ID: 1144524375

View in Genome Browser
Species Human (GRCh38)
Location 17:15977906-15977928
Sequence CTGCAGTCCTGGAGGGAAAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 344}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144524361_1144524375 13 Left 1144524361 17:15977870-15977892 CCCTCCACAGCCCACGGCTCCAA 0: 1
1: 0
2: 1
3: 20
4: 302
Right 1144524375 17:15977906-15977928 CTGCAGTCCTGGAGGGAAAAGGG 0: 1
1: 0
2: 2
3: 33
4: 344
1144524365_1144524375 2 Left 1144524365 17:15977881-15977903 CCACGGCTCCAACCCACAGCACC 0: 1
1: 0
2: 2
3: 29
4: 328
Right 1144524375 17:15977906-15977928 CTGCAGTCCTGGAGGGAAAAGGG 0: 1
1: 0
2: 2
3: 33
4: 344
1144524363_1144524375 9 Left 1144524363 17:15977874-15977896 CCACAGCCCACGGCTCCAACCCA 0: 1
1: 0
2: 0
3: 46
4: 388
Right 1144524375 17:15977906-15977928 CTGCAGTCCTGGAGGGAAAAGGG 0: 1
1: 0
2: 2
3: 33
4: 344
1144524364_1144524375 3 Left 1144524364 17:15977880-15977902 CCCACGGCTCCAACCCACAGCAC 0: 1
1: 1
2: 1
3: 13
4: 207
Right 1144524375 17:15977906-15977928 CTGCAGTCCTGGAGGGAAAAGGG 0: 1
1: 0
2: 2
3: 33
4: 344
1144524367_1144524375 -10 Left 1144524367 17:15977893-15977915 CCCACAGCACCTCCTGCAGTCCT 0: 1
1: 0
2: 3
3: 46
4: 397
Right 1144524375 17:15977906-15977928 CTGCAGTCCTGGAGGGAAAAGGG 0: 1
1: 0
2: 2
3: 33
4: 344
1144524366_1144524375 -6 Left 1144524366 17:15977889-15977911 CCAACCCACAGCACCTCCTGCAG 0: 1
1: 0
2: 5
3: 70
4: 534
Right 1144524375 17:15977906-15977928 CTGCAGTCCTGGAGGGAAAAGGG 0: 1
1: 0
2: 2
3: 33
4: 344
1144524362_1144524375 12 Left 1144524362 17:15977871-15977893 CCTCCACAGCCCACGGCTCCAAC 0: 1
1: 0
2: 1
3: 19
4: 270
Right 1144524375 17:15977906-15977928 CTGCAGTCCTGGAGGGAAAAGGG 0: 1
1: 0
2: 2
3: 33
4: 344

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144524375 Original CRISPR CTGCAGTCCTGGAGGGAAAA GGG Exonic
900535931 1:3177524-3177546 CAGCAGCCCTGGAGGGAAGGTGG - Intronic
900803921 1:4755100-4755122 CTCCTGTCCTGGTGGGAGAAGGG + Intronic
900908968 1:5580601-5580623 CTGGGGTCCTGGAAGGAAGAGGG - Intergenic
900936288 1:5768296-5768318 ATACAGTCATGGAGGGAAGATGG - Intergenic
901281572 1:8040361-8040383 CTACAGGCCAGGAGAGAAAATGG - Intergenic
901857061 1:12051351-12051373 CTGGGGGCCTGGAGGCAAAATGG + Intergenic
903835730 1:26202236-26202258 CTGAACTCCTGGAGAGAAAAAGG + Intronic
903959011 1:27044910-27044932 CTCCAGTGCTGGAGGGAAAGGGG - Intergenic
904290178 1:29479964-29479986 CTGCATTCCAGGCAGGAAAAAGG - Intergenic
904370920 1:30046907-30046929 CTGCAGTTCAGGAGAGAACACGG + Intergenic
904616955 1:31755141-31755163 CAGGAGACCTGGAGGGAACAGGG - Intronic
905521380 1:38603150-38603172 CTGCACTTCTGGAGAAAAAAAGG + Intergenic
905696793 1:39980614-39980636 CAGCTGCCCTGGAGGGAAAAAGG - Intergenic
907664874 1:56425876-56425898 CTACAGTCTAGGAGGGGAAATGG + Intergenic
907664876 1:56425967-56425989 CTACAGTCTAGGAGGGAAAATGG - Intergenic
909141522 1:71872516-71872538 ATGCTTTGCTGGAGGGAAAAGGG - Intronic
910040834 1:82850193-82850215 CTCCAGACCTGAAGGGGAAATGG + Intergenic
915057396 1:153147191-153147213 CTGCAATTCTGGAGGAAAACAGG + Intergenic
915346747 1:155201384-155201406 CTTCAGGCGTGGAAGGAAAAGGG - Intronic
915834791 1:159168178-159168200 CTCCTGCCCGGGAGGGAAAAGGG - Intergenic
916519839 1:165553717-165553739 CTGCAGTCCCAGAGGGCAGAGGG - Intronic
916808275 1:168281169-168281191 CTTCAGGCAGGGAGGGAAAAAGG + Exonic
916850737 1:168700768-168700790 CTGCAGTTTTGGCTGGAAAATGG - Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917498229 1:175562222-175562244 CTTCAGTGCTGGAGAAAAAATGG - Intronic
