ID: 1144537400

View in Genome Browser
Species Human (GRCh38)
Location 17:16104227-16104249
Sequence TGGATTATAAAGTACATGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 339}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144537397_1144537400 6 Left 1144537397 17:16104198-16104220 CCTGGTACACAGTAGACTCAAAT 0: 1
1: 0
2: 2
3: 30
4: 248
Right 1144537400 17:16104227-16104249 TGGATTATAAAGTACATGAATGG 0: 1
1: 0
2: 2
3: 28
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144537400 Original CRISPR TGGATTATAAAGTACATGAA TGG Intronic
901219725 1:7576617-7576639 TGGTTTATAAAGAACAGAAATGG - Intronic
905033275 1:34901809-34901831 TCGATTATGAAGGACATGGAAGG + Intronic
906242378 1:44249832-44249854 GTGATTTTAAAGTACTTGAAAGG - Intronic
907070788 1:51532845-51532867 TGGATTATAAGGCCCAGGAAGGG + Intergenic
907359670 1:53904372-53904394 TGCCTTATAAACTGCATGAAAGG + Intronic
907723099 1:56992119-56992141 TGGAAGATAAAGTGAATGAAAGG + Intergenic
908705399 1:66948590-66948612 TGGGTTAAAAAGCATATGAAGGG + Intronic
910492067 1:87783705-87783727 TGGGTGATAATGTACTTGAAGGG + Intergenic
910915890 1:92288386-92288408 AAGAATATAAAGTAAATGAATGG + Intronic
911866392 1:103029269-103029291 AGTAATATAAAGTACATGTATGG + Intronic
913646997 1:120866810-120866832 TACATTATAAAGTACATTATAGG - Intergenic
914079646 1:144396055-144396077 TACATTATAAAGTACATTATAGG + Intergenic
914174546 1:145264592-145264614 TACATTATAAAGTACATTATAGG + Intergenic
914529275 1:148506081-148506103 TACATTATAAAGTACATTATAGG + Intergenic
915908326 1:159896072-159896094 TGGATAATAACGTATGTGAAAGG + Intronic
918716496 1:187793792-187793814 TGGATTATATATAACATTAAAGG + Intergenic
918819822 1:189237772-189237794 TGTATTGAAAAATACATGAATGG - Intergenic
919319485 1:196017419-196017441 TTCTTTATAAAGTATATGAAGGG - Intergenic
919527299 1:198669396-198669418 TGGACCACACAGTACATGAAAGG - Intronic
921721412 1:218475936-218475958 TAGATTATAAACTCCTTGAAGGG + Intergenic
1063405920 10:5794952-5794974 TGGATTTTAAAGTGACTGAAGGG - Exonic
1063760933 10:9075570-9075592 TTGATTTTATAATACATGAAAGG + Intergenic
1064937631 10:20696129-20696151 TGTATAATGAAGTACATGCAGGG - Intergenic
1066206485 10:33194309-33194331 TGTTTTATAAAGTACATTTAAGG - Intronic
1066737454 10:38492225-38492247 TGGAATAGAATGGACATGAATGG + Intergenic
1066738267 10:38498083-38498105 TGGAAAAGAAAGGACATGAATGG + Intergenic
1066738623 10:38500860-38500882 TGGAATAGAATGGACATGAATGG + Intergenic
1066739532 10:38507567-38507589 TGGATTGGAACGTACTTGAAAGG + Intergenic
1066741690 10:38524061-38524083 TGGAATGGAAAGTACTTGAAAGG + Intergenic
1066743128 10:38578343-38578365 TGCAATTTAATGTACATGAATGG + Intergenic
1066775573 10:38883249-38883271 TGGATTGGAATGGACATGAATGG + Intergenic
1066939153 10:41868060-41868082 TGGAATGGAAAGTAAATGAATGG + Intergenic
1066939927 10:41872985-41873007 TGGAATGGAAAGTAAATGAATGG + Intergenic
1066971925 10:42319184-42319206 TGGATTGGAAAGGACACGAATGG - Intergenic
1066971964 10:42319469-42319491 TGGATTTGAATGTACTTGAATGG - Intergenic
1069033819 10:63627684-63627706 TGTATTATATAATACATGTATGG - Intergenic
1071433976 10:85629348-85629370 GGGATGAGAAATTACATGAAGGG - Intronic
1073967546 10:109009022-109009044 TGAATTAAAAAGTAAATGACAGG + Intergenic
1074580244 10:114712050-114712072 TTCATTACAAAGTACATTAATGG + Intergenic
1074752762 10:116602514-116602536 TGGATTATTAATTTCATGAGAGG - Intronic
1080090522 11:28342563-28342585 TGGCTTATAAAATCCAAGAATGG - Intergenic
1080667964 11:34352479-34352501 TGGATTATAAACTTCATGAGAGG + Intronic
