ID: 1144519564

View in Genome Browser
Species Human (GRCh38)
Location 17:15944979-15945001
Sequence GCCCAAAGTTCGCGCCCGCG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 21
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 18}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144519564_1144519569 -7 Left 1144519564 17:15944979-15945001 CCGCGCGGGCGCGAACTTTGGGC 0: 1
1: 0
2: 0
3: 2
4: 18
Right 1144519569 17:15944995-15945017 TTTGGGCTCGGGCGAGTGGGTGG 0: 1
1: 0
2: 0
3: 6
4: 139
1144519564_1144519579 28 Left 1144519564 17:15944979-15945001 CCGCGCGGGCGCGAACTTTGGGC 0: 1
1: 0
2: 0
3: 2
4: 18
Right 1144519579 17:15945030-15945052 CCCGAGACGGGCGGGCGCGCGGG 0: 1
1: 0
2: 1
3: 25
4: 227
1144519564_1144519577 27 Left 1144519564 17:15944979-15945001 CCGCGCGGGCGCGAACTTTGGGC 0: 1
1: 0
2: 0
3: 2
4: 18
Right 1144519577 17:15945029-15945051 GCCCGAGACGGGCGGGCGCGCGG 0: 1
1: 0
2: 2
3: 34
4: 240
1144519564_1144519572 19 Left 1144519564 17:15944979-15945001 CCGCGCGGGCGCGAACTTTGGGC 0: 1
1: 0
2: 0
3: 2
4: 18
Right 1144519572 17:15945021-15945043 TCCGCCCAGCCCGAGACGGGCGG 0: 1
1: 0
2: 0
3: 6
4: 87
1144519564_1144519571 16 Left 1144519564 17:15944979-15945001 CCGCGCGGGCGCGAACTTTGGGC 0: 1
1: 0
2: 0
3: 2
4: 18
Right 1144519571 17:15945018-15945040 TGCTCCGCCCAGCCCGAGACGGG 0: 1
1: 0
2: 1
3: 5
4: 146
1144519564_1144519570 15 Left 1144519564 17:15944979-15945001 CCGCGCGGGCGCGAACTTTGGGC 0: 1
1: 0
2: 0
3: 2
4: 18
Right 1144519570 17:15945017-15945039 GTGCTCCGCCCAGCCCGAGACGG 0: 1
1: 0
2: 0
3: 8
4: 86
1144519564_1144519568 -10 Left 1144519564 17:15944979-15945001 CCGCGCGGGCGCGAACTTTGGGC 0: 1
1: 0
2: 0
3: 2
4: 18
Right 1144519568 17:15944992-15945014 AACTTTGGGCTCGGGCGAGTGGG 0: 1
1: 0
2: 0
3: 1
4: 46
1144519564_1144519574 20 Left 1144519564 17:15944979-15945001 CCGCGCGGGCGCGAACTTTGGGC 0: 1
1: 0
2: 0
3: 2
4: 18
Right 1144519574 17:15945022-15945044 CCGCCCAGCCCGAGACGGGCGGG 0: 1
1: 0
2: 1
3: 12
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144519564 Original CRISPR GCCCAAAGTTCGCGCCCGCG CGG (reversed) Exonic