917560465 1:176147819-176147841 CTGCATTTCTGGAGAGATAATGG - Intronic
917666545 1:177230650-177230672 CCGCAGGCCTTGTGGGAAAAAGG + Intronic
919268142 1:195300849-195300871 CTGATTTCCTGGTGGGAAAAAGG + Intergenic
919765497 1:201124678-201124700 CTGCAGGGCTGGAGGGGAGACGG + Intronic
920207778 1:204305444-204305466 CTGCAATCCTGTAGGGAAGATGG - Intronic
920363904 1:205438148-205438170 CTGAAGCCCAAGAGGGAAAATGG + Intronic
921164045 1:212493545-212493567 CTTCAGTCCCAGAGGGGAAATGG - Intergenic
922504144 1:226116728-226116750 CTGAGGTGCTGCAGGGAAAATGG + Intergenic
924368342 1:243320460-243320482 CAGCAGCCTTGGAGGGCAAAAGG - Intronic
1063979744 10:11443995-11444017 CTGCATTCCTGGGGGGCAGAGGG + Intergenic
1065490559 10:26277758-26277780 CTGGAGGCCTGGAAGGAAAATGG + Intronic
1065985030 10:30941616-30941638 CTTCAGTACTGGATGGGAAATGG + Exonic
1066459509 10:35600962-35600984 CTCCAGGGCTGGTGGGAAAAGGG - Intergenic
1067169250 10:43892659-43892681 CTGCAGTCCAGCACAGAAAAGGG - Intergenic
1067710622 10:48648675-48648697 CAGCTGTCCTGGGGGGAAAATGG + Intronic
1067833234 10:49622082-49622104 CTGCAAACCTGCAGGGAGAAGGG - Exonic
1067909697 10:50333472-50333494 TTGCAGTCCTGGTTGGATAATGG - Intronic
1068145954 10:53071180-53071202 TTGCAGTCCTGCAGGGAGAATGG - Intergenic
1069920403 10:71812457-71812479 CTGCAGTTGGGGAGGGAAAAGGG - Intronic
1070962163 10:80506921-80506943 TTCCAGGCCTGGAGGGAAACGGG - Intronic
1072065108 10:91860703-91860725 TTGCAGTCATGGAGGGAAACAGG + Intronic
1072258432 10:93643214-93643236 CTGCAAACCTGGAGGCAAGATGG - Intronic
1073251148 10:102120862-102120884 CCGCGCTCCGGGAGGGAAAAGGG + Intergenic
1075055438 10:119214988-119215010 CTGCAGTTCTGGAGTGAAGACGG + Intronic
1075969511 10:126640532-126640554 CCACGGTCCTGGAGGGAAAAAGG + Intronic
1077655966 11:4018929-4018951 TTGCACTCCTGAAGGCAAAATGG + Intronic
1078442363 11:11378421-11378443 CTGCAGGGCTGGAGGGCACAGGG - Intronic
1078519323 11:12050814-12050836 CTGCAGAGCTGGAGGGAACTGGG + Intergenic
1080113809 11:28599424-28599446 CTGGAGTCTTAAAGGGAAAATGG + Intergenic
1081853608 11:46290488-46290510 TTGCAGCCCTGGAGAGAAAGGGG - Intronic
1082059129 11:47845740-47845762 CTGCACTCCAGGTGGGAAAAAGG - Intronic
1082263524 11:50096218-50096240 CTGAACTCCAGGAGGCAAAAGGG + Intergenic
1083609175 11:63997027-63997049 CTGCAGCCACGGAGGGAGAAAGG - Intronic
1083650788 11:64203427-64203449 CTGCAGTCCAGAAGAGACAAAGG - Intronic
1084537060 11:69763536-69763558 TTGCAGTTCTGGAGGGCAGAAGG - Intergenic
1084540410 11:69782712-69782734 TTGCTGTCCTGGAGGGAGACAGG - Intergenic
1084620988 11:70270406-70270428 CTGCAGCCGTGGGGGGAAACTGG + Intergenic
1084751323 11:71205904-71205926 CTGCAGCCCTGGGGGGACACAGG - Intronic
1086701234 11:89902093-89902115 CTGCAGTTCTGGAGGGCACAGGG + Intergenic
1086704933 11:89942434-89942456 CTGCAGTTCTGGAGGGCACAGGG - Intergenic
1088029656 11:105231128-105231150 CTGTCTTCCTGGAGGCAAAAAGG - Intergenic
1088047239 11:105468897-105468919 CTGAAGTACTGGTGGGCAAAGGG - Intergenic
1089255705 11:117192805-117192827 ATGCGGTCCTGGAGGGAAGCAGG - Exonic
1089291409 11:117439700-117439722 CTGCAGGCCTGGAGGCAACCGGG + Intronic
1089412232 11:118255127-118255149 CTGCAGAACTGGTTGGAAAACGG + Exonic
1089796907 11:120988092-120988114 CTGCCGTCCTGGGGGCCAAATGG + Exonic
1090534280 11:127623816-127623838 CTGAAGCCCTGGAGGGAGAAAGG + Intergenic
1092088585 12:5785833-5785855 CTGCTGGCCTGGAGGGTAGATGG - Intronic
1096521318 12:52186299-52186321 CCTCAGTGCTGGAGGGAAGAGGG - Intronic
1097130537 12:56807991-56808013 CTTAAGTCCTGTAGAGAAAAGGG + Intergenic
