ID: 1144518869

View in Genome Browser
Species Human (GRCh38)
Location 17:15941143-15941165
Sequence AAAGTCCCACTTGAGTTTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144518867_1144518869 -8 Left 1144518867 17:15941128-15941150 CCACTTTCACCAGTGAAAGTCCC No data
Right 1144518869 17:15941143-15941165 AAAGTCCCACTTGAGTTTCTAGG No data
1144518865_1144518869 -3 Left 1144518865 17:15941123-15941145 CCCTTCCACTTTCACCAGTGAAA No data
Right 1144518869 17:15941143-15941165 AAAGTCCCACTTGAGTTTCTAGG No data
1144518866_1144518869 -4 Left 1144518866 17:15941124-15941146 CCTTCCACTTTCACCAGTGAAAG No data
Right 1144518869 17:15941143-15941165 AAAGTCCCACTTGAGTTTCTAGG No data
1144518863_1144518869 28 Left 1144518863 17:15941092-15941114 CCACGGAGGGTCAGTTTGTTCAG No data
Right 1144518869 17:15941143-15941165 AAAGTCCCACTTGAGTTTCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144518869 Original CRISPR AAAGTCCCACTTGAGTTTCT AGG Intergenic
No off target data available for this crispr