ID: 1144520237

View in Genome Browser
Species Human (GRCh38)
Location 17:15948131-15948153
Sequence GACCTACCCCCAGTTCCTCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 155}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144520237 Original CRISPR GACCTACCCCCAGTTCCTCC CGG Intronic
900530645 1:3151349-3151371 ACCCTACACTCAGTTCCTCCTGG + Intronic
901128784 1:6949199-6949221 GCCCTAACCCCACTTCCCCCAGG - Intronic
901468406 1:9438689-9438711 AACCTTCCCCCAGCTCCCCCAGG + Intergenic
902605886 1:17569172-17569194 ATCCTCCCACCAGTTCCTCCAGG - Intronic
903847598 1:26287731-26287753 TACCTGCCCCCAGCCCCTCCGGG + Intronic
904296045 1:29520496-29520518 GACCTTAGCCCAGTTCCCCCTGG + Intergenic
905807957 1:40890536-40890558 CACCTACCCCCACCACCTCCTGG - Intergenic
912516839 1:110221677-110221699 GACCTACCCTGACTTCCACCTGG - Intronic
913681612 1:121191200-121191222 GGACTACCCCCACTTCCCCCAGG + Intronic
914033447 1:143978837-143978859 GGACTACCCCCACTTCCCCCAGG + Intergenic
915553130 1:156646621-156646643 GCCCTACCTCTAGGTCCTCCAGG - Intronic
915740960 1:158118130-158118152 GAGCTCGCCCCAGTTCTTCCCGG + Intergenic
915952861 1:160201438-160201460 GTCCTTCCCTGAGTTCCTCCAGG + Exonic
919927568 1:202200191-202200213 GGCTTAGCCCCAGCTCCTCCGGG - Intronic
919970682 1:202575572-202575594 GGCCCAACCCCAGTTGCTCCAGG - Intronic
920305390 1:205015190-205015212 CACCCACCCCCAGTCCTTCCTGG - Intronic
920468928 1:206209718-206209740 GGACTACCCCCACTTCCCCCAGG + Intronic
923123395 1:231014687-231014709 GAGCTCTCCCCAGTTCCTCCAGG - Intergenic
924733259 1:246731494-246731516 GGCCAACTCCCAGCTCCTCCAGG - Intronic
924822324 1:247505170-247505192 GACCTACCCCAAGGCCCTGCTGG - Intergenic
1063467374 10:6255919-6255941 GACATTCACCCGGTTCCTCCTGG + Intergenic
1063989570 10:11545263-11545285 GACCTTACCCCAAATCCTCCTGG - Intronic
1065975143 10:30835398-30835420 GAACGACTCCCAGGTCCTCCAGG - Intronic
1067683381 10:48453822-48453844 GACATACCCTCTGTCCCTCCTGG - Intronic
1069591576 10:69645313-69645335 CACCTCGTCCCAGTTCCTCCAGG + Intergenic
1069826108 10:71256278-71256300 GCCCTGGCCCCAGCTCCTCCAGG + Intronic
1070407747 10:76112151-76112173 GCCCTCCCGCCAGCTCCTCCAGG - Intronic
1071116068 10:82221941-82221963 AACCTACTCCCAAATCCTCCAGG + Intronic
1072682046 10:97514637-97514659 GACCTTGCCCCGGTTCCTCGGGG - Intronic
1073024867 10:100480506-100480528 AACCCATCCCCACTTCCTCCTGG - Intronic
1073372962 10:103007189-103007211 GACCTACTCCCTGTTCGTACAGG - Intronic
1075025474 10:118980346-118980368 GGCCTCCCGCCTGTTCCTCCTGG - Intergenic
1075088797 10:119431321-119431343 GGCCTGCCCCGAGCTCCTCCAGG - Intronic
1075297978 10:121294674-121294696 GACCTGCCTCTAGTTCCTCATGG + Intergenic
1078486135 11:11725107-11725129 GTGATCCCCCCAGTTCCTCCAGG - Intergenic
1081572945 11:44302811-44302833 CACCTTACCCCAGTTTCTCCTGG + Intronic
1083705606 11:64512224-64512246 CTCCTGCCCCCTGTTCCTCCAGG + Intergenic
1083857357 11:65399860-65399882 GTACTGCCCCCAGCTCCTCCAGG + Intronic
1084601269 11:70147325-70147347 GACCTCCCCGCATTGCCTCCTGG + Intronic