1097140932 12:56902068-56902090 CTTAAGTCCTGTAGAGAAAAGGG - Intergenic
1098032130 12:66265720-66265742 CTGCCATCCTGGAGGGAAGATGG - Intergenic
1098198399 12:68027233-68027255 GTGCAGTGTTGGAGGAAAAATGG + Intergenic
1100537088 12:95521604-95521626 CTGCAGTCCCAGCAGGAAAATGG - Intronic
1100715202 12:97298348-97298370 CAGCTGTTCTGGAGGGAATATGG + Intergenic
1101560121 12:105849094-105849116 CTGCAGTCCTGCAGGTGACAGGG - Intergenic
1103907089 12:124333272-124333294 CTGGAGACCTGGATGGAGAAAGG + Exonic
1104042879 12:125141933-125141955 TTGCAGACCTGGTGGGAAGAGGG + Intronic
1104287815 12:127441189-127441211 CTGAACTCCTAGAAGGAAAATGG + Intergenic
1104691038 12:130826530-130826552 ATGCAGTCCGGGAGGGAACTGGG - Intronic
1105787670 13:23765668-23765690 CTGCAGTACTGGAAGCACAACGG + Intronic
1106714498 13:32373851-32373873 GTGCAGTACAGGAGGGAAACCGG - Intronic
1107527476 13:41247630-41247652 CTGCAGTTCTGGAGGGATTGTGG - Intronic
1107838932 13:44435857-44435879 CGGCAGCCGTGGAGGGAGAAAGG - Intronic
1111415557 13:87938993-87939015 CTGCAATTCTTGAGGGGAAATGG + Intergenic
1111468457 13:88646599-88646621 CTTCAGTCCTATAGAGAAAAGGG - Intergenic
1112504249 13:99966048-99966070 CTGCAGTCCCAGAGGGATCAGGG + Intronic
1114596258 14:23914710-23914732 CTGCAGTCCTTGTGTTAAAATGG - Intergenic
1115067021 14:29275740-29275762 CAGCAGAAGTGGAGGGAAAAAGG - Intergenic
1116131063 14:40856032-40856054 CTTAAGTCCTGAAGAGAAAATGG - Intergenic
1116252608 14:42506111-42506133 CTGGAGTCCTTGGTGGAAAATGG - Intergenic
1116267094 14:42706253-42706275 CTGTAGTCTTGGTGGAAAAAGGG - Intergenic
1116471582 14:45291810-45291832 CTGGGGTGCTGGAGGGGAAATGG + Intergenic
1116965306 14:51008596-51008618 ATGCAAGCCTGGAAGGAAAATGG - Intronic
1117389310 14:55247912-55247934 CTGCAGGCCTGAAGAGACAAGGG + Intergenic
1118395972 14:65337009-65337031 CTGCACTCCAGGAGATAAAATGG - Intergenic
1118512111 14:66486825-66486847 CTGGATTCCTAGAGGTAAAAAGG + Intergenic
1118749446 14:68795502-68795524 CCGCAGCCTTGGAGGGAAAGCGG - Intronic
1119027997 14:71168969-71168991 CCCCAGGGCTGGAGGGAAAAAGG - Intergenic
1121009084 14:90509445-90509467 CTGGGGTCCAGGAGGGAGAAAGG - Intergenic
1121273260 14:92651758-92651780 CTGCAGTCCTCGATGAAAATAGG - Exonic
1121320083 14:92987134-92987156 CCCCAGTCCTGGTGGGACAAAGG + Intronic
1121455896 14:94038727-94038749 CTACGGTCCGGGAGGGAAGATGG - Intronic
1121787227 14:96671208-96671230 CTGCAGCTTTGGAGGGAAAGGGG - Intergenic
1122855127 14:104556452-104556474 CTGCACCCCTGGAGGGACGAGGG + Intronic
1122856956 14:104564442-104564464 CTCCATCCCTGGAGGGCAAATGG + Intronic
1123121723 14:105919839-105919861 CTGCATTGCTGGAGGGACAGGGG - Intronic
1123404428 15:20011490-20011512 CTGCATTGCTGGAGGGACAGGGG - Intergenic
1123513761 15:21018137-21018159 CTGCATTGCTGGAGGGACAGGGG - Intergenic
1123673201 15:22681367-22681389 CTGCAGGCCTGGAGGTGAATTGG - Intergenic
1124325256 15:28754660-28754682 CTGCAGGCCTGGAGGTGAATTGG - Intergenic
1125600311 15:40912099-40912121 GTGCAATCCTGGAGGCCAAATGG - Intergenic
1126765682 15:52008812-52008834 CTGGTGTCCTGGAAGAAAAATGG - Intronic
1128882062 15:71252995-71253017 CTGCAAGCCTGGAGGGCAGAGGG - Intronic
1129556222 15:76512587-76512609 CTGCAGAAGTGGAGGGGAAAAGG + Intronic
1129633932 15:77294021-77294043 CTGCATTCATGGAAGGAAAAAGG + Intronic
1129833429 15:78685646-78685668 CTCCCGTCCTGGGGGAAAAATGG + Intronic
1130763667 15:86848184-86848206 CTGAACTTCTGGTGGGAAAATGG - Intronic
1131293921 15:91130710-91130732 CTGCAGTCCTGGGGGCAAAGAGG + Intronic
1132027942 15:98418859-98418881 CTGGAGTGCTGAAGGGCAAAGGG + Intergenic
1133052411 16:3124618-3124640 CTGCAGTCCTAGAGAGCATACGG + Intergenic
