ID: 1144517366

View in Genome Browser
Species Human (GRCh38)
Location 17:15928056-15928078
Sequence CCCAGCACTTTGGGAGGCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1083691
Summary {0: 84188, 1: 205795, 2: 234195, 3: 260821, 4: 298692}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144517366_1144517377 17 Left 1144517366 17:15928056-15928078 CCTCAGCCTCCCAAAGTGCTGGG 0: 84188
1: 205795
2: 234195
3: 260821
4: 298692
Right 1144517377 17:15928096-15928118 CCACGCCCGGCCGAGGCCATGGG No data
1144517366_1144517375 16 Left 1144517366 17:15928056-15928078 CCTCAGCCTCCCAAAGTGCTGGG 0: 84188
1: 205795
2: 234195
3: 260821
4: 298692
Right 1144517375 17:15928095-15928117 ACCACGCCCGGCCGAGGCCATGG No data
1144517366_1144517373 10 Left 1144517366 17:15928056-15928078 CCTCAGCCTCCCAAAGTGCTGGG 0: 84188
1: 205795
2: 234195
3: 260821
4: 298692
Right 1144517373 17:15928089-15928111 TGAGCCACCACGCCCGGCCGAGG 0: 25
1: 626
2: 2978
3: 6264
4: 7998
1144517366_1144517372 4 Left 1144517366 17:15928056-15928078 CCTCAGCCTCCCAAAGTGCTGGG 0: 84188
1: 205795
2: 234195
3: 260821
4: 298692
Right 1144517372 17:15928083-15928105 TAGGCGTGAGCCACCACGCCCGG 0: 596
1: 12105
2: 67367
3: 137739
4: 203328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144517366 Original CRISPR CCCAGCACTTTGGGAGGCTG AGG (reversed) Intergenic
Too many off-targets to display for this crispr