ID: 1144517371

View in Genome Browser
Species Human (GRCh38)
Location 17:15928066-15928088
Sequence CGCCTATAATCCCAGCACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144517371_1144517373 0 Left 1144517371 17:15928066-15928088 CCAAAGTGCTGGGATTATAGGCG No data
Right 1144517373 17:15928089-15928111 TGAGCCACCACGCCCGGCCGAGG No data
1144517371_1144517375 6 Left 1144517371 17:15928066-15928088 CCAAAGTGCTGGGATTATAGGCG No data
Right 1144517375 17:15928095-15928117 ACCACGCCCGGCCGAGGCCATGG No data
1144517371_1144517383 30 Left 1144517371 17:15928066-15928088 CCAAAGTGCTGGGATTATAGGCG No data
Right 1144517383 17:15928119-15928141 TTTCAAGAAAGAGGAAGTGATGG No data
1144517371_1144517372 -6 Left 1144517371 17:15928066-15928088 CCAAAGTGCTGGGATTATAGGCG No data
Right 1144517372 17:15928083-15928105 TAGGCGTGAGCCACCACGCCCGG No data
1144517371_1144517381 21 Left 1144517371 17:15928066-15928088 CCAAAGTGCTGGGATTATAGGCG No data
Right 1144517381 17:15928110-15928132 GGCCATGGGTTTCAAGAAAGAGG No data
1144517371_1144517377 7 Left 1144517371 17:15928066-15928088 CCAAAGTGCTGGGATTATAGGCG No data
Right 1144517377 17:15928096-15928118 CCACGCCCGGCCGAGGCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144517371 Original CRISPR CGCCTATAATCCCAGCACTT TGG (reversed) Intergenic