ID: 1144519216

View in Genome Browser
Species Human (GRCh38)
Location 17:15943292-15943314
Sequence TTATGCCTGTGGAGGGCAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144519211_1144519216 7 Left 1144519211 17:15943262-15943284 CCTCGTTGGTGCAAGGGCAGATG No data
Right 1144519216 17:15943292-15943314 TTATGCCTGTGGAGGGCAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144519216 Original CRISPR TTATGCCTGTGGAGGGCAGA GGG Intergenic
No off target data available for this crispr