ID: 1144517381

View in Genome Browser
Species Human (GRCh38)
Location 17:15928110-15928132
Sequence GGCCATGGGTTTCAAGAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144517370_1144517381 22 Left 1144517370 17:15928065-15928087 CCCAAAGTGCTGGGATTATAGGC 0: 20277
1: 245443
2: 271371
3: 174555
4: 143969
Right 1144517381 17:15928110-15928132 GGCCATGGGTTTCAAGAAAGAGG No data
1144517371_1144517381 21 Left 1144517371 17:15928066-15928088 CCAAAGTGCTGGGATTATAGGCG 0: 9370
1: 149078
2: 285159
3: 214832
4: 149190
Right 1144517381 17:15928110-15928132 GGCCATGGGTTTCAAGAAAGAGG No data
1144517376_1144517381 -9 Left 1144517376 17:15928096-15928118 CCACGCCCGGCCGAGGCCATGGG No data
Right 1144517381 17:15928110-15928132 GGCCATGGGTTTCAAGAAAGAGG No data
1144517368_1144517381 25 Left 1144517368 17:15928062-15928084 CCTCCCAAAGTGCTGGGATTATA 0: 26361
1: 319744
2: 258545
3: 142388
4: 133448
Right 1144517381 17:15928110-15928132 GGCCATGGGTTTCAAGAAAGAGG No data
1144517374_1144517381 -6 Left 1144517374 17:15928093-15928115 CCACCACGCCCGGCCGAGGCCAT No data
Right 1144517381 17:15928110-15928132 GGCCATGGGTTTCAAGAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144517381 Original CRISPR GGCCATGGGTTTCAAGAAAG AGG Intergenic
No off target data available for this crispr