ID: 1144518866

View in Genome Browser
Species Human (GRCh38)
Location 17:15941124-15941146
Sequence CTTTCACTGGTGAAAGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144518866_1144518870 -3 Left 1144518866 17:15941124-15941146 CCTTCCACTTTCACCAGTGAAAG No data
Right 1144518870 17:15941144-15941166 AAGTCCCACTTGAGTTTCTAGGG No data
1144518866_1144518869 -4 Left 1144518866 17:15941124-15941146 CCTTCCACTTTCACCAGTGAAAG No data
Right 1144518869 17:15941143-15941165 AAAGTCCCACTTGAGTTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144518866 Original CRISPR CTTTCACTGGTGAAAGTGGA AGG (reversed) Intergenic
No off target data available for this crispr