1133879030 16:9763497-9763519 CTCCAGACCTTGGGGGAAAAGGG + Exonic
1135961509 16:26998367-26998389 CTGAAGTCCTGAATGGAGAAAGG + Intergenic
1136608666 16:31353201-31353223 CAGCTGTCCTGGTGGGAAGAGGG - Intergenic
1136927077 16:34384332-34384354 CAGCAGTCATGGAAGGAAATGGG - Intergenic
1136977497 16:35027475-35027497 CAGCAGTCATGGAAGGAAATGGG + Intergenic
1137677833 16:50312605-50312627 CTGCAGTAGTGGAGGGTAACGGG - Intronic
1139312421 16:66038952-66038974 ATGCAGTTCTGTAAGGAAAACGG - Intergenic
1139752593 16:69118828-69118850 AGGTGGTCCTGGAGGGAAAATGG + Exonic
1139890774 16:70252027-70252049 CTGGAGGCCCGGAGGGAGAACGG + Intergenic
1140468127 16:75198295-75198317 CTGCAGTCCTGGAGGGAATCTGG + Intergenic
1140742522 16:77954226-77954248 CTGTTGCCCTGGAGTGAAAAGGG + Intronic
1141142389 16:81505151-81505173 CTGCTGTCCTGGAGGCAGGACGG + Intronic
1141171558 16:81694855-81694877 CCTCAGGCATGGAGGGAAAAAGG + Intronic
1143739099 17:8939843-8939865 CTGGAGTCCTGGTGTGAGAAGGG + Intronic
1144044307 17:11441098-11441120 TTGAAGTCATGGAGGGAAGAAGG - Intronic
1144524375 17:15977906-15977928 CTGCAGTCCTGGAGGGAAAAGGG + Exonic
1145127426 17:20313904-20313926 CTGAAGTCCTTGAGGGGAAGGGG + Intronic
1148111327 17:45146116-45146138 GAGCACTCCTGGAGGAAAAAGGG - Intergenic
1148645548 17:49217970-49217992 CTGGGGTTCTGGAGGGAAAGGGG - Intronic
1148785871 17:50145969-50145991 CTGCAGTTGTGGAGGGAGAGCGG - Intronic
1151260784 17:72914494-72914516 CACCAGTCCTTGATGGAAAATGG - Intronic
1154073484 18:11177094-11177116 CTGCACTCCTTGATGGAAAAGGG + Intergenic
1155183826 18:23370640-23370662 CTGTAGTCCTGGGGGAAAAACGG - Intronic
1157108429 18:44796937-44796959 CGGAAGTCCAGAAGGGAAAAGGG - Intronic
1157131635 18:45013013-45013035 CTGCAGTCCTGGAAGGCGACAGG + Intronic
1157332724 18:46715178-46715200 CTGCAGAAAAGGAGGGAAAAAGG - Intronic
1159888292 18:73931322-73931344 CTGGAGAGCTGGAGAGAAAATGG - Intergenic
1160024685 18:75208353-75208375 CTGCCAACCTGGAGGGAACAGGG + Intronic
1162486296 19:10962367-10962389 CTGCAGTCTTGGAGGGGAGCGGG + Intronic
1162854686 19:13459309-13459331 CTGCTTTCCAGGTGGGAAAACGG + Intronic
1163163431 19:15479428-15479450 CGGCAGTGCTGGAGGGAGACAGG + Exonic
1163460836 19:17436596-17436618 CTGCAGCCCTGGAGGGAGGCTGG - Exonic
1163556564 19:17996805-17996827 TTGCACTGATGGAGGGAAAAGGG + Intronic
1165712137 19:38019385-38019407 CTGGAGTCCAGGTGGGAATAGGG + Intronic
1166093488 19:40525282-40525304 ATCCAGGCCTGGATGGAAAAGGG - Intronic
1168401247 19:56087328-56087350 CTTGAGTCCGGGAGGGAGAAGGG - Intergenic
925518153 2:4708263-4708285 CTACAGACATGCAGGGAAAAAGG + Intergenic
925659079 2:6183578-6183600 CTGAAGTCCTGAAGGATAAAGGG - Intergenic
925912551 2:8583119-8583141 TTGCTGTCCTGGAAGGAAAGGGG - Intergenic
926716370 2:15927496-15927518 CTGCAGTCCTGCAAGGAGAGAGG + Intergenic
926800334 2:16654462-16654484 CTCCAGTCATGGCAGGAAAAAGG + Intronic
927007225 2:18863422-18863444 CTGTAATCCTGGAGGAACAATGG + Intergenic
927663727 2:25014914-25014936 CTACAGTCCTGGCTGGAAGATGG + Intergenic
927696151 2:25241071-25241093 CTGGAGTCCTGAAGGGCAACTGG - Intronic
929696064 2:44116539-44116561 ATGCAGTCATAGAGGGAAAATGG + Intergenic
929788965 2:45010162-45010184 CAGCGGTCCTCGAGGGAAAAGGG + Intergenic
931151590 2:59580207-59580229 CTGGAGTCCTGGAAAAAAAACGG - Intergenic
932878384 2:75476373-75476395 CTGCAGTCAGGGAGGGGTAAAGG - Intronic
934620074 2:95798382-95798404 CTCCATACCTGCAGGGAAAAGGG - Intergenic
934640813 2:96026175-96026197 CTCCATACCTGCAGGGAAAAGGG + Exonic
937222919 2:120352496-120352518 CTGCAGTCCTCCAAGGAAACGGG - Intergenic
