ID: 1144517362

View in Genome Browser
Species Human (GRCh38)
Location 17:15928049-15928071
Sequence CTTTGGGAGGCTGAGGCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 608038
Summary {0: 20304, 1: 108143, 2: 164903, 3: 177131, 4: 137557}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144517362_1144517369 -8 Left 1144517362 17:15928049-15928071 CCGCCCGCCTCAGCCTCCCAAAG 0: 20304
1: 108143
2: 164903
3: 177131
4: 137557
Right 1144517369 17:15928064-15928086 TCCCAAAGTGCTGGGATTATAGG 0: 27231
1: 315676
2: 251783
3: 138973
4: 131031
1144517362_1144517377 24 Left 1144517362 17:15928049-15928071 CCGCCCGCCTCAGCCTCCCAAAG 0: 20304
1: 108143
2: 164903
3: 177131
4: 137557
Right 1144517377 17:15928096-15928118 CCACGCCCGGCCGAGGCCATGGG No data
1144517362_1144517373 17 Left 1144517362 17:15928049-15928071 CCGCCCGCCTCAGCCTCCCAAAG 0: 20304
1: 108143
2: 164903
3: 177131
4: 137557
Right 1144517373 17:15928089-15928111 TGAGCCACCACGCCCGGCCGAGG 0: 25
1: 626
2: 2978
3: 6264
4: 7998
1144517362_1144517375 23 Left 1144517362 17:15928049-15928071 CCGCCCGCCTCAGCCTCCCAAAG 0: 20304
1: 108143
2: 164903
3: 177131
4: 137557
Right 1144517375 17:15928095-15928117 ACCACGCCCGGCCGAGGCCATGG No data
1144517362_1144517372 11 Left 1144517362 17:15928049-15928071 CCGCCCGCCTCAGCCTCCCAAAG 0: 20304
1: 108143
2: 164903
3: 177131
4: 137557
Right 1144517372 17:15928083-15928105 TAGGCGTGAGCCACCACGCCCGG 0: 596
1: 12105
2: 67367
3: 137739
4: 203328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144517362 Original CRISPR CTTTGGGAGGCTGAGGCGGG CGG (reversed) Intergenic
Too many off-targets to display for this crispr