1085453874 11:76655096-76655118 GACCTCCCCCCAGGACCTCCTGG + Intergenic
1089699568 11:120236288-120236310 GACCCCTCCCCAGGTCCTCCGGG - Intergenic
1090959410 11:131542902-131542924 GACCTACACCCAGATCCTCTAGG + Intronic
1091216520 11:133905709-133905731 GTCCTACCCCCAGTCTCTCCAGG + Intergenic
1094416085 12:30216376-30216398 GACCTCTCCCCATTTCCTCTGGG + Intergenic
1096472430 12:51888067-51888089 GACCAGCCCCAAGATCCTCCGGG - Exonic
1102055718 12:109895030-109895052 CACCTCCTCCCAGTTCCTCAAGG - Intergenic
1103348168 12:120265123-120265145 GACCTGCTCCCCGTCCCTCCAGG - Intronic
1104872847 12:132013047-132013069 GTCCTACACTCAGTTCTTCCGGG + Exonic
1104961645 12:132490846-132490868 CACCTACCTCCAGGGCCTCCAGG - Exonic
1116618469 14:47168089-47168111 GACCTACTCCCATTGCATCCAGG - Intronic
1119133603 14:72196497-72196519 GACATGCCCCCTGTTCCTCCTGG + Intronic
1121339915 14:93099129-93099151 GTCCTCCCCGCAGTTCCACCAGG + Intronic
1122127875 14:99588867-99588889 CAGCTTCCCCAAGTTCCTCCGGG + Intronic
1122199960 14:100116477-100116499 GACCAGCCCCCAGCTCCTCTGGG - Intronic
1122802459 14:104238506-104238528 CACCTCCTCCCTGTTCCTCCGGG + Intergenic
1123117184 14:105900038-105900060 GACCTGCCAGAAGTTCCTCCTGG + Intergenic
1124618866 15:31262723-31262745 GACCTATCACCAGTTCCTCCTGG + Intergenic
1124983602 15:34584513-34584535 GACCTTCGCCCAGGGCCTCCAGG - Intronic
1124999071 15:34753043-34753065 CCCCCACCCCCAGTTCCTCCAGG + Exonic
1127232702 15:57014440-57014462 GACCTTCTCTCATTTCCTCCTGG + Intronic
1127804975 15:62510752-62510774 TGCCTGCCCCCAGTGCCTCCAGG + Intronic
1128313373 15:66645364-66645386 GACCCAGCCCCACCTCCTCCAGG + Intronic
1129737670 15:77975094-77975116 AACCTTCCTCCAGTTCCTCCAGG + Intergenic
1129848410 15:78778525-78778547 AACCTTCCTCCAGTTCCTCCAGG - Intronic
1131513725 15:93064060-93064082 TCCCATCCCCCAGTTCCTCCTGG + Intronic
1131557605 15:93413389-93413411 GACCTCCACCCCATTCCTCCTGG + Intergenic
1136517574 16:30777250-30777272 TACCTTCCCCGAGCTCCTCCAGG + Intergenic
1139287102 16:65825550-65825572 GAGCTACCCCCAGTGCTGCCTGG - Intergenic
1140558383 16:75947733-75947755 GACTTAGTCCCTGTTCCTCCAGG - Intergenic
1141555725 16:84835493-84835515 GACCCACCCCCAGGCCCTCTGGG + Intronic
1141977820 16:87529252-87529274 GACCTGCCTCCAGGTCCTGCTGG - Intergenic
1142001278 16:87665710-87665732 GAACTGCCCCCTCTTCCTCCCGG + Intronic
1142213795 16:88821217-88821239 GAAGGAGCCCCAGTTCCTCCAGG - Intronic
1142965286 17:3577232-3577254 GCCCTTCCCTCAGCTCCTCCTGG - Intronic
1143146613 17:4780740-4780762 CACGTCCCCCCAGATCCTCCAGG - Intronic
1144520237 17:15948131-15948153 GACCTACCCCCAGTTCCTCCCGG + Intronic
1146225290 17:31060700-31060722 CTCTTACCCCCAGCTCCTCCTGG - Intergenic
1146850341 17:36216138-36216160 GACATAGCCACAGTTCTTCCTGG + Intronic
1147591927 17:41689250-41689272 GACCTACCGCCTGCTCCTTCCGG - Intronic
1147613560 17:41815171-41815193 GCCCTACCCCCAGGTCCAGCTGG - Intronic
1147915505 17:43883043-43883065 CACCACCCCCCAGTCCCTCCTGG - Exonic
1151669348 17:75563488-75563510 GGCCCACCCCCAGTGCCTCCTGG + Intronic
1152002237 17:77654147-77654169 GACCTTCCTCTTGTTCCTCCTGG + Intergenic