937685407 2:124690912-124690934 CTGCAAACCTTGAGGGTAAAGGG - Intronic
938108550 2:128549577-128549599 CTGGAATCCTGAGGGGAAAAGGG + Intergenic
939408663 2:141795411-141795433 CAGCAGCCCTTGAGGGAAGATGG + Intronic
939712254 2:145536806-145536828 CTGCAGTCCTGGAGGAATGAAGG - Intergenic
942729143 2:179044520-179044542 CTGTAGTCCTGGATGGAGTAGGG + Intronic
942914765 2:181291974-181291996 CTACAGACCTGGAGTGATAATGG + Intergenic
944521345 2:200571653-200571675 CTGATGTCCTGGATGGCAAAAGG + Exonic
946036246 2:216744692-216744714 CTGAAGTGCTGGGAGGAAAATGG - Intergenic
946621597 2:221569664-221569686 CTGCAGTCCTGGGGGTCGAAAGG + Intronic
946999236 2:225434235-225434257 CTGCTGTACTGGAGGGCAGAGGG - Intronic
948207493 2:236169932-236169954 CAGCAGACCTGGAGGAAAGAGGG + Intergenic
1168850364 20:972528-972550 CTGCACTCCTGCAGGCATAAGGG - Intronic
1168854294 20:997991-998013 CTGCAGTCCAAGAGGGAAGGGGG - Intronic
1169494190 20:6098121-6098143 CAGCAGCCCTGGAAGTAAAATGG - Intronic
1171432346 20:25091025-25091047 CTGAAGTCCTGGGGGGCAGAGGG + Intergenic
1171468161 20:25347319-25347341 TTGCAGTCCAGGAGAGAGAAGGG - Intronic
1172120082 20:32593264-32593286 GTGGAGGTCTGGAGGGAAAAGGG + Intronic
1173041506 20:39468352-39468374 TTTCAGTGCTGGAGGAAAAATGG + Intergenic
1173812594 20:45965481-45965503 CTGCAGGCCTCCAGGGAAAGGGG - Intronic
1174093704 20:48070360-48070382 CAGCAAGCCTGGATGGAAAATGG - Intergenic
1174200592 20:48804024-48804046 CTCCAGTCCAGGGGAGAAAATGG - Intronic
1174282942 20:49452525-49452547 CTTCAGTCTAGCAGGGAAAATGG + Intronic
1174291180 20:49509840-49509862 CTGCAGGGATTGAGGGAAAAGGG - Intronic
1174682428 20:52421660-52421682 CTGTAGTCCTTGAGTCAAAAAGG - Intergenic
1176026142 20:62986548-62986570 GTGCAGTACAGGTGGGAAAAGGG + Intergenic
1176087241 20:63303760-63303782 CTGCACACCTGGAAAGAAAAGGG - Intronic
1176087268 20:63303848-63303870 CTGCACACCTGGAGGGAGGAAGG - Intronic
1176087311 20:63304008-63304030 CTGCACACCTGGAGGGAGGAAGG - Intronic
1176087394 20:63304288-63304310 CTGCACACCTGGAGGGAGGAAGG - Intronic
1176087417 20:63304368-63304390 CTGCACACCTGGAGGGAGGAAGG - Intronic
1176087430 20:63304408-63304430 CTGCACACCTGGAGGGAGGAAGG - Intronic
1176087443 20:63304448-63304470 CTGCACACCTGGAGGGAGGAAGG - Intronic
1176087466 20:63304528-63304550 CTGCACACCTGGAGGGAGGAAGG - Intronic
1176087501 20:63304648-63304670 CTGCACACCTGGAGGGAGGAAGG - Intronic
1179090879 21:38264443-38264465 TTGCAGCCCTGTAGGGAAAAGGG - Intronic
1184094909 22:42311236-42311258 CTGCAGTCAGGGAGGCAGAAGGG + Intronic
1184633553 22:45806162-45806184 ATACACTGCTGGAGGGAAAATGG - Intronic
949159086 3:859190-859212 CTGGAGTCCCAGGGGGAAAATGG - Intergenic
949845503 3:8366356-8366378 CAGCATTCCTGGAGGGCAAGAGG - Intergenic
950831952 3:15883481-15883503 GTTCAGACCTGGAGGAAAAATGG - Intergenic
952699771 3:36314137-36314159 CTGCAGTCGTGTTGTGAAAATGG - Intergenic
952711948 3:36440406-36440428 CTGCTGTCCTGCAGGCATAAGGG - Intronic
953611308 3:44449695-44449717 CTGAAGTCCTGGTGGGAAGGTGG + Intronic
954005349 3:47586268-47586290 CTGGAGTCCGAGAAGGAAAATGG - Exonic
954397772 3:50302189-50302211 CCGCAGTGCTGGAGGGCACAGGG - Exonic
954920573 3:54187482-54187504 CTGCAGGGCTGGAGGGTAATGGG + Intronic
955029338 3:55201226-55201248 AGCCAGGCCTGGAGGGAAAATGG - Intergenic
955305145 3:57823001-57823023 CAGCAGTCCTGGGGAGAGAAGGG + Intronic
955941027 3:64147187-64147209 CTACAGTCCAGGAGGGCAAGGGG - Exonic
956557766 3:70541310-70541332 CTGAAGTCCTGTAGAGAGAAGGG + Intergenic
956931949 3:74053463-74053485 CTGGAGTCATAGAGAGAAAATGG + Intergenic
