ID: 1144517369

View in Genome Browser
Species Human (GRCh38)
Location 17:15928064-15928086
Sequence TCCCAAAGTGCTGGGATTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 864694
Summary {0: 27231, 1: 315676, 2: 251783, 3: 138973, 4: 131031}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144517362_1144517369 -8 Left 1144517362 17:15928049-15928071 CCGCCCGCCTCAGCCTCCCAAAG 0: 20304
1: 108143
2: 164903
3: 177131
4: 137557
Right 1144517369 17:15928064-15928086 TCCCAAAGTGCTGGGATTATAGG 0: 27231
1: 315676
2: 251783
3: 138973
4: 131031
1144517361_1144517369 1 Left 1144517361 17:15928040-15928062 CCTCGTGATCCGCCCGCCTCAGC 0: 2552
1: 23091
2: 49083
3: 67692
4: 56441
Right 1144517369 17:15928064-15928086 TCCCAAAGTGCTGGGATTATAGG 0: 27231
1: 315676
2: 251783
3: 138973
4: 131031
1144517360_1144517369 6 Left 1144517360 17:15928035-15928057 CCTGACCTCGTGATCCGCCCGCC 0: 16279
1: 43514
2: 69209
3: 54541
4: 24107
Right 1144517369 17:15928064-15928086 TCCCAAAGTGCTGGGATTATAGG 0: 27231
1: 315676
2: 251783
3: 138973
4: 131031

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144517369 Original CRISPR TCCCAAAGTGCTGGGATTAT AGG Intergenic
Too many off-targets to display for this crispr