ID: 1144517370

View in Genome Browser
Species Human (GRCh38)
Location 17:15928065-15928087
Sequence GCCTATAATCCCAGCACTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 855615
Summary {0: 20277, 1: 245443, 2: 271371, 3: 174555, 4: 143969}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144517370_1144517375 7 Left 1144517370 17:15928065-15928087 CCCAAAGTGCTGGGATTATAGGC 0: 20277
1: 245443
2: 271371
3: 174555
4: 143969
Right 1144517375 17:15928095-15928117 ACCACGCCCGGCCGAGGCCATGG No data
1144517370_1144517373 1 Left 1144517370 17:15928065-15928087 CCCAAAGTGCTGGGATTATAGGC 0: 20277
1: 245443
2: 271371
3: 174555
4: 143969
Right 1144517373 17:15928089-15928111 TGAGCCACCACGCCCGGCCGAGG 0: 25
1: 626
2: 2978
3: 6264
4: 7998
1144517370_1144517381 22 Left 1144517370 17:15928065-15928087 CCCAAAGTGCTGGGATTATAGGC 0: 20277
1: 245443
2: 271371
3: 174555
4: 143969
Right 1144517381 17:15928110-15928132 GGCCATGGGTTTCAAGAAAGAGG No data
1144517370_1144517372 -5 Left 1144517370 17:15928065-15928087 CCCAAAGTGCTGGGATTATAGGC 0: 20277
1: 245443
2: 271371
3: 174555
4: 143969
Right 1144517372 17:15928083-15928105 TAGGCGTGAGCCACCACGCCCGG 0: 596
1: 12105
2: 67367
3: 137739
4: 203328
1144517370_1144517377 8 Left 1144517370 17:15928065-15928087 CCCAAAGTGCTGGGATTATAGGC 0: 20277
1: 245443
2: 271371
3: 174555
4: 143969
Right 1144517377 17:15928096-15928118 CCACGCCCGGCCGAGGCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144517370 Original CRISPR GCCTATAATCCCAGCACTTT GGG (reversed) Intergenic
Too many off-targets to display for this crispr