ID: 1144517372

View in Genome Browser
Species Human (GRCh38)
Location 17:15928083-15928105
Sequence TAGGCGTGAGCCACCACGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 421135
Summary {0: 596, 1: 12105, 2: 67367, 3: 137739, 4: 203328}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144517366_1144517372 4 Left 1144517366 17:15928056-15928078 CCTCAGCCTCCCAAAGTGCTGGG 0: 84188
1: 205795
2: 234195
3: 260821
4: 298692
Right 1144517372 17:15928083-15928105 TAGGCGTGAGCCACCACGCCCGG 0: 596
1: 12105
2: 67367
3: 137739
4: 203328
1144517361_1144517372 20 Left 1144517361 17:15928040-15928062 CCTCGTGATCCGCCCGCCTCAGC 0: 2552
1: 23091
2: 49083
3: 67692
4: 56441
Right 1144517372 17:15928083-15928105 TAGGCGTGAGCCACCACGCCCGG 0: 596
1: 12105
2: 67367
3: 137739
4: 203328
1144517363_1144517372 8 Left 1144517363 17:15928052-15928074 CCCGCCTCAGCCTCCCAAAGTGC 0: 59629
1: 175979
2: 229415
3: 270535
4: 297068
Right 1144517372 17:15928083-15928105 TAGGCGTGAGCCACCACGCCCGG 0: 596
1: 12105
2: 67367
3: 137739
4: 203328
1144517364_1144517372 7 Left 1144517364 17:15928053-15928075 CCGCCTCAGCCTCCCAAAGTGCT 0: 60215
1: 147830
2: 155736
3: 113395
4: 79914
Right 1144517372 17:15928083-15928105 TAGGCGTGAGCCACCACGCCCGG 0: 596
1: 12105
2: 67367
3: 137739
4: 203328
1144517360_1144517372 25 Left 1144517360 17:15928035-15928057 CCTGACCTCGTGATCCGCCCGCC 0: 16279
1: 43514
2: 69209
3: 54541
4: 24107
Right 1144517372 17:15928083-15928105 TAGGCGTGAGCCACCACGCCCGG 0: 596
1: 12105
2: 67367
3: 137739
4: 203328
1144517368_1144517372 -2 Left 1144517368 17:15928062-15928084 CCTCCCAAAGTGCTGGGATTATA 0: 26361
1: 319744
2: 258545
3: 142388
4: 133448
Right 1144517372 17:15928083-15928105 TAGGCGTGAGCCACCACGCCCGG 0: 596
1: 12105
2: 67367
3: 137739
4: 203328
1144517370_1144517372 -5 Left 1144517370 17:15928065-15928087 CCCAAAGTGCTGGGATTATAGGC 0: 20277
1: 245443
2: 271371
3: 174555
4: 143969
Right 1144517372 17:15928083-15928105 TAGGCGTGAGCCACCACGCCCGG 0: 596
1: 12105
2: 67367
3: 137739
4: 203328
1144517371_1144517372 -6 Left 1144517371 17:15928066-15928088 CCAAAGTGCTGGGATTATAGGCG 0: 9370
1: 149078
2: 285159
3: 214832
4: 149190
Right 1144517372 17:15928083-15928105 TAGGCGTGAGCCACCACGCCCGG 0: 596
1: 12105
2: 67367
3: 137739
4: 203328
1144517362_1144517372 11 Left 1144517362 17:15928049-15928071 CCGCCCGCCTCAGCCTCCCAAAG 0: 20304
1: 108143
2: 164903
3: 177131
4: 137557
Right 1144517372 17:15928083-15928105 TAGGCGTGAGCCACCACGCCCGG 0: 596
1: 12105
2: 67367
3: 137739
4: 203328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144517372 Original CRISPR TAGGCGTGAGCCACCACGCC CGG Intergenic
Too many off-targets to display for this crispr