1082297905 11:50466039-50466061 TGTATTGTAAAATCCATGAAGGG + Intergenic
1084579285 11:70012842-70012864 TGGATGAAAAAGCAAATGAATGG - Intergenic
1085433421 11:76477081-76477103 TGTATTATACAATACATTAAAGG - Intronic
1085488487 11:76890114-76890136 TGGATTGTAAAGTCTATGAGGGG + Intronic
1086869613 11:92021128-92021150 TGTACTATAAAATATATGAAAGG - Intergenic
1087746950 11:101958755-101958777 TGAAAAATAAAGTACATGGATGG - Intronic
1087897667 11:103605001-103605023 AGAATTATAAAGTTGATGAATGG - Intergenic
1087942838 11:104121239-104121261 TGGATTAGAAAGGACATTATAGG - Intronic
1088651892 11:111964961-111964983 TGGAGTACTAAGTACATTAATGG - Intronic
1090331702 11:125937965-125937987 TGGATTATAGGGTACAATAAAGG - Intergenic
1092297455 12:7211747-7211769 TGTATTATGAATTACATGGAAGG + Intronic
1095688160 12:45059465-45059487 TGGAATATCAGGTTCATGAAGGG - Intergenic
1095879974 12:47123597-47123619 TTGAATATAAAATACATTAAGGG - Intronic
1096488513 12:52000422-52000444 TAGATTATAAACTCCTTGAAGGG - Intergenic
1097923532 12:65103328-65103350 TAAATGATTAAGTACATGAAAGG + Intronic
1100106908 12:91186423-91186445 TTCCTTATAAAGTCCATGAATGG - Intergenic
1100834047 12:98548818-98548840 TTGATTAGAAAGTACAAAAAGGG + Intronic
1105012985 12:132768093-132768115 TGGTTTAAAAAGTACAGAAAAGG - Intergenic
1107167285 13:37297785-37297807 AGGAAGATAAAGTAAATGAAGGG - Intergenic
1107309766 13:39063888-39063910 TGGATAATACATTACATTAAAGG - Intergenic
1108813633 13:54263271-54263293 TGGAATATACTGTACTTGAAAGG + Intergenic
1109453997 13:62559178-62559200 TGGATTATAAAGTGGATGTCAGG + Intergenic
1109646065 13:65258404-65258426 TGGAGCATAAAGAACAAGAAGGG - Intergenic
1111125347 13:83907085-83907107 TGGTTTAGGAAGTAAATGAAGGG - Intergenic
1115018876 14:28650411-28650433 TGGATTACTAATTGCATGAATGG - Intergenic
1115576994 14:34721243-34721265 GGGATTATAAAATGTATGAATGG - Intergenic
1116178464 14:41505030-41505052 TGAGTAATAAAGTATATGAAAGG - Intergenic
1117103675 14:52377534-52377556 AAGATTATATAGTTCATGAAAGG - Intergenic
1117126984 14:52639771-52639793 AGGATTATAAGGTAGATAAATGG - Intergenic
1118098483 14:62567426-62567448 TGGATTAAATGGTACTTGAATGG + Intergenic
1118233026 14:63971734-63971756 TGTATTGTAAAGTAAGTGAAAGG - Intronic
1119575927 14:75722074-75722096 TGGATTATAAGGTATATGAGGGG - Intronic
1120334319 14:83134117-83134139 CTAATTATAAAGAACATGAAAGG - Intergenic
1120546145 14:85813809-85813831 TTGATTTAAAAGTAAATGAAAGG + Intergenic
1121076873 14:91076340-91076362 GAGATTATAAAGTACATGAGAGG - Intronic
1122332248 14:100929460-100929482 TAGATTATAAAATACATTGAGGG - Intergenic
1202874011 14_GL000225v1_random:191604-191626 TGGAATAGAATGGACATGAAAGG + Intergenic
1124016936 15:25885275-25885297 TTGAATATAAAGTCCATGAGAGG + Intergenic
1124049206 15:26179358-26179380 TGCATTATAAATTACCTGACAGG + Intergenic
1125423277 15:39525745-39525767 TGGATTAGAGAGAACAGGAAAGG + Intergenic
1126409044 15:48353151-48353173 TGGAGTATAAAGGACATGTAGGG + Intergenic
1127106242 15:55619640-55619662 TGGATTATAAAATATATCACTGG - Exonic
1127451320 15:59119094-59119116 TGTATTATAAAGTCAATAAAAGG - Intronic
1127673209 15:61215181-61215203 TAGATTTAAAAGTACAAGAAGGG - Intronic
1128488618 15:68122859-68122881 TGGATGAGAAACTAAATGAAAGG - Intronic
1128618762 15:69131265-69131287 TGAAATATAAAATAAATGAATGG - Intergenic
1129308608 15:74687805-74687827 TGGATTATAAATGATAGGAAAGG - Intronic
1129504167 15:76067160-76067182 TGGGTTATAATATACATGAAAGG + Intronic
