ID: 1144517364

View in Genome Browser
Species Human (GRCh38)
Location 17:15928053-15928075
Sequence AGCACTTTGGGAGGCTGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144517364_1144517372 7 Left 1144517364 17:15928053-15928075 CCGCCTCAGCCTCCCAAAGTGCT No data
Right 1144517372 17:15928083-15928105 TAGGCGTGAGCCACCACGCCCGG No data
1144517364_1144517375 19 Left 1144517364 17:15928053-15928075 CCGCCTCAGCCTCCCAAAGTGCT No data
Right 1144517375 17:15928095-15928117 ACCACGCCCGGCCGAGGCCATGG No data
1144517364_1144517377 20 Left 1144517364 17:15928053-15928075 CCGCCTCAGCCTCCCAAAGTGCT No data
Right 1144517377 17:15928096-15928118 CCACGCCCGGCCGAGGCCATGGG No data
1144517364_1144517373 13 Left 1144517364 17:15928053-15928075 CCGCCTCAGCCTCCCAAAGTGCT No data
Right 1144517373 17:15928089-15928111 TGAGCCACCACGCCCGGCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144517364 Original CRISPR AGCACTTTGGGAGGCTGAGG CGG (reversed) Intergenic