957530985 3:81440636-81440658 TTCCAGTCCTGGAGGAGAAAAGG + Intergenic
958537109 3:95418266-95418288 CTGCTGTCCTGGAGGGACTGAGG + Intergenic
958792013 3:98662677-98662699 CTGCAGTTCTGGCTGGAAAGGGG + Intergenic
958915524 3:100045981-100046003 CTGCATTCTTGGTGGAAAAATGG + Intronic
961532217 3:127546865-127546887 CTGAAGTTCTAGGGGGAAAAAGG + Intergenic
961566130 3:127764323-127764345 CTGCAGACCTGGAGTGGAAGGGG + Intronic
961606033 3:128096182-128096204 CTGCAGTGCTGGGGGCACAAAGG - Intronic
962374840 3:134851035-134851057 CTTCAGTCCAGGAGGAAAGAAGG - Intronic
962960897 3:140310098-140310120 CTGCAGTCTTAGAGGAGAAAGGG - Intronic
963643009 3:147881391-147881413 CTTAAGTCCTGTAGAGAAAAGGG + Intergenic
964624746 3:158748330-158748352 CTGCATTCCAGGAAGGAATAAGG - Intronic
965528490 3:169746901-169746923 CTACAATCCTGTAGGGAACAGGG + Intergenic
966010345 3:175067599-175067621 CTGCAGGGCTGCAGAGAAAAAGG + Intronic
966318164 3:178672073-178672095 CTACAGTCCTTCAGAGAAAAAGG - Intronic
966493391 3:180552990-180553012 CTCCAGTTCTGTAGGGAGAAAGG - Intergenic
967127063 3:186433979-186434001 CTTCAGCCCTGGAAGGATAAAGG + Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
968148678 3:196320396-196320418 CAGCAGCCCTGGAGAGGAAAGGG + Intronic
968901877 4:3435839-3435861 GGCCAGTCCTGGAGGGAACATGG - Intronic
969425064 4:7119449-7119471 CTGCAGCCCTGGGAGGAAGAGGG - Intergenic
971450155 4:26792758-26792780 TTGCAGTACTGCAGGGAAATAGG - Intergenic
972857689 4:43127169-43127191 ATGCATTCCTTGAGAGAAAAAGG + Intergenic
973723707 4:53751107-53751129 CTGCAGGCTGGGAGGGAAGAAGG - Intronic
974697581 4:65396276-65396298 CTTAAGTCCTGTAGAGAAAAGGG - Intronic
976822625 4:89223776-89223798 CTTCCATCCTGGAGGTAAAAAGG - Intergenic
977615426 4:99083097-99083119 CTGCAGTTTTGCAGGGAAGATGG + Intronic
978706098 4:111713572-111713594 CTGCATTCAGGGATGGAAAAGGG + Intergenic
980219825 4:129900786-129900808 CTGCCTTCCAGAAGGGAAAAAGG + Intergenic
981409377 4:144410835-144410857 CTGAAGTTTTGGAGGGAAGAGGG - Intergenic
982465678 4:155727977-155727999 CTGCTTTCCAGGAAGGAAAATGG + Intronic
984739440 4:183146158-183146180 CCTCAGACCTGGAGGGAGAAAGG - Intronic
985657961 5:1141991-1142013 CTGCAGGGCTGCAGGGAAGAGGG - Intergenic
986228366 5:5838597-5838619 CTGCAGCCCTGGTCTGAAAAGGG - Intergenic
988557644 5:32251478-32251500 CTGCAGTCATGTAGGGAACTGGG + Intronic
988676811 5:33441104-33441126 CAGCAGTCCTTCAGGGAAGATGG + Exonic
994244986 5:97468478-97468500 CTTAAGTCCTGTAGAGAAAAGGG + Intergenic
995077124 5:107999017-107999039 CAGCAGACCTGGAGGGAAATGGG - Intronic
995519967 5:112993752-112993774 TGGCAGTCCTTCAGGGAAAAGGG - Intronic
996308391 5:122077091-122077113 CTGCAGTCCCGGTGGGCGAAGGG - Intronic
997580754 5:135015338-135015360 CTGCAGAGCTAGAGGGAAAGGGG + Intergenic
998142050 5:139705570-139705592 CTGCGATCCTGGGGGGAGAATGG - Intergenic
998394047 5:141806802-141806824 CTGCAGCCCTAGAGGGGAAATGG + Intergenic
999435534 5:151560489-151560511 CAGCAGTCCGGGAGAGCAAATGG - Intronic
999924937 5:156364834-156364856 CTACAGTTCTGGAGAGAAAATGG - Intronic
999941071 5:156543744-156543766 CTGCAGTCTTGGAGGATCAAAGG - Intronic
1000024218 5:157344881-157344903 CTCCACTCCTGGAGGAAAATGGG - Intronic
1001037900 5:168311115-168311137 CTGCAGTCCAGCAGGAAGAATGG - Intronic
1001720779 5:173855361-173855383 CTGTTGGCCAGGAGGGAAAAAGG - Intergenic
1002435269 5:179227609-179227631 CTGCAGTCCTAGAGGGCATCTGG - Intronic
1002722463 5:181271256-181271278 CTGAAGGCCTGGAGAGAACAAGG - Intergenic
1002982480 6:2153499-2153521 CAACAGTCCAGTAGGGAAAATGG + Intronic
