ID: 1144519702

View in Genome Browser
Species Human (GRCh38)
Location 17:15945542-15945564
Sequence CGTGGCAGTCGACAGATACC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 32}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144519696_1144519702 26 Left 1144519696 17:15945493-15945515 CCTGCTTCGTGCTGGTGCTCACG 0: 1
1: 0
2: 1
3: 10
4: 112
Right 1144519702 17:15945542-15945564 CGTGGCAGTCGACAGATACCTGG 0: 1
1: 0
2: 0
3: 2
4: 32
1144519698_1144519702 -4 Left 1144519698 17:15945523-15945545 CCATCTTCAGCCTTCTGGCCGTG 0: 1
1: 0
2: 1
3: 9
4: 180
Right 1144519702 17:15945542-15945564 CGTGGCAGTCGACAGATACCTGG 0: 1
1: 0
2: 0
3: 2
4: 32

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144519702 Original CRISPR CGTGGCAGTCGACAGATACC TGG Exonic