ID: 1144522984

View in Genome Browser
Species Human (GRCh38)
Location 17:15966749-15966771
Sequence TTTGCAGGCCCACACAACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 133}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144522984_1144522991 4 Left 1144522984 17:15966749-15966771 CCCCTGTTGTGTGGGCCTGCAAA 0: 1
1: 0
2: 0
3: 5
4: 133
Right 1144522991 17:15966776-15966798 GGGATTGTTTCTGCCTTGTTTGG 0: 1
1: 0
2: 2
3: 20
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144522984 Original CRISPR TTTGCAGGCCCACACAACAG GGG (reversed) Intronic
902638729 1:17752209-17752231 TTTGCAGTGCCTCACATCAGAGG - Intergenic
909116695 1:71546225-71546247 TTTCCAGACACACTCAACAGAGG + Intronic
915147000 1:153801251-153801273 TTTGCGGGCCTACTCAGCAGAGG + Intergenic
917716355 1:177741643-177741665 ATTGCAGGCCCAATCAACAAAGG + Intergenic
919855882 1:201705704-201705726 CTGGCAGGCCCCCACACCAGAGG - Intronic
922208484 1:223469256-223469278 TTTGGAGGGCCACAAAACATTGG + Intergenic
1062916155 10:1242363-1242385 TTTTCAGGGTCTCACAACAGCGG + Intronic
1063171803 10:3516071-3516093 GTTCCAGGCCCACAAAACTGTGG - Intergenic
1063647573 10:7900499-7900521 CTTTCAGGACCACACAATAGTGG - Intronic
1065889801 10:30111123-30111145 TCAGCAGGCCCATACATCAGGGG - Intronic
1067020511 10:42792740-42792762 TTTGCAGGCCTACACATAGGTGG - Intronic
1067546693 10:47196993-47197015 TTTGCGGGCCCACCCTGCAGAGG - Intergenic
1070541156 10:77416297-77416319 GCTGCTGGCCCACACAATAGGGG + Intronic
1075640111 10:124058496-124058518 TTTGCAGCCACACAGACCAGCGG - Intronic
1078577406 11:12513785-12513807 TTTGCAGTCCCATACAACTCAGG - Intronic
1078736387 11:14024602-14024624 TTAGCAGGCACACACACAAGCGG - Intronic
1083791058 11:64986201-64986223 ATTGCAGGCCCAGACTTCAGGGG - Intergenic
1084247800 11:67872040-67872062 TTTCCAGGCACAGACTACAGGGG - Intergenic
1085681917 11:78584302-78584324 TTAGTAGACCCACACTACAGAGG + Intergenic
1085708751 11:78810405-78810427 TTTCCTGGCCCACACAACATGGG + Intronic
1086875227 11:92087825-92087847 TTTACAGGCCACCACAAAAGGGG + Intergenic
1087771184 11:102212076-102212098 TTTTCAGCCCCAAAGAACAGAGG + Intronic
1089103164 11:115981242-115981264 TTTCCAGGCCCACACAGCCTGGG + Intergenic
1090204841 11:124878453-124878475 CTTCCAGGCCCACACACCTGCGG + Intronic
1092418082 12:8307435-8307457 TTTCCAGGCACAGACTACAGGGG - Intergenic
1093692284 12:22121940-22121962 TTAGCAGGCACACACACAAGTGG - Intronic
1096218287 12:49810233-49810255 TTTATAGGACCACACACCAGGGG + Intronic
1099983711 12:89637836-89637858 TTTAAAGACCAACACAACAGAGG + Intronic
1101891994 12:108725457-108725479 TTTGCATCTCCACACTACAGAGG + Intronic
1102092090 12:110199754-110199776 GATGCAGTCCCACACAACAAAGG + Intronic
1104216768 12:126741515-126741537 TTCGGAGGCATACACAACAGAGG + Intergenic
1106185730 13:27408244-27408266 TGTGCAGGGCCACACAGCGGCGG + Intergenic
1106483550 13:30154523-30154545 TTTCCAAGCCCACACACCTGAGG + Intergenic
1113725599 13:112598356-112598378 TAGGCAGGAACACACAACAGTGG + Intergenic
1118748049 14:68788054-68788076 TTTGCAGTCCAACACAAAGGGGG + Exonic
1119657020 14:76424495-76424517 TGTGCAGGCCCACACAACGAAGG - Intronic
1122337046 14:100999012-100999034 TTTGTAACCCCACAGAACAGAGG + Intergenic
1126259302 15:46669206-46669228 TTTGCTGCCCCACAGAACACTGG - Intergenic
1127005006 15:54559034-54559056 TGTTCAGGCCCATATAACAGGGG - Intronic
1127277908 15:57463561-57463583 CTTGCTGGCCCACACCCCAGTGG - Intronic
1128682446 15:69661794-69661816 TTTGCAGATCCACCCAACACTGG - Intergenic
