ID: 1144517363

View in Genome Browser
Species Human (GRCh38)
Location 17:15928052-15928074
Sequence GCACTTTGGGAGGCTGAGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1032626
Summary {0: 59629, 1: 175979, 2: 229415, 3: 270535, 4: 297068}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144517363_1144517375 20 Left 1144517363 17:15928052-15928074 CCCGCCTCAGCCTCCCAAAGTGC 0: 59629
1: 175979
2: 229415
3: 270535
4: 297068
Right 1144517375 17:15928095-15928117 ACCACGCCCGGCCGAGGCCATGG No data
1144517363_1144517377 21 Left 1144517363 17:15928052-15928074 CCCGCCTCAGCCTCCCAAAGTGC 0: 59629
1: 175979
2: 229415
3: 270535
4: 297068
Right 1144517377 17:15928096-15928118 CCACGCCCGGCCGAGGCCATGGG No data
1144517363_1144517373 14 Left 1144517363 17:15928052-15928074 CCCGCCTCAGCCTCCCAAAGTGC 0: 59629
1: 175979
2: 229415
3: 270535
4: 297068
Right 1144517373 17:15928089-15928111 TGAGCCACCACGCCCGGCCGAGG 0: 25
1: 626
2: 2978
3: 6264
4: 7998
1144517363_1144517372 8 Left 1144517363 17:15928052-15928074 CCCGCCTCAGCCTCCCAAAGTGC 0: 59629
1: 175979
2: 229415
3: 270535
4: 297068
Right 1144517372 17:15928083-15928105 TAGGCGTGAGCCACCACGCCCGG 0: 596
1: 12105
2: 67367
3: 137739
4: 203328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144517363 Original CRISPR GCACTTTGGGAGGCTGAGGC GGG (reversed) Intergenic
Too many off-targets to display for this crispr