ID: 1144517377

View in Genome Browser
Species Human (GRCh38)
Location 17:15928096-15928118
Sequence CCACGCCCGGCCGAGGCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144517366_1144517377 17 Left 1144517366 17:15928056-15928078 CCTCAGCCTCCCAAAGTGCTGGG No data
Right 1144517377 17:15928096-15928118 CCACGCCCGGCCGAGGCCATGGG No data
1144517368_1144517377 11 Left 1144517368 17:15928062-15928084 CCTCCCAAAGTGCTGGGATTATA No data
Right 1144517377 17:15928096-15928118 CCACGCCCGGCCGAGGCCATGGG No data
1144517371_1144517377 7 Left 1144517371 17:15928066-15928088 CCAAAGTGCTGGGATTATAGGCG No data
Right 1144517377 17:15928096-15928118 CCACGCCCGGCCGAGGCCATGGG No data
1144517370_1144517377 8 Left 1144517370 17:15928065-15928087 CCCAAAGTGCTGGGATTATAGGC No data
Right 1144517377 17:15928096-15928118 CCACGCCCGGCCGAGGCCATGGG No data
1144517364_1144517377 20 Left 1144517364 17:15928053-15928075 CCGCCTCAGCCTCCCAAAGTGCT No data
Right 1144517377 17:15928096-15928118 CCACGCCCGGCCGAGGCCATGGG No data
1144517363_1144517377 21 Left 1144517363 17:15928052-15928074 CCCGCCTCAGCCTCCCAAAGTGC No data
Right 1144517377 17:15928096-15928118 CCACGCCCGGCCGAGGCCATGGG No data
1144517362_1144517377 24 Left 1144517362 17:15928049-15928071 CCGCCCGCCTCAGCCTCCCAAAG No data
Right 1144517377 17:15928096-15928118 CCACGCCCGGCCGAGGCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144517377 Original CRISPR CCACGCCCGGCCGAGGCCAT GGG Intergenic