1156902808 18:42321171-42321193 GACCTTCCCCAAATTGCTCCTGG + Intergenic
1157177897 18:45467858-45467880 GATCTACCTCCACCTCCTCCAGG - Intronic
1161283123 19:3456386-3456408 GCCCTACCCCCAGTTGAACCGGG - Intronic
1161641297 19:5425069-5425091 GATCTCTCTCCAGTTCCTCCTGG + Intergenic
1161709194 19:5838388-5838410 GACAGACACCCACTTCCTCCTGG + Intronic
1162020143 19:7864583-7864605 GGCCTCCCCTCACTTCCTCCTGG + Intronic
1162104504 19:8362241-8362263 AACCTGCCCCGAGTTCTTCCTGG + Intronic
1163349241 19:16764975-16764997 TACCTCCCTCCAGTTCATCCTGG - Intronic
1167276503 19:48543385-48543407 GCACTGCCCCCACTTCCTCCAGG - Intergenic
1168266893 19:55228254-55228276 GGGCTACACCCAGCTCCTCCAGG - Exonic
1168406232 19:56112058-56112080 GCCCTACCCCCAGGACCTCATGG + Intronic
926054169 2:9764394-9764416 GTCCCTCCCCCAGTTCCTCATGG - Intergenic
926294336 2:11557752-11557774 GACCCACATCCAGTTCTTCCAGG - Intronic
930322930 2:49878334-49878356 GACCTTCCCCAAATTGCTCCTGG + Intergenic
936462294 2:112722445-112722467 GACCCCTCCCCAGTGCCTCCTGG - Intronic
937295670 2:120808404-120808426 GACCTCTCCCCAGTGGCTCCTGG + Intronic
938157240 2:128952068-128952090 GACCTATCCCCAAGTCGTCCTGG + Intergenic
939720557 2:145644873-145644895 GACCTTCCCCCACTGCCTGCAGG + Intergenic
947121588 2:226820973-226820995 AACCTTCCCTCTGTTCCTCCAGG + Intergenic
948793626 2:240391487-240391509 GACCCACCCCCTCTTCCTCCAGG + Intergenic
1172309701 20:33908177-33908199 GCCCTGCCCCCAGCTCCTGCAGG - Intergenic
1173333899 20:42097935-42097957 CACCAAGCCCCAGTTCCTCACGG - Intronic
1175498082 20:59429024-59429046 GACCTACCTTCAGTTCCTGTAGG - Intergenic
1175889069 20:62308157-62308179 GACCTCGCCCCAGTTCCAGCAGG + Exonic
1176289556 21:5036906-5036928 GACCTGGCCCCATGTCCTCCAGG - Intronic
1176520524 21:7820886-7820908 CCTCTACCCCCAGTTCCTGCTGG + Intronic
1178654546 21:34450898-34450920 CCTCTACCCCCAGTTCCTGCTGG + Intergenic
1179867674 21:44226681-44226703 GACCTGGCCCCATGTCCTCCAGG + Intronic
1180099105 21:45576095-45576117 GGCCTTCTCCCAGTGCCTCCTGG + Intergenic
1183370035 22:37427133-37427155 GAGCCACCCCCAGTGTCTCCTGG - Intronic
1183528075 22:38336095-38336117 CACCTACCCCCAGCTGCTGCTGG + Intronic
1184681607 22:46075133-46075155 GAGCTTTTCCCAGTTCCTCCTGG - Intronic
1184801259 22:46761831-46761853 CACCCACCCCCAGTCCCCCCCGG + Intergenic
949999176 3:9643046-9643068 GACCTTCCCCAAATTGCTCCTGG - Intergenic
950010291 3:9718189-9718211 GATCTCCCACCAGTTCCCCCTGG + Exonic
950218582 3:11177489-11177511 GAATTATCCCCATTTCCTCCAGG + Intronic
950325568 3:12106157-12106179 GGGCCACTCCCAGTTCCTCCAGG + Intronic
950522456 3:13505183-13505205 GACCTAGCTCCAGCACCTCCTGG - Exonic
954152012 3:48662523-48662545 CACCGCCCCCCAGCTCCTCCTGG + Exonic
958977258 3:100682275-100682297 GCCCCAGACCCAGTTCCTCCTGG - Intronic
970157705 4:13158245-13158267 GAACTTCCTCCAGTTCCTCCAGG + Intergenic
985752034 5:1686289-1686311 GCCCTGTCCCCAGCTCCTCCAGG - Intergenic
986290385 5:6394973-6394995 AACCCACCCCCAGTTCACCCGGG + Intergenic
987065358 5:14284934-14284956 GCCCTCACCCCAGTGCCTCCAGG + Intronic
987261087 5:16204102-16204124 GACCCACTCCCAGGGCCTCCTGG + Intergenic
988509938 5:31856272-31856294 GACCCACCCACAGTTAATCCAGG + Intronic
992118879 5:73570074-73570096 CACCTACCTCAATTTCCTCCCGG + Intronic
999192417 5:149758102-149758124 GACCCATCCCCAGTTCCAGCTGG - Intronic
1001396333 5:171421411-171421433 GACCTGTGTCCAGTTCCTCCTGG - Intronic
1002545838 5:179944636-179944658 GACAGTCCCCCAGTTCCTCAGGG + Intronic
1003195970 6:3915308-3915330 CACCTCCTCCCAGTTCCTCAAGG + Intergenic
1008715626 6:54285992-54286014 GGCCTAACCTGAGTTCCTCCTGG + Intergenic
1008939290 6:57029176-57029198 AACCTCCCCCAAATTCCTCCTGG + Intergenic
1009185346 6:60568326-60568348 GACCATCTCCCAGATCCTCCTGG + Intergenic
1019221719 6:170478631-170478653 GGCCTCACCCCTGTTCCTCCTGG - Intergenic
1020136389 7:5590362-5590384 GCCCCACCCCAAGTCCCTCCGGG - Intergenic
1020398880 7:7751611-7751633 GACAAACACCCAGCTCCTCCTGG + Intronic
1022834650 7:34102201-34102223 GTCCTCCTCCCAGTTCCTCATGG + Intronic
1026247664 7:68635511-68635533 GAGCCACCCCAAGTTGCTCCTGG - Intergenic
1026845737 7:73698242-73698264 CACCAAACTCCAGTTCCTCCTGG + Intronic
1028160060 7:87475540-87475562 GACCTCCACCCAGTGCCCCCGGG - Intronic
1029227241 7:99037060-99037082 CACATACCTCCAGTTCCTTCTGG + Exonic
1032761476 7:134947433-134947455 GACCGACCTCCCCTTCCTCCAGG + Intronic
1033286789 7:140048275-140048297 CACCAACCCCATGTTCCTCCTGG + Intronic
1034441622 7:151088590-151088612 TACCTTCCCCCAGCTCCTTCTGG + Intronic
1035645306 8:1214256-1214278 GTCCTACTCCCAGTTCCACCTGG - Intergenic
1036595425 8:10207461-10207483 GACTCACCCCCAGTTCAGCCTGG + Intronic
1044014977 8:87040058-87040080 GACCTTCCCCAAATTGCTCCTGG - Intronic
1044508378 8:93047823-93047845 TATCGACCCCCAGTTTCTCCTGG + Intergenic
1045684998 8:104702704-104702726 CACCTACCCCCAGTTCAACCAGG - Intronic
1048220455 8:132536369-132536391 TACCTTTCCCCAGTTTCTCCTGG + Intergenic
1052809537 9:33044892-33044914 GACCGCCCCCTAGTCCCTCCAGG + Exonic
1053067735 9:35079996-35080018 GCCACACCCCCAGGTCCTCCTGG + Exonic
1056288300 9:85113982-85114004 CACCTCCTCCCAGTTCCTCAAGG + Intergenic
1056660367 9:88538729-88538751 GACCCACCTCCAATTCCACCTGG - Intronic
1057930565 9:99189548-99189570 GACCCACCCACAGTCCCTACTGG + Intergenic
1061465567 9:130776669-130776691 CAACTCCCCCCAGCTCCTCCAGG - Intronic
1062318352 9:135978791-135978813 GACTTACCCCCAGGCCCTCCTGG - Intergenic
1187278418 X:17836942-17836964 GACTTAGCCCCAGTTGCTCATGG - Intronic
1187285516 X:17899793-17899815 GGCTTCCCCTCAGTTCCTCCTGG - Intergenic
1188354756 X:29177042-29177064 GACAGATCCCCAGTTCCTCTGGG - Intronic
1191219612 X:57974181-57974203 GACCTTCCCCAAATTGCTCCTGG - Intergenic
1193640939 X:84009006-84009028 CCCCTACCCCCTGTGCCTCCAGG - Intergenic
1194403070 X:93461718-93461740 CCCCTACCCCCTGTTGCTCCCGG - Intergenic
1197749491 X:129954856-129954878 GCCCTACCCCCAGTCCTCCCTGG + Intergenic
1197829768 X:130629114-130629136 GCCCTGCCCTCAGTTCCTTCTGG - Intronic
1197937281 X:131752890-131752912 GGCCGGGCCCCAGTTCCTCCTGG + Intergenic
1198726192 X:139679739-139679761 AACCTACGCCAAGTACCTCCTGG + Intronic