1132392802 15:101451000-101451022 CTTGCAGGGCCACACAAGGGAGG + Intronic
1133357437 16:5147036-5147058 TTTCCAGGCACAGACTACAGGGG - Intergenic
1133914636 16:10098117-10098139 TTAGCAAGCCCAAACAAAAGTGG + Intronic
1134290372 16:12899729-12899751 GTACCAGGCCCACACAACAGAGG - Intergenic
1135190114 16:20347950-20347972 TTCTGAGGCCCACACCACAGTGG - Intronic
1136269435 16:29139743-29139765 TCTGCAGCCACACACCACAGGGG + Intergenic
1136775915 16:32871777-32871799 TTTGCAGGCCCCCAAAGTAGAGG - Intergenic
1136894701 16:33989735-33989757 TTTGCAGGCCCCCAAAGTAGAGG + Intergenic
1138123103 16:54416236-54416258 TCTGCAGGGCCACACTCCAGGGG - Intergenic
1142072913 16:88101013-88101035 TCTGCAGCCACACACCACAGGGG + Intronic
1203078331 16_KI270728v1_random:1133886-1133908 TTTGCAGGCCCCCAAAGTAGAGG - Intergenic
1142558192 17:793825-793847 TGGGCAGGCCCAGACCACAGTGG - Intergenic
1143994819 17:10997273-10997295 TTTGCAGGCACAAACAAGCGTGG - Intergenic
1144522984 17:15966749-15966771 TTTGCAGGCCCACACAACAGGGG - Intronic
1146957253 17:36942816-36942838 CTCGCAGGCCCAGACACCAGTGG + Exonic
1147612008 17:41807373-41807395 TTCCCAGGACCACACAGCAGTGG + Intronic
1147657066 17:42097044-42097066 TTTGCTGTCCCACACATGAGGGG + Intergenic
1148694214 17:49549387-49549409 GTTGCAGGCGCACACAGAAGGGG + Intergenic
1151950512 17:77350998-77351020 TGTGCAGGCACACACCACACAGG - Intronic
1162807455 19:13145395-13145417 TCTGCAGGGGCACACAACATAGG + Exonic
1168692822 19:58387025-58387047 TTTGCAGGCGCCCACAAGACAGG + Intronic
926595781 2:14788598-14788620 TTTGCCTGGCCACAGAACAGCGG + Intergenic
928989738 2:37220410-37220432 TTTTCAGCTCCACAGAACAGAGG + Exonic
931228445 2:60353525-60353547 GTTGCAGGCCCAGGCAGCAGCGG + Intergenic
935400550 2:102655932-102655954 GATGAAGGCCCTCACAACAGAGG - Intronic
936514439 2:113173022-113173044 CTTGCATGTCCACACAGCAGTGG - Intronic
940084998 2:149849269-149849291 TTAGCAATGCCACACAACAGGGG - Intergenic
941090873 2:161173843-161173865 TTTAGAGACCCACAAAACAGTGG + Intronic
1176162602 20:63655465-63655487 CTAGCAGGAACACACAACAGGGG + Intergenic
1177594742 21:23224059-23224081 TTAGCAGGCAGACACATCAGGGG - Intergenic
1180115085 21:45697891-45697913 TTATGAGGCTCACACAACAGAGG - Intronic
1180918499 22:19506098-19506120 TTTCCAAGGCCACACAATAGTGG + Intronic
1182061680 22:27402816-27402838 TGTGCAGGCCCACACGACATGGG - Intergenic
1184850254 22:47115699-47115721 TCTGCAGGCCCAATCAGCAGGGG - Intronic
952507690 3:34022359-34022381 TTTGCATGTCTACACAAAAGGGG - Intergenic
953574439 3:44101754-44101776 TTTGCAGGCAGAAACACCAGCGG + Intergenic
956936521 3:74107871-74107893 TCTCCAGGCACATACAACAGTGG + Intergenic
957062008 3:75489865-75489887 TTTCCAGGCACAGACTACAGGGG - Intergenic
961291395 3:125849536-125849558 TTTCCAGGCACAGACTACAGGGG + Intergenic
961380371 3:126492745-126492767 TCTGGAGGCCCAGACTACAGTGG - Intronic
967465871 3:189805758-189805780 ATTGCAGGCCAACAAAACAATGG + Intronic
969005901 4:4019956-4019978 TTTCCAGGCACAGACTACAGGGG - Intergenic
969807048 4:9617334-9617356 TTTCCAGGCACAGACTACAGGGG + Intergenic
971241766 4:24895778-24895800 TCTTCAGGCTCCCACAACAGAGG + Intronic
972124148 4:35741839-35741861 TTTGCAGGCATTCACCACAGTGG - Intergenic
978509684 4:109502904-109502926 ATTGCAGACACACACAACAATGG - Intronic
979153505 4:117351672-117351694 TTTTCAGCCACACATAACAGAGG - Intergenic
981423769 4:144580901-144580923 ATAGCAGGCACACACAAAAGCGG + Intergenic
984290788 4:177791416-177791438 CTTGCAGGAAGACACAACAGAGG - Intronic
