ID: 1144517383

View in Genome Browser
Species Human (GRCh38)
Location 17:15928119-15928141
Sequence TTTCAAGAAAGAGGAAGTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144517380_1144517383 -10 Left 1144517380 17:15928106-15928128 CCGAGGCCATGGGTTTCAAGAAA No data
Right 1144517383 17:15928119-15928141 TTTCAAGAAAGAGGAAGTGATGG No data
1144517376_1144517383 0 Left 1144517376 17:15928096-15928118 CCACGCCCGGCCGAGGCCATGGG No data
Right 1144517383 17:15928119-15928141 TTTCAAGAAAGAGGAAGTGATGG No data
1144517374_1144517383 3 Left 1144517374 17:15928093-15928115 CCACCACGCCCGGCCGAGGCCAT No data
Right 1144517383 17:15928119-15928141 TTTCAAGAAAGAGGAAGTGATGG No data
1144517371_1144517383 30 Left 1144517371 17:15928066-15928088 CCAAAGTGCTGGGATTATAGGCG 0: 9370
1: 149078
2: 285159
3: 214832
4: 149190
Right 1144517383 17:15928119-15928141 TTTCAAGAAAGAGGAAGTGATGG No data
1144517378_1144517383 -5 Left 1144517378 17:15928101-15928123 CCCGGCCGAGGCCATGGGTTTCA No data
Right 1144517383 17:15928119-15928141 TTTCAAGAAAGAGGAAGTGATGG No data
1144517379_1144517383 -6 Left 1144517379 17:15928102-15928124 CCGGCCGAGGCCATGGGTTTCAA No data
Right 1144517383 17:15928119-15928141 TTTCAAGAAAGAGGAAGTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144517383 Original CRISPR TTTCAAGAAAGAGGAAGTGA TGG Intergenic
No off target data available for this crispr