ID: 1144519632

View in Genome Browser
Species Human (GRCh38)
Location 17:15945196-15945218
Sequence TACCGAAGGCGCGCCGGGCG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 76}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144519632_1144519640 -10 Left 1144519632 17:15945196-15945218 CCTCGCCCGGCGCGCCTTCGGTA 0: 1
1: 0
2: 0
3: 1
4: 76
Right 1144519640 17:15945209-15945231 GCCTTCGGTAGGGGGCGCCCGGG 0: 1
1: 1
2: 1
3: 4
4: 90
1144519632_1144519643 0 Left 1144519632 17:15945196-15945218 CCTCGCCCGGCGCGCCTTCGGTA 0: 1
1: 0
2: 0
3: 1
4: 76
Right 1144519643 17:15945219-15945241 GGGGGCGCCCGGGGCCCAGCTGG 0: 1
1: 0
2: 11
3: 76
4: 598
1144519632_1144519644 5 Left 1144519632 17:15945196-15945218 CCTCGCCCGGCGCGCCTTCGGTA 0: 1
1: 0
2: 0
3: 1
4: 76
Right 1144519644 17:15945224-15945246 CGCCCGGGGCCCAGCTGGCCCGG 0: 1
1: 0
2: 3
3: 32
4: 391
1144519632_1144519642 -9 Left 1144519632 17:15945196-15945218 CCTCGCCCGGCGCGCCTTCGGTA 0: 1
1: 0
2: 0
3: 1
4: 76
Right 1144519642 17:15945210-15945232 CCTTCGGTAGGGGGCGCCCGGGG 0: 1
1: 0
2: 1
3: 4
4: 46
1144519632_1144519652 26 Left 1144519632 17:15945196-15945218 CCTCGCCCGGCGCGCCTTCGGTA 0: 1
1: 0
2: 0
3: 1
4: 76
Right 1144519652 17:15945245-15945267 GGCCATGCTGCTGGAGACACAGG 0: 1
1: 1
2: 6
3: 85
4: 466
1144519632_1144519649 17 Left 1144519632 17:15945196-15945218 CCTCGCCCGGCGCGCCTTCGGTA 0: 1
1: 0
2: 0
3: 1
4: 76
Right 1144519649 17:15945236-15945258 AGCTGGCCCGGCCATGCTGCTGG 0: 1
1: 0
2: 3
3: 15
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144519632 Original CRISPR TACCGAAGGCGCGCCGGGCG AGG (reversed) Exonic
904162252 1:28530622-28530644 CACAGAGGGCGCCCCGGGCGCGG - Intronic
904560738 1:31395514-31395536 GACAGAAGGCGGGGCGGGCGCGG - Intergenic
916372123 1:164109927-164109949 TACTGAGGGAGGGCCGGGCGCGG - Intergenic
917291628 1:173477287-173477309 AAACGAAGGCGCGAGGGGCGGGG - Exonic
923189099 1:231603227-231603249 TACAGAAGCCTGGCCGGGCGTGG + Intronic
924623406 1:245681497-245681519 TACCAAAGACCGGCCGGGCGCGG - Intronic
1066464423 10:35640388-35640410 CAGCGGTGGCGCGCCGGGCGCGG - Exonic
1068933760 10:62616787-62616809 TACTGGAGGCTAGCCGGGCGTGG - Intronic
1077034820 11:489531-489553 TCGCGACGGCGCGGCGGGCGGGG + Intronic
1077056995 11:598640-598662 CACAGAAGCCGCGCCGGGCCCGG + Intronic
1083687342 11:64384518-64384540 GACCGAAGGTGGGCGGGGCGCGG + Intergenic
1087244164 11:95814648-95814670 TACACAAGGCTGGCCGGGCGTGG - Intronic
1091510804 12:1123702-1123724 TACATAAAGCGGGCCGGGCGCGG + Intronic
1093478266 12:19578981-19579003 TACAGAAGGCTGGCCGGGCATGG + Intronic
1098632147 12:72737223-72737245 TACTCAAGTCGGGCCGGGCGCGG + Intergenic
1103091986 12:118104037-118104059 TGCCGAGGGCGCGCCGAGCCGGG + Intronic
1107614868 13:42155723-42155745 TACAGAAGGTGGGTCGGGCGTGG - Exonic
1121751588 14:96362784-96362806 TGCCGGCGGCGAGCCGGGCGGGG - Intronic
1125510726 15:40291140-40291162 CGCCGGAGCCGCGCCGGGCGAGG - Exonic
1131228213 15:90642525-90642547 CACCGAAGGCGGGCCCGGAGTGG + Exonic
1132314375 15:100879663-100879685 TCCCGCAGGGGCGGCGGGCGGGG + Exonic
1140932432 16:79640234-79640256 AACCGGAGGCTGGCCGGGCGCGG + Intergenic
1141538559 16:84700273-84700295 GGACGAAGGCGCGGCGGGCGCGG - Intronic
1143996325 17:11009639-11009661 GACCTAAGGCCGGCCGGGCGCGG + Intergenic
1144092775 17:11872628-11872650 CAGCGAAGGTGGGCCGGGCGCGG + Intronic
1144519632 17:15945196-15945218 TACCGAAGGCGCGCCGGGCGAGG - Exonic
1144851247 17:18245152-18245174 TGCAGAAGGCGCTCCAGGCGTGG + Exonic
