCTCGG No data
1144515997_1144516007 10 Left 1144515997 17:15917844-15917866 CCTGCCACAGGAGGCCACCCCAA No data
Right 1144516007 17:15917877-15917899 TCCAGGCGAGTGCTCGGGCTCGG No data
1144515995_1144516007 12 Left 1144515995 17:15917842-15917864 CCCCTGCCACAGGAGGCCACCCC No data
Right 1144516007 17:15917877-15917899 TCCAGGCGAGTGCTCGGGCTCGG No data
1144516001_1144516007 -7 Left 1144516001 17:15917861-15917883 CCCCAAACTTCGCCTGTCCAGGC No data
Right 1144516007 17:15917877-15917899 TCCAGGCGAGTGCTCGGGCTCGG No data
1144516003_1144516007 -9 Left 1144516003 17:15917863-15917885 CCAAACTTCGCCTGTCCAGGCGA No data
Right 1144516007 17:15917877-15917899 TCCAGGCGAGTGCTCGGGCTCGG No data
1144515998_1144516007 6 Left 1144515998 17:15917848-15917870 CCACAGGAGGCCACCCCAAACTT No data
Right 1144516007 17:15917877-15917899 TCCAGGCGAGTGCTCGGGCTCGG No data
1144515993_1144516007 17 Left 1144515993 17:15917837-15917859 CCAACCCCCTGCCACAGGAGGCC No data
Right 1144516007 17:15917877-15917899 TCCAGGCGAGTGCTCGGGCTCGG No data
1144515992_1144516007 18 Left 1144515992 17:15917836-15917858 CCCAACCCCCTGCCACAGGAGGC No data
Right 1144516007 17:15917877-15917899 TCCAGGCGAGTGCTCGGGCTCGG No data
1144515994_1144516007 13 Left 1144515994 17:15917841-15917863 CCCCCTGCCACAGGAGGCCACCC No data
Right 1144516007 17:15917877-15917899 TCCAGGCGAGTGCTCGGGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144516007 Original CRISPR TCCAGGCGAGTGCTCGGGCT CGG Intergenic