1003311309 6:4971999-4972021 CTGCAGGCCTGGAGGGAGTGGGG + Intergenic
1003379786 6:5613978-5614000 TGGGAGTCCTGGGGGGAAAAGGG + Intronic
1003564207 6:7208696-7208718 CTGCAGTCCTTGAGCAAAACTGG + Intronic
1004878046 6:19976074-19976096 CTCCAGGCCTTGGGGGAAAATGG - Intergenic
1005581289 6:27237826-27237848 CTGCACTCCCGCAGGGAAGAAGG + Intergenic
1006012980 6:31057752-31057774 CTGCCGACAGGGAGGGAAAAGGG + Intergenic
1007146171 6:39634951-39634973 CTGCTGTCCTGATTGGAAAAGGG + Exonic
1007251755 6:40500083-40500105 CTGCAGTCGTGGAGGCTAAGAGG - Intronic
1007291519 6:40790890-40790912 CTGCTGTTGTGGAGGGTAAATGG - Intergenic
1007394555 6:41570154-41570176 CAGCAGTCCTGAAGAGAAATGGG - Intronic
1008322406 6:50133185-50133207 GTGCAGTCCTGCGGGGAAATAGG + Intergenic
1008515842 6:52318550-52318572 CTGCAGTCCTGGTTAGAAAATGG - Intergenic
1012372384 6:98523399-98523421 CTGCAGGCATGGAAGTAAAATGG + Intergenic
1013080054 6:106804622-106804644 CCGCATTCCTGGAGAGAAACAGG + Intergenic
1016887191 6:148969662-148969684 CTCCAGGTCTGGAGGAAAAATGG - Intronic
1017740032 6:157398282-157398304 CTGCAGTCCTGGAGGGAACCTGG + Intronic
1017819157 6:158037330-158037352 CTGGAGTCCTGGAGAGACACAGG - Intronic
1019204786 6:170350878-170350900 TTGCAGTCGTGGAGGAGAAAAGG - Intronic
1019619645 7:1985303-1985325 CCCCAGTCCTGGGCGGAAAACGG - Intronic
1022147388 7:27558644-27558666 CTGGAGTGCTGGAGTGAATATGG - Intronic
1022522530 7:31017369-31017391 GTGCAGCCCAGGAGGGAAAATGG + Intergenic
1022819868 7:33948991-33949013 AATCAGTCCTGGAGGGAGAAGGG - Intronic
1023059768 7:36316030-36316052 CTACCTTCCTGGAGGGATAAAGG - Intergenic
1023398336 7:39772591-39772613 CTGAACTCCAGGAGGCAAAAGGG - Intergenic
1024491387 7:49989719-49989741 CTGCAGACCAGAAGGAAAAAAGG + Intronic
1025185723 7:56856750-56856772 CTGAACTCCAGGAGGCAAAAGGG + Intergenic
1025519078 7:61697107-61697129 CTTGAGTCCTGTGGGGAAAAAGG - Intergenic
1025543402 7:62125753-62125775 CTTGAGTCCTGTGGGGAAAAAGG - Intergenic
1025686206 7:63720194-63720216 CTGAACTCCAGGAGGCAAAAGGG - Intergenic
1025909689 7:65818485-65818507 CTGAACTCCAGGAGGCAAAAGGG - Intergenic
1027053249 7:75032649-75032671 CTGGAGACCGGGAGTGAAAATGG + Intronic
1027767366 7:82362548-82362570 CTGCAGTAATGGAGGAAAAAAGG + Intronic
1028069922 7:86438948-86438970 CTAGAGTACTGGAGGAAAAATGG - Intergenic
1029124330 7:98286349-98286371 CTCCAGTCCTGCAGTGAAAGTGG - Intronic
1029574664 7:101395558-101395580 CAGCGGGGCTGGAGGGAAAATGG + Intronic
1030299732 7:107963006-107963028 CTCCAGTCCAGGAGGGAATCCGG + Exonic
1031414625 7:121480669-121480691 CCACAGTCCTGGAGGGCAGAAGG + Intergenic
1033026718 7:137781582-137781604 CTGCAGTCATGGAAGGAGAGTGG - Intronic
1033631125 7:143159158-143159180 CTACAGTGTTGGAGGCAAAAGGG - Intergenic
1033938112 7:146614598-146614620 ATGCAAACCTGCAGGGAAAATGG + Intronic
1034061876 7:148099568-148099590 CTGCAGCCATTGGGGGAAAAGGG - Intronic
1034112138 7:148547531-148547553 TTGGAATCCTGGAGGGGAAAGGG - Intergenic
1034313692 7:150111210-150111232 CTGCGGTCCAGGGAGGAAAAGGG - Intergenic
1034459613 7:151191280-151191302 CTGCAGGTGTGGAGGGAAGAGGG - Intronic
1034793208 7:153989586-153989608 CTGCGGTCCAGGGAGGAAAAGGG + Intronic
1035006099 7:155662330-155662352 CTGCTGTGCTGGAGAGAAATGGG - Intronic
1035609670 8:952087-952109 CTCCACACCTGGAGAGAAAATGG - Intergenic
1036279499 8:7387972-7387994 CTGAAGTCCTTGATGTAAAATGG - Intergenic
1036342020 8:7923905-7923927 CTGAAGTCCTTGATGTAAAATGG + Intergenic
1036455087 8:8899565-8899587 CTGAACTCCTGAAGGGTAAAGGG - Intergenic
1036751359 8:11445451-11445473 CTGCAGCTGTGGAGGGAAGAAGG + Intronic
