ID: 1144517373

View in Genome Browser
Species Human (GRCh38)
Location 17:15928089-15928111
Sequence TGAGCCACCACGCCCGGCCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 17891
Summary {0: 25, 1: 626, 2: 2978, 3: 6264, 4: 7998}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144517371_1144517373 0 Left 1144517371 17:15928066-15928088 CCAAAGTGCTGGGATTATAGGCG 0: 9370
1: 149078
2: 285159
3: 214832
4: 149190
Right 1144517373 17:15928089-15928111 TGAGCCACCACGCCCGGCCGAGG 0: 25
1: 626
2: 2978
3: 6264
4: 7998
1144517362_1144517373 17 Left 1144517362 17:15928049-15928071 CCGCCCGCCTCAGCCTCCCAAAG 0: 20304
1: 108143
2: 164903
3: 177131
4: 137557
Right 1144517373 17:15928089-15928111 TGAGCCACCACGCCCGGCCGAGG 0: 25
1: 626
2: 2978
3: 6264
4: 7998
1144517368_1144517373 4 Left 1144517368 17:15928062-15928084 CCTCCCAAAGTGCTGGGATTATA 0: 26361
1: 319744
2: 258545
3: 142388
4: 133448
Right 1144517373 17:15928089-15928111 TGAGCCACCACGCCCGGCCGAGG 0: 25
1: 626
2: 2978
3: 6264
4: 7998
1144517364_1144517373 13 Left 1144517364 17:15928053-15928075 CCGCCTCAGCCTCCCAAAGTGCT 0: 60215
1: 147830
2: 155736
3: 113395
4: 79914
Right 1144517373 17:15928089-15928111 TGAGCCACCACGCCCGGCCGAGG 0: 25
1: 626
2: 2978
3: 6264
4: 7998
1144517370_1144517373 1 Left 1144517370 17:15928065-15928087 CCCAAAGTGCTGGGATTATAGGC 0: 20277
1: 245443
2: 271371
3: 174555
4: 143969
Right 1144517373 17:15928089-15928111 TGAGCCACCACGCCCGGCCGAGG 0: 25
1: 626
2: 2978
3: 6264
4: 7998
1144517363_1144517373 14 Left 1144517363 17:15928052-15928074 CCCGCCTCAGCCTCCCAAAGTGC 0: 59629
1: 175979
2: 229415
3: 270535
4: 297068
Right 1144517373 17:15928089-15928111 TGAGCCACCACGCCCGGCCGAGG 0: 25
1: 626
2: 2978
3: 6264
4: 7998
1144517361_1144517373 26 Left 1144517361 17:15928040-15928062 CCTCGTGATCCGCCCGCCTCAGC 0: 2552
1: 23091
2: 49083
3: 67692
4: 56441
Right 1144517373 17:15928089-15928111 TGAGCCACCACGCCCGGCCGAGG 0: 25
1: 626
2: 2978
3: 6264
4: 7998
1144517366_1144517373 10 Left 1144517366 17:15928056-15928078 CCTCAGCCTCCCAAAGTGCTGGG 0: 84188
1: 205795
2: 234195
3: 260821
4: 298692
Right 1144517373 17:15928089-15928111 TGAGCCACCACGCCCGGCCGAGG 0: 25
1: 626
2: 2978
3: 6264
4: 7998

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144517373 Original CRISPR TGAGCCACCACGCCCGGCCG AGG Intergenic
Too many off-targets to display for this crispr