986104182 5:4644124-4644146 TGTGCAGTCCCGCACAGCAGAGG + Intergenic
986458485 5:7944306-7944328 TTTGCTGACGCAGACAACAGAGG - Intergenic
987027683 5:13943964-13943986 TTTGCAGGCATATAGAACAGGGG + Intronic
987182892 5:15385694-15385716 TTAGCAGGCACACACATAAGTGG - Intergenic
988870650 5:35385356-35385378 CCTGCAGGCCTACACCACAGTGG - Intergenic
990364853 5:55060133-55060155 TTTACATTCCCACTCAACAGTGG - Intergenic
994034433 5:95182644-95182666 TTTACAGTCCCACACCACTGTGG + Intronic
1002721288 5:181262604-181262626 TTTGTAGTCCCAGAGAACAGAGG + Intergenic
1002901519 6:1413870-1413892 ATTTCAGGCACACACAGCAGAGG + Intergenic
1004799871 6:19134631-19134653 TTAGCAGGCACACACACAAGTGG + Intergenic
1007807706 6:44462864-44462886 TTTGCTGCTCCACACAGCAGGGG + Intergenic
1008384241 6:50869929-50869951 GTTGCACGCCCAAACATCAGGGG - Intergenic
1010869624 6:81021492-81021514 TTTCCAGGTCCAGATAACAGTGG + Intergenic
1011526669 6:88272970-88272992 TTTGCAAGCAGAAACAACAGTGG + Intergenic
1012424522 6:99099351-99099373 TTTGCAGGTGCAAAGAACAGTGG + Intergenic
1014129238 6:117811725-117811747 TTAGCAGGCCGACACATCTGAGG - Intergenic
1014623511 6:123698738-123698760 TTTCCAAGCACAGACAACAGAGG - Intergenic
1022206752 7:28171898-28171920 TCTGCAGGCCCACAAAACTTGGG - Intronic
1022427281 7:30281448-30281470 TTTGCTGTCCCACACATCAAAGG + Intergenic
1022913993 7:34928302-34928324 TTTGCTGGGCCCCACCACAGAGG - Intergenic
1023864957 7:44234192-44234214 ATTGGAGCCCCCCACAACAGTGG + Intronic
1023885071 7:44348630-44348652 ATACCAGGTCCACACAACAGTGG - Intergenic
1024491789 7:49994252-49994274 TATGCAGGACCACCCAAAAGTGG - Intronic
1024532000 7:50401068-50401090 CCTGCAGACCCACACAGCAGGGG - Exonic
1028952759 7:96655310-96655332 TTTGCACAACCACACAACAATGG - Intronic
1030668122 7:112304435-112304457 TTTGGAAGCCCTCACACCAGGGG - Intronic
1031073550 7:117190215-117190237 TTGGCAGGCAGACACCACAGGGG - Intronic
1031168825 7:118265071-118265093 TTCCCAGGCTGACACAACAGGGG - Intergenic
1031234298 7:119153189-119153211 ATTGCAAGCTCTCACAACAGAGG - Intergenic
1033896252 7:146074096-146074118 TTAGCAGGCACACACACAAGTGG + Intergenic
1035772211 8:2156588-2156610 TTGTCACGCCCACCCAACAGAGG - Intronic
1036133921 8:6141300-6141322 TTTGCAGGTGCACAGAACTGGGG + Intergenic
1036487765 8:9195108-9195130 TGTTCAGGCCCCCACAGCAGAGG - Intergenic
1036955901 8:13188055-13188077 TAAGCAGGTCCATACAACAGTGG + Intronic
1041599468 8:59699429-59699451 TTCTCAGGCTCACAGAACAGTGG - Intergenic
1046100742 8:109611215-109611237 TTGGCAGGCCCCCAAATCAGTGG + Intronic
1049332466 8:142062255-142062277 TTCTCAGGCACACACAGCAGAGG - Intergenic
1050752211 9:8952981-8953003 TTTGCAGGCCCAGAAATCTGTGG + Intronic
1054909598 9:70441997-70442019 TTTGCAGCCCTACAAAATAGAGG + Intergenic
1055622513 9:78141255-78141277 TTTGTAGGCACACTCAAAAGTGG - Intergenic
1057461863 9:95270313-95270335 CTTGCAGGCCAACACGAGAGGGG + Intronic
1061861024 9:133468901-133468923 TCTGCAGACCCACCCAGCAGAGG - Exonic
1062594801 9:137294770-137294792 TTTGCAGGCTCACAGACCTGAGG + Intergenic
1187982839 X:24777573-24777595 TGTGCAGGTGCACACAACACAGG + Intronic
1196528758 X:116759035-116759057 TTTGCAGGACCTCCCAACTGGGG + Intergenic
1197836820 X:130703539-130703561 TTTTCAAGCATACACAACAGAGG + Intronic
1199682740 X:150238919-150238941 CTTGCAGGGCCCCACAACAGAGG - Intergenic
1200103971 X:153702260-153702282 TTTGCAGGCCCCCAAAGTAGAGG + Intronic
1201509527 Y:14743538-14743560 TGGGCAGGCCCACACAGCATTGG + Intronic