ID: 1144516788

View in Genome Browser
Species Human (GRCh38)
Location 17:15923705-15923727
Sequence CACTAAGAAATATGGGCAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144516788_1144516793 0 Left 1144516788 17:15923705-15923727 CCCATTGCCCATATTTCTTAGTG No data
Right 1144516793 17:15923728-15923750 AGTGTTTGGAAACCTCATCTTGG No data
1144516788_1144516795 17 Left 1144516788 17:15923705-15923727 CCCATTGCCCATATTTCTTAGTG No data
Right 1144516795 17:15923745-15923767 TCTTGGAGCTTTTAGTACATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144516788 Original CRISPR CACTAAGAAATATGGGCAAT GGG (reversed) Intergenic
No off target data available for this crispr