ID: 1144517368

View in Genome Browser
Species Human (GRCh38)
Location 17:15928062-15928084
Sequence TATAATCCCAGCACTTTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 880486
Summary {0: 26361, 1: 319744, 2: 258545, 3: 142388, 4: 133448}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144517368_1144517381 25 Left 1144517368 17:15928062-15928084 CCTCCCAAAGTGCTGGGATTATA 0: 26361
1: 319744
2: 258545
3: 142388
4: 133448
Right 1144517381 17:15928110-15928132 GGCCATGGGTTTCAAGAAAGAGG No data
1144517368_1144517373 4 Left 1144517368 17:15928062-15928084 CCTCCCAAAGTGCTGGGATTATA 0: 26361
1: 319744
2: 258545
3: 142388
4: 133448
Right 1144517373 17:15928089-15928111 TGAGCCACCACGCCCGGCCGAGG 0: 25
1: 626
2: 2978
3: 6264
4: 7998
1144517368_1144517375 10 Left 1144517368 17:15928062-15928084 CCTCCCAAAGTGCTGGGATTATA 0: 26361
1: 319744
2: 258545
3: 142388
4: 133448
Right 1144517375 17:15928095-15928117 ACCACGCCCGGCCGAGGCCATGG No data
1144517368_1144517377 11 Left 1144517368 17:15928062-15928084 CCTCCCAAAGTGCTGGGATTATA 0: 26361
1: 319744
2: 258545
3: 142388
4: 133448
Right 1144517377 17:15928096-15928118 CCACGCCCGGCCGAGGCCATGGG No data
1144517368_1144517372 -2 Left 1144517368 17:15928062-15928084 CCTCCCAAAGTGCTGGGATTATA 0: 26361
1: 319744
2: 258545
3: 142388
4: 133448
Right 1144517372 17:15928083-15928105 TAGGCGTGAGCCACCACGCCCGG 0: 596
1: 12105
2: 67367
3: 137739
4: 203328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144517368 Original CRISPR TATAATCCCAGCACTTTGGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr