ID: 1144521977

View in Genome Browser
Species Human (GRCh38)
Location 17:15958774-15958796
Sequence GAACCCTGTGTGCCCCCCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 161}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144521977 Original CRISPR GAACCCTGTGTGCCCCCCAG AGG (reversed) Intronic
900238798 1:1605074-1605096 GTGCCCTGTATTCCCCCCAGGGG + Intergenic
901654630 1:10762291-10762313 TAACCCTGTGTGGCGCCGAGGGG - Intronic
909874041 1:80779917-80779939 AAAGCCTGAGTTCCCCCCAGGGG + Intergenic
911238384 1:95437182-95437204 GAAGCCAGTGTGCTCCACAGGGG + Intergenic
918310207 1:183280215-183280237 GAACCCTGGGTGGCTCCAAGTGG - Intronic
922209269 1:223475036-223475058 AAACGGTGTCTGCCCCCCAGGGG - Intergenic
922567287 1:226608914-226608936 GAACCCTGCTTGGCCCCTAGAGG - Exonic
922771205 1:228184185-228184207 ACTCCCTGTGTGCACCCCAGGGG - Intergenic
1064104999 10:12493286-12493308 GAGCCCTGTGAGCACCCCAAAGG - Intronic
1067344755 10:45429100-45429122 GAACCCATGGTGCCCCTCAGTGG - Intronic
1067740900 10:48895455-48895477 GAAGCCTGTGTGCCAACCACAGG - Intronic
1069280400 10:66648256-66648278 GGACCCTGTGTTGCCCACAGCGG + Intronic
1069841381 10:71341443-71341465 TAACCCTCTGTGCCCCTCATGGG + Intronic
1073008281 10:100341052-100341074 GAAATCTGTGAGCTCCCCAGGGG + Intergenic
1073458722 10:103653354-103653376 GAAACCTGTTTGTCCCCCAAAGG + Intronic
1074385037 10:113009981-113010003 TAACCCTGTGTGTCACCCACGGG + Intronic
1075093813 10:119458320-119458342 GTATTCTGGGTGCCCCCCAGGGG - Intronic
1077091374 11:779856-779878 CAACCCTGTGTGCCCACCCAGGG + Intronic
1077468715 11:2746856-2746878 GACCCCTGTGAGCCCCACTGGGG + Intronic
1077674422 11:4183877-4183899 GAAAGCTCTGTGCCCCCCAAGGG + Intergenic
1079131428 11:17749020-17749042 GAACCCTGTGAGCACCACGGAGG - Intronic
1079279602 11:19075451-19075473 AAGCCCTGTGTGCCCCAAAGAGG - Intergenic
1080609828 11:33894227-33894249 GCACCCTGTGTGCCTACAAGAGG + Intergenic
1081131102 11:39381404-39381426 GAACCCTGTGGGCCCTGGAGGGG + Intergenic
1083623921 11:64062310-64062332 GAGCCCTGGGTGTCTCCCAGAGG + Intronic
1084152844 11:67299266-67299288 GAGCCCTGTGTACTCCGCAGGGG - Intronic
1084537301 11:69764665-69764687 GAACCCTGGCAGCCTCCCAGTGG + Intergenic
1085296724 11:75435551-75435573 CACCCCTGTGGGCCCCCGAGGGG - Exonic
1086851994 11:91820513-91820535 TAATACTGTGTGCCCTCCAGTGG + Intergenic
1087893226 11:103558585-103558607 AAGCCCTGTGTGTGCCCCAGGGG + Intergenic
1089913787 11:122131123-122131145 GAACCCTGTATTTCCCCTAGGGG - Intergenic
1090976384 11:131683790-131683812 CAACCCAGAGTGCCCCCCAGGGG - Intronic
1091320614 11:134646781-134646803 GAACCCAGGGTGCCCACCACAGG - Intergenic
1092253143 12:6912638-6912660 GAACCCCGAGAGTCCCCCAGAGG + Intronic
1092365196 12:7871712-7871734 GGAACCTGTGTGCCCCCAGGAGG + Intronic
1096558626 12:52419672-52419694 CCACCCTGTCTGTCCCCCAGGGG + Intergenic
1097555089 12:61127141-61127163 GAACCATGTATGCCACCCAGGGG - Intergenic
1103969871 12:124663879-124663901 GGACCCTGTGTGCATCCCGGTGG - Intergenic
1105503204 13:20989592-20989614 GACCCCAGTGTGGTCCCCAGGGG - Intronic
1106172159 13:27297488-27297510 GACCCCTGTGAGGCCCCCACTGG + Intergenic
1108027880 13:46197421-46197443 CAACCCTGTGTGCTCACCAATGG - Intronic
1111613704 13:90638656-90638678 GCACCATGTGTACCTCCCAGGGG - Intergenic
1113559822 13:111269731-111269753 GAAGCTTGTGTGCCCTCCCGAGG + Intronic
1122435024 14:101689365-101689387 CACCCCTGTGGGCTCCCCAGCGG + Intergenic
1123701058 15:22915089-22915111 CAACCCTGTGAGCCCTTCAGTGG + Intronic
1125683044 15:41544801-41544823 GAACGCTGTGTCCCTGCCAGGGG - Intergenic
1128527780 15:68424094-68424116 GATCCCTGTGTGGCCCCAAGGGG - Intronic
1128889563 15:71318541-71318563 AAACCCTGAGTGCCTCCAAGAGG - Intronic
1130966600 15:88701769-88701791 GAACCAGGTGTTCCCGCCAGAGG - Intergenic
1132600169 16:769611-769633 GCAGCCTGTGGGCCCCCCTGGGG - Exonic
1138343822 16:56307903-56307925 GAACCCTCCGTGCTCCCCACTGG - Intronic
1142719528 17:1766970-1766992 GAACCCTGCCAGCCCCCCGGAGG + Exonic
1144521977 17:15958774-15958796 GAACCCTGTGTGCCCCCCAGAGG - Intronic
1146126616 17:30236093-30236115 GACCCCTGTGTGCCGTCCTGTGG - Intergenic
1148123396 17:45224955-45224977 TGACCCTGCGTGCCTCCCAGGGG - Intronic
1149542594 17:57479036-57479058 GAAGACTGTGTGTGCCCCAGGGG + Intronic
1152762309 17:82115216-82115238 GAGCCCTGTGTGATCTCCAGCGG + Intronic
1153772363 18:8426104-8426126 GGAGCATGAGTGCCCCCCAGGGG - Intergenic
1154001814 18:10487956-10487978 GGACCAGGTGTGCCTCCCAGGGG - Exonic
1154490005 18:14914305-14914327 AAAGCCTGTGAGCCTCCCAGAGG - Intergenic
1157321070 18:46635030-46635052 GAACCCTGTGTTCCAGACAGGGG - Intronic
1160014406 18:75129330-75129352 AAAGCCTGTGTGCCCCCGACGGG + Intergenic
1160173421 18:76573045-76573067 CAACCCTGTGTGGCCCCGTGTGG - Intergenic
1160364320 18:78311570-78311592 GAGCCCAGTGTGACCCTCAGAGG + Intergenic
1160844957 19:1162076-1162098 GAGCCCTGTGTCCCCCACAAAGG - Intronic
1161627514 19:5335871-5335893 GCACCCTCTGCGCCCCGCAGAGG - Intronic
1163442945 19:17330676-17330698 GGGCTCTGTGTGCTCCCCAGGGG - Intronic
1164558321 19:29270069-29270091 GCTGCCTGTGTGCCCCACAGTGG - Intergenic
1166001797 19:39881866-39881888 GAAACCTCTGTGCCACCCAGTGG + Intronic
1166004578 19:39898117-39898139 GAAACCTCTGTGCCACCCAGTGG + Intronic
1168160714 19:54508615-54508637 GGACCCTGTGTTCTGCCCAGTGG - Intronic
1168328719 19:55553493-55553515 TAACCCTGTATTTCCCCCAGTGG + Intergenic
1168588502 19:57614153-57614175 GAAACCTGTGCGCCGCCCGGCGG + Intergenic
925688554 2:6496514-6496536 GACGCCTGTGTGGTCCCCAGTGG + Intergenic
926139480 2:10359763-10359785 GATCCCCGTGTCCCCCACAGCGG + Intronic
929552038 2:42900421-42900443 GAACCATGTGTGACCAGCAGAGG - Intergenic
932663837 2:73680372-73680394 GAGCCATGAGTGCCCCCTAGAGG - Intergenic
933987092 2:87601195-87601217 GTACCCTGTGTGGCCCACACTGG + Intergenic
935407591 2:102725234-102725256 GAACCCTGTGAAGCCCCCCGTGG + Intronic
935557078 2:104521493-104521515 GACCCCTGAGTGCCCCCAAAAGG + Intergenic
936090810 2:109500352-109500374 GAGCTCTGAGTGCACCCCAGGGG - Intronic
936306750 2:111349613-111349635 GTACCCTGTGTGGCCCACACTGG - Intergenic
938386586 2:130871093-130871115 GGCCCCTTTATGCCCCCCAGAGG - Intronic
940581560 2:155586300-155586322 GAACCCTGTCTGCCTGACAGTGG + Intergenic
942430541 2:175906658-175906680 GAACCCTTTTTGACCCCAAGGGG + Intergenic
944110939 2:196130645-196130667 GCACTGTGTGTGCCACCCAGTGG + Intergenic
945511980 2:210714137-210714159 GAACCTGGTGTGTCCCCCATTGG - Intergenic
946842890 2:223836168-223836190 GCACCCTGTGGGCCCACCGGAGG - Intronic
946865188 2:224036260-224036282 GAACCCTGGGTAACCCCAAGAGG + Intronic
948020570 2:234729958-234729980 CAACCCTGTCTGCCCACAAGAGG - Intergenic
948988345 2:241539737-241539759 GAGGCCTCTGTGCCACCCAGTGG + Intergenic
1169198748 20:3697434-3697456 CAACCCTGTGGGCACCCCAGGGG - Intronic
1171747728 20:29014376-29014398 GAGCCCTTTGTGGCCCACAGTGG + Intergenic
1171849084 20:30295429-30295451 GAGCCCTGTGTCCCTCCCTGAGG + Intergenic
1172109792 20:32538236-32538258 GAACCCTCCCTGCCCCCCAAAGG - Intronic
1172520129 20:35560741-35560763 GACACCTGTGTGCCCAGCAGGGG + Intergenic
1174428444 20:50449934-50449956 CAGCCCTGTGAGCCCCTCAGTGG + Intergenic
1175292127 20:57882795-57882817 GAGCCCTGTGAGCCCCCAGGAGG - Intergenic
1175899670 20:62355029-62355051 GGACCCTGTGGGCCCGTCAGGGG - Intronic
1176131175 20:63497469-63497491 GAGGCCTGAGTGCCCCACAGCGG + Intronic
1176317808 21:5265373-5265395 GAGCCCTTTGTGGCCCACAGTGG - Intergenic
1176475672 21:7202148-7202170 GAGCCCTTTGTGGCCCACAGTGG - Intergenic
1177889294 21:26785733-26785755 GAACCCTCTGTGCTCCACATTGG - Intergenic
1177948289 21:27500826-27500848 TGACCCTGTGTGCCTGCCAGTGG + Intergenic
1179569431 21:42269361-42269383 GAGCCATGGGTGCCCCTCAGTGG - Intronic
1180046524 21:45308826-45308848 GGACCCTTTCTGCCCCCCAGCGG - Intergenic
1180163156 21:46006965-46006987 GAACCCAGTGTGCAGCCCAGGGG - Intergenic
1180395482 22:12329732-12329754 GAGCCCTTTGTGGCCCACAGTGG - Intergenic
1180404263 22:12535019-12535041 GAGCCCTTTGTGGCCCACAGTGG + Intergenic
1182301647 22:29340419-29340441 GAATCCTGTCTGCCTCTCAGGGG + Intronic
1183396061 22:37571561-37571583 GAACTCTGTCTGGCCCCCTGCGG - Intronic
1184244920 22:43231051-43231073 GTACCCTGTGGGCCCCACACTGG - Intronic
1184369924 22:44075827-44075849 GTTCCCTGTTTGCCTCCCAGAGG + Intronic
1184817585 22:46884047-46884069 GAACGCTGTTTGCCCCACAACGG - Intronic
950640158 3:14343542-14343564 GATCCCGGTGGGCTCCCCAGGGG - Intergenic
954628284 3:52034778-52034800 GCACCCTGTGTGCCCCCAGGTGG - Intergenic
954638626 3:52085129-52085151 TAACCCAGTGTGGCCGCCAGGGG - Intronic
955507260 3:59644860-59644882 GAACCCTCTGTGCCCGCTTGGGG - Intergenic
960159212 3:114331528-114331550 GAAGTGTGTGTGCCCCCCAAAGG - Intergenic
961785458 3:129344330-129344352 GCACCCTGTCTGCCCCTCGGGGG + Intergenic
963401274 3:144802505-144802527 GCAGCCTGTGTGGACCCCAGAGG - Intergenic
963914529 3:150845936-150845958 GAACCTTGTGTGCACCCATGGGG - Intergenic
965490222 3:169325929-169325951 CAACCCTGTGTGCCTGCCACTGG + Intronic
965638849 3:170812137-170812159 AAACCATGAGTGCCCCCTAGTGG + Intronic
968529739 4:1085077-1085099 GAGCCCTGTCTGCCTCCCATTGG - Intronic
968609064 4:1548970-1548992 GGACCCTGTGCGGCCCCAAGCGG + Intergenic
968663833 4:1810169-1810191 GATCCCACTGTGCCCACCAGAGG - Intergenic
969321710 4:6416827-6416849 GCTCCCTGTGTGTGCCCCAGGGG + Intronic
970433088 4:16006964-16006986 GAACCCTGTGTGACACCCGTGGG - Intronic
981232096 4:142368856-142368878 GAATCCTGTGTTTCCCCCAAGGG - Intronic
983690773 4:170465887-170465909 CAACCCTGTGTGGAACCCAGGGG - Intergenic
984607982 4:181806603-181806625 GAAGGCTGTGTGCCCCGAAGGGG - Intergenic
985626670 5:992487-992509 GAACCCTGTGTGCAGCTGAGAGG + Intergenic
985753059 5:1693862-1693884 CAATCCTGTGGTCCCCCCAGGGG + Intergenic
985988767 5:3538445-3538467 GTCCCCTGTGTGCCCCCCTGTGG - Intergenic
986725654 5:10594602-10594624 GAACCCCATGTGGCTCCCAGGGG - Intronic
993115744 5:83718389-83718411 GGTCCCTGTGTGCCACCTAGTGG - Intronic
997977308 5:138448057-138448079 GATCCCAGTGAGGCCCCCAGGGG + Intergenic
998862265 5:146455772-146455794 TAACCCTATTTTCCCCCCAGGGG - Intronic
998947199 5:147352543-147352565 GAATACTGTGTGCCCCCTCGAGG - Intronic
1002348022 5:178561486-178561508 GAACCCTATGGGCACCCCTGAGG + Intronic
1003797925 6:9626839-9626861 GAACCATCTTTGCCTCCCAGAGG + Intronic
1005873526 6:29994782-29994804 GATCTCTATTTGCCCCCCAGAGG - Intergenic
1013416991 6:109934139-109934161 GAACCTGGTGTGCTCCTCAGGGG + Intergenic
1019809559 7:3155066-3155088 AAGCACTCTGTGCCCCCCAGTGG + Intronic
1023707728 7:42959776-42959798 GAATCCTGGGTGCCCCAAAGAGG + Intergenic
1025014793 7:55430454-55430476 CATCCCTGTGGTCCCCCCAGAGG - Intronic
1026928758 7:74211153-74211175 GGACCCTCTGAGGCCCCCAGGGG - Intronic
1032264146 7:130359086-130359108 GAACCCTCTGCTTCCCCCAGGGG + Intronic
1033548916 7:142427390-142427412 GAACCCTGTGTGACCTCCCCGGG - Intergenic
1033555894 7:142488413-142488435 GAACCCAGAGTGGCCCCAAGTGG + Intergenic
1034999841 7:155603969-155603991 GAAGCCAGGGTGCCCCCAAGGGG - Intergenic
1039404594 8:37301665-37301687 GATCCATGTGTGCCTCCCACTGG - Intergenic
1039424440 8:37474345-37474367 CATCCCTGTGTGCTCCCCACAGG - Intergenic
1043350090 8:79349989-79350011 GAACCCTTTGGGTCCCCCATAGG + Intergenic
1048995186 8:139789725-139789747 GAAGCCTGTGTGGGTCCCAGGGG + Intronic
1049237827 8:141521315-141521337 GAACACTGTGTGGCCCACAGTGG + Intergenic
1049256382 8:141616101-141616123 GCACACTGTGTGCCCACCAAGGG - Intergenic
1049451108 8:142662039-142662061 GAATCCCTTGTGCCACCCAGGGG - Intronic
1052342506 9:27377874-27377896 GAACCCTAGGTCCCCCACAGGGG + Intronic
1053786806 9:41658149-41658171 GAGCCCTGTGTCCCTCCCTGAGG + Intergenic
1054158255 9:61656046-61656068 GAGCCCTGTGTCCCTCCCTGAGG - Intergenic
1054478028 9:65587051-65587073 GAGCCCTGTGTCCCTCCCTGAGG - Intergenic
1057816796 9:98301926-98301948 GAATTCTGTGAGCCCCCCAAAGG + Intronic
1058417820 9:104806264-104806286 GCTGCCTGTGTGTCCCCCAGGGG - Exonic
1061383762 9:130276227-130276249 GCACCCTGCCTGGCCCCCAGGGG - Intergenic
1062345542 9:136112840-136112862 GGGCTCTGTGTGCCCCACAGGGG - Intergenic
1062491298 9:136806336-136806358 CAAGCCTGTGTGTCCCACAGAGG + Intronic
1203411106 Un_KI270579v1:4837-4859 GAGCCCTTTGTGGCCCACAGTGG - Intergenic
1188870430 X:35364832-35364854 GAAACCAGTGTATCCCCCAGGGG + Intergenic
1189510391 X:41656085-41656107 GAACCCTGTGTGCTCCCTCGAGG + Intronic
1190050685 X:47146525-47146547 GAACCCTGTGACCCAGCCAGAGG - Intronic
1191943358 X:66503268-66503290 TAACCCTGTCTGCCCCCTTGGGG - Intergenic
1198800176 X:140439897-140439919 GACCCCTGTATGCCCCCCTCCGG - Intergenic