ID: 1144517361

View in Genome Browser
Species Human (GRCh38)
Location 17:15928040-15928062
Sequence GCTGAGGCGGGCGGATCACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144517361_1144517373 26 Left 1144517361 17:15928040-15928062 CCTCGTGATCCGCCCGCCTCAGC No data
Right 1144517373 17:15928089-15928111 TGAGCCACCACGCCCGGCCGAGG No data
1144517361_1144517367 -7 Left 1144517361 17:15928040-15928062 CCTCGTGATCCGCCCGCCTCAGC No data
Right 1144517367 17:15928056-15928078 CCTCAGCCTCCCAAAGTGCTGGG No data
1144517361_1144517369 1 Left 1144517361 17:15928040-15928062 CCTCGTGATCCGCCCGCCTCAGC No data
Right 1144517369 17:15928064-15928086 TCCCAAAGTGCTGGGATTATAGG No data
1144517361_1144517372 20 Left 1144517361 17:15928040-15928062 CCTCGTGATCCGCCCGCCTCAGC No data
Right 1144517372 17:15928083-15928105 TAGGCGTGAGCCACCACGCCCGG No data
1144517361_1144517365 -8 Left 1144517361 17:15928040-15928062 CCTCGTGATCCGCCCGCCTCAGC No data
Right 1144517365 17:15928055-15928077 GCCTCAGCCTCCCAAAGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144517361 Original CRISPR GCTGAGGCGGGCGGATCACG AGG (reversed) Intergenic