1037749945 8:21674980-21675002 CTGCCGACCTGAAGGGAAAGAGG + Intergenic
1038867397 8:31454821-31454843 CTGAAGTCTTGGTGGGGAAATGG + Intergenic
1041935160 8:63325061-63325083 TTTAAGTCCTGTAGGGAAAAAGG - Intergenic
1042570278 8:70156534-70156556 CTGCCATCCTGGAGAGCAAAAGG - Exonic
1043528279 8:81120511-81120533 CTGCAGTCCAGCAGGAAAGAAGG - Intergenic
1045766383 8:105675637-105675659 CTTCAGTCCTGGGAGGATAAAGG + Intronic
1046728816 8:117703449-117703471 CTGCAGTTCTGGAAGGAAGGTGG + Intergenic
1047313336 8:123710603-123710625 CTGCAGTCCTGGAGGGGGTGGGG - Intronic
1048266408 8:132991216-132991238 CTGCAGTCCTGGAGGGAGTCAGG + Intronic
1048475121 8:134736022-134736044 CACCTGTCCTGGAGGGAAACTGG + Intergenic
1048846789 8:138609857-138609879 CTGCAGCCCAGGAGGGAACCAGG - Intronic
1049299824 8:141863586-141863608 CTGCAGTCCCAGAGAGAAAGGGG - Intergenic
1049332166 8:142060335-142060357 CTGCGGTGGTGGAGGCAAAATGG + Intergenic
1049415522 8:142493174-142493196 CTGCTGCCCTGGAGGACAAAGGG - Intronic
1049488685 8:142879635-142879657 CTGCAGATCTGGAGGGAGCAGGG - Exonic
1049493584 8:142917662-142917684 CTGCAGATCTGGAGGGAGCAGGG - Exonic
1050292204 9:4166593-4166615 CTGAACTCCTGGAAGGAGAAGGG - Intronic
1051186264 9:14464504-14464526 CTGAAGTGTTGGAGGAAAAAGGG + Intergenic
1055568308 9:77591087-77591109 CTGCCTTCCTGGAGGGCAAGAGG - Intronic
1055915051 9:81392181-81392203 CTGAAGGCCTGGCTGGAAAAAGG + Intergenic
1055944538 9:81681177-81681199 CTGCAATCCTGGTTGGGAAAGGG - Intronic
1056303491 9:85267104-85267126 ATGCAGTCATAGAGGGAGAAGGG - Intergenic
1057518291 9:95739557-95739579 GTGCAATCCTGGAGAGAAATGGG + Intergenic
1057864596 9:98669145-98669167 CTGCATTGCTGGTGGTAAAATGG - Intronic
1061196380 9:129109359-129109381 CAGGAGTCCTGGAGAGAAACAGG - Intronic
1061741326 9:132708496-132708518 CTGTGGTCCTGGTGGGAACATGG - Intergenic
1062327732 9:136020221-136020243 ATGCAGGTCTGGAGGGAAACCGG + Intronic
1187433577 X:19246943-19246965 CTGTAGCCCTGGAGTGAAGAGGG - Intergenic
1187581939 X:20616505-20616527 CAACTGTCCTGGAGGGAAACTGG + Intergenic
1189033304 X:37471197-37471219 CTCAAGACCTGGAGGGAAACTGG + Intronic
1189794773 X:44635236-44635258 AGGTGGTCCTGGAGGGAAAAAGG - Intergenic
1191925503 X:66305226-66305248 CTGCAGTATTGTAGGGATAATGG + Intergenic
1192146947 X:68688580-68688602 CTGCAGCCCTGGAGGGACACTGG + Intronic
1193010471 X:76669811-76669833 CTGCAGTACTGGAGGGGCCAAGG - Intergenic
1193184434 X:78495607-78495629 CTTCACTCCTTGAGGGTAAATGG - Intergenic
1194124077 X:89992280-89992302 CTTAAGTCCTGTAGAGAAAAGGG + Intergenic
1195202805 X:102566080-102566102 GAACAGGCCTGGAGGGAAAAAGG - Intergenic
1195233922 X:102878316-102878338 CTGCTGTCCTGATGGGTAAATGG + Intergenic
1196904653 X:120419409-120419431 TTGGAGTGCTGGAGGGGAAAGGG + Intergenic
1197106751 X:122725890-122725912 CTGCTGTGCTGGAGGGGACAAGG - Intergenic
1197706775 X:129639859-129639881 CTGCAGTGCTGGAGGTGGAAGGG + Intergenic
1198334293 X:135651878-135651900 CCTCAGTCCTGAAGGGGAAAGGG + Intergenic
1199078389 X:143549593-143549615 CTGCTGAGATGGAGGGAAAAAGG + Intergenic
1200184303 X:154171879-154171901 CTGCATTGCTGGTGGGAAGATGG + Intergenic
1200189955 X:154209012-154209034 CTGCATTGCTGGTGGGAAGATGG + Intergenic
1200195708 X:154246821-154246843 CTGCATTGCTGGTGGGAAGATGG + Intergenic
1200201362 X:154283937-154283959 CTGCATTGCTGGTGGGAAGATGG + Intronic
1200476964 Y:3649902-3649924 CTTAAGTCCTGTAGAGAAAAGGG + Intergenic
1202177825 Y:22113876-22113898 CTGCAATCCTGGGGAAAAAATGG + Intergenic
1202213536 Y:22472519-22472541 CTGCAATCCTGGGGAAAAAATGG - Intergenic