ID: 1144518016

View in Genome Browser
Species Human (GRCh38)
Location 17:15932821-15932843
Sequence TAATCAACACAATGTGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144518016_1144518018 25 Left 1144518016 17:15932821-15932843 CCAGCACCACATTGTGTTGATTA No data
Right 1144518018 17:15932869-15932891 ATCAAGAAACGTTCATTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144518016 Original CRISPR TAATCAACACAATGTGGTGC TGG (reversed) Intergenic
No off target data available for this crispr