1147150309 17:38510360-38510382 CACTGAGGGCGCGGCGGGCGCGG + Exonic
1148704505 17:49617631-49617653 TACAGAAGGCTGGCTGGGCGTGG + Intronic
1149238095 17:54616651-54616673 TGCCAAAGGCGCGTCAGGCGTGG - Intergenic
1152318567 17:79595128-79595150 TACCGATGGCTCTCCAGGCGGGG - Intergenic
1156448779 18:37254583-37254605 TGCCGACGGCGCCCGGGGCGAGG - Intronic
1158934780 18:62354497-62354519 CACCGAGTGCGCGCCGGGCCTGG + Exonic
1166529333 19:43533392-43533414 CGCCGGACGCGCGCCGGGCGGGG + Exonic
1168630032 19:57949420-57949442 TACCAAGGGCGAGCCAGGCGCGG + Intergenic
930864719 2:56111176-56111198 TATGGAAGGCAGGCCGGGCGTGG - Intergenic
937993303 2:127675621-127675643 TGCAGAGGGGGCGCCGGGCGGGG - Intronic
938296303 2:130181689-130181711 AAGCGAAGGCCGGCCGGGCGGGG + Exonic
941487980 2:166105895-166105917 TACAGAAACCGGGCCGGGCGCGG + Intronic
948198862 2:236115096-236115118 TACCGAAGGCCTGCTGGGCACGG - Intronic
948922343 2:241071644-241071666 TCCGGCAGGCGCGCCGGGGGCGG - Exonic
1168757601 20:327248-327270 CAGAGAAGGCGGGCCGGGCGAGG - Exonic
1172456940 20:35084007-35084029 TACAGAAAGCAGGCCGGGCGCGG + Intronic
1174254317 20:49243008-49243030 TACCAAGGGCTCGCCGGGCACGG - Intronic
1176006605 20:62867797-62867819 AACCAAAGGCTGGCCGGGCGCGG + Intergenic
1178361865 21:31955299-31955321 TACCAAAGCAGGGCCGGGCGCGG + Intronic
1184276550 22:43412163-43412185 GACCGGAGGCGGGCGGGGCGCGG + Intronic
1184356215 22:43981142-43981164 CACCGAAGGCGAGCAGGGCCCGG - Intronic
1184663364 22:45975731-45975753 CACAGTAGGCGCGCAGGGCGCGG + Intronic
952334314 3:32391831-32391853 TACAGAGGGCGGGCCGGGGGCGG - Exonic
955687632 3:61562401-61562423 TCCCCAACGCGCGCCGGCCGGGG - Intronic
960702424 3:120451183-120451205 GGCCGAAGGGGCGCCGGACGAGG - Exonic
962277866 3:134029650-134029672 AGCCGAAGGTGCGCCAGGCGCGG + Intronic
968965521 4:3767383-3767405 TACCGAAAACGGGCTGGGCGCGG + Exonic
970218600 4:13784723-13784745 TACCAAAAGCAGGCCGGGCGCGG + Intergenic
971195609 4:24470439-24470461 CACCCAAGGCCCGCCAGGCGGGG + Intergenic
974270608 4:59646607-59646629 TACCGAAGACTGGCAGGGCGTGG - Intergenic
976180141 4:82391089-82391111 TGCCAAAGGCTGGCCGGGCGCGG - Intergenic
976436406 4:85023489-85023511 TGCCGAAGGCAGGCTGGGCGGGG + Intergenic
995438222 5:112160947-112160969 TCACGCAGGGGCGCCGGGCGGGG + Intronic
996302224 5:122001849-122001871 TACCAAAGGATGGCCGGGCGCGG - Intronic
999904997 5:156131017-156131039 TACAGAATGCTGGCCGGGCGTGG - Intronic
1001296828 5:170504339-170504361 TTCCGAAGGCTCGCGGGGAGCGG + Intronic
1001617970 5:173057269-173057291 TGCCGGAGGTGGGCCGGGCGGGG + Intronic
1001954412 5:175838546-175838568 GACAGAAGGGGGGCCGGGCGCGG - Intronic
1002888049 6:1312905-1312927 TGCGGGAGGCGGGCCGGGCGCGG + Exonic
1005044558 6:21629365-21629387 AAACCAAGGCTCGCCGGGCGCGG - Intergenic
1006860910 6:37170899-37170921 TGGGGAGGGCGCGCCGGGCGGGG + Intronic
1009167420 6:60357555-60357577 TACAAAAGGCAGGCCGGGCGTGG - Intergenic
1009558942 6:65213868-65213890 TACTGAAAGCTGGCCGGGCGTGG + Intronic
1022096385 7:27144064-27144086 TGCCGATCGCGCGCCCGGCGAGG + Intronic
1028976393 7:96919056-96919078 TACCCAAGTAGGGCCGGGCGCGG - Intergenic
1049419516 8:142510674-142510696 GCCCGAGGGAGCGCCGGGCGGGG - Intronic
1049807452 8:144547438-144547460 GGCCGAAGGGGCGCGGGGCGCGG - Exonic
1053240703 9:36492525-36492547 TACTGAAGGGGCGCCGGGTGCGG + Intergenic
1061382208 9:130265484-130265506 CGCCGATGGCGCGCCGGGGGCGG - Intergenic
1189426192 X:40903438-40903460 GACCGAATGCTGGCCGGGCGTGG + Intergenic
1196804858 X:119574809-119574831 GTCCCGAGGCGCGCCGGGCGGGG + Intronic