ID: 1144517371

View in Genome Browser
Species Human (GRCh38)
Location 17:15928066-15928088
Sequence CGCCTATAATCCCAGCACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 807629
Summary {0: 9370, 1: 149078, 2: 285159, 3: 214832, 4: 149190}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144517371_1144517372 -6 Left 1144517371 17:15928066-15928088 CCAAAGTGCTGGGATTATAGGCG 0: 9370
1: 149078
2: 285159
3: 214832
4: 149190
Right 1144517372 17:15928083-15928105 TAGGCGTGAGCCACCACGCCCGG 0: 596
1: 12105
2: 67367
3: 137739
4: 203328
1144517371_1144517377 7 Left 1144517371 17:15928066-15928088 CCAAAGTGCTGGGATTATAGGCG 0: 9370
1: 149078
2: 285159
3: 214832
4: 149190
Right 1144517377 17:15928096-15928118 CCACGCCCGGCCGAGGCCATGGG No data
1144517371_1144517381 21 Left 1144517371 17:15928066-15928088 CCAAAGTGCTGGGATTATAGGCG 0: 9370
1: 149078
2: 285159
3: 214832
4: 149190
Right 1144517381 17:15928110-15928132 GGCCATGGGTTTCAAGAAAGAGG No data
1144517371_1144517383 30 Left 1144517371 17:15928066-15928088 CCAAAGTGCTGGGATTATAGGCG 0: 9370
1: 149078
2: 285159
3: 214832
4: 149190
Right 1144517383 17:15928119-15928141 TTTCAAGAAAGAGGAAGTGATGG No data
1144517371_1144517375 6 Left 1144517371 17:15928066-15928088 CCAAAGTGCTGGGATTATAGGCG 0: 9370
1: 149078
2: 285159
3: 214832
4: 149190
Right 1144517375 17:15928095-15928117 ACCACGCCCGGCCGAGGCCATGG No data
1144517371_1144517373 0 Left 1144517371 17:15928066-15928088 CCAAAGTGCTGGGATTATAGGCG 0: 9370
1: 149078
2: 285159
3: 214832
4: 149190
Right 1144517373 17:15928089-15928111 TGAGCCACCACGCCCGGCCGAGG 0: 25
1: 626
2: 2978
3: 6264
4: 7998

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144517371 Original CRISPR CGCCTATAATCCCAGCACTT TGG (reversed) Intergenic
Too many off-targets to display for this crispr