ID: 1144517360

View in Genome Browser
Species Human (GRCh38)
Location 17:15928035-15928057
Sequence GGCGGGCGGATCACGAGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144517360_1144517372 25 Left 1144517360 17:15928035-15928057 CCTGACCTCGTGATCCGCCCGCC No data
Right 1144517372 17:15928083-15928105 TAGGCGTGAGCCACCACGCCCGG No data
1144517360_1144517365 -3 Left 1144517360 17:15928035-15928057 CCTGACCTCGTGATCCGCCCGCC No data
Right 1144517365 17:15928055-15928077 GCCTCAGCCTCCCAAAGTGCTGG No data
1144517360_1144517369 6 Left 1144517360 17:15928035-15928057 CCTGACCTCGTGATCCGCCCGCC No data
Right 1144517369 17:15928064-15928086 TCCCAAAGTGCTGGGATTATAGG No data
1144517360_1144517367 -2 Left 1144517360 17:15928035-15928057 CCTGACCTCGTGATCCGCCCGCC No data
Right 1144517367 17:15928056-15928078 CCTCAGCCTCCCAAAGTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144517360 Original CRISPR GGCGGGCGGATCACGAGGTC AGG (reversed) Intergenic