1130634215 15:85601117-85601139 TGTATTAAAATGTACATTAATGG + Intronic
1131360432 15:91785622-91785644 TAGATTATAAACTCCATGAGGGG - Intergenic
1131661981 15:94526993-94527015 TGCATTATAAAATGCATGAGAGG - Intergenic
1134160595 16:11885388-11885410 TGGATAATAAAGTGGTTGAATGG - Intronic
1134329582 16:13238234-13238256 TGGACCAAAAAGTAAATGAAAGG + Exonic
1136156030 16:28382788-28382810 TGGAATATAATGTACATGAAGGG + Intronic
1136207056 16:28732500-28732522 TGGAATATAATGTACATGAAGGG - Intronic
1139135781 16:64203130-64203152 TGGATTAAAAGGTGCAAGAATGG + Intergenic
1144365549 17:14541253-14541275 TGGATTTTTAACTACATGAGGGG + Intergenic
1144537400 17:16104227-16104249 TGGATTATAAAGTACATGAATGG + Intronic
1144794197 17:17880097-17880119 TGGATTTTAAAGAGCAGGAACGG - Intronic
1145697009 17:26796713-26796735 TGGAATGTAAAGTAGACGAATGG + Intergenic
1145705892 17:26871181-26871203 TGGAATAGAACGTACACGAATGG + Intergenic
1147471801 17:40669235-40669257 TGGATCATAAAGCTAATGAAAGG + Intergenic
1148187539 17:45655520-45655542 TGGATTTTAAAGTTCATCAGTGG - Intergenic
1149056678 17:52375217-52375239 TGGATTAAAAAGAACAGGAAAGG - Intergenic
1152255482 17:79236706-79236728 TGGATTATAAAGTGAGTGAGTGG - Intronic
1203180180 17_KI270729v1_random:50596-50618 TGGAATGGAAAGTACACGAATGG + Intergenic
1203199261 17_KI270729v1_random:260648-260670 TGGAATAGAAAGGACACGAATGG + Intergenic
1203200578 17_KI270729v1_random:271677-271699 TGGAATTGAAAGTAAATGAAAGG + Intergenic
1203208861 17_KI270730v1_random:61388-61410 TGGAATAGAAAGGACACGAATGG + Intergenic
1203210173 17_KI270730v1_random:72378-72400 TGGAATTGAAAGTAAATGAAAGG + Intergenic
1155145801 18:23082453-23082475 TTAATTATAAAGTACATGGCAGG - Intergenic
1158034618 18:53011553-53011575 TTGATAATAAAATAAATGAATGG + Intronic
1158065258 18:53399558-53399580 TTCTTTATTAAGTACATGAATGG - Intronic
1159820333 18:73133194-73133216 TGAATTATCAAGTGCATGAAAGG + Intergenic
1162702800 19:12530611-12530633 ATGATTATAAAATACACGAAGGG + Intronic
1163198531 19:15744146-15744168 TAAATTAAAAAGTAAATGAATGG - Intergenic
1163447235 19:17353774-17353796 TGGATAATAAATTAGATGAACGG - Intronic
925149637 2:1606349-1606371 GGGATATTAAAGTACATGACGGG + Intergenic
925893072 2:8451763-8451785 TGGGATATAAATTAAATGAAAGG + Intergenic
926846562 2:17147412-17147434 TGAGAGATAAAGTACATGAATGG + Intergenic
927389079 2:22572652-22572674 ATGATTATAAAGTAAATGCAGGG + Intergenic
927758453 2:25727899-25727921 TGGATTATAAAGTATTTGATGGG - Intergenic
928974311 2:37068076-37068098 TGGATTAAAAGCTCCATGAAGGG + Intronic
929184071 2:39074943-39074965 TGGACCAAAAAGTACATGTAGGG + Intronic
929262430 2:39880702-39880724 AGGATTATAAACTACATTACAGG + Intergenic
929424371 2:41829024-41829046 TTGATGATAAAGTGCATGAGTGG - Intergenic
929481894 2:42316455-42316477 TAGATTCTAAAGGACTTGAAGGG - Intronic
929973963 2:46613326-46613348 GTGATTCTAAAGTACTTGAATGG - Intronic
930228415 2:48818461-48818483 TGCTTTGTAAAGTACAGGAAGGG - Intergenic
931034552 2:58224391-58224413 TTGATTACAAATTACATCAAAGG - Intronic
931248571 2:60510873-60510895 TGCATTATAATGTAAATGGAGGG + Intronic
931323224 2:61193093-61193115 TATATTTTAAAGTACATAAAGGG + Intronic
932782601 2:74570720-74570742 TGGAGTGTATGGTACATGAAGGG + Intronic
933042422 2:77486496-77486518 TGGATTATGGATTACAAGAATGG + Intronic
933074313 2:77904072-77904094 TGGTTTGTAAGGTTCATGAAAGG - Intergenic
933187441 2:79293648-79293670 TGTATTTTAATTTACATGAATGG - Intronic
933891537 2:86776013-86776035 TTAATTATAATGTACATCAAAGG + Exonic
934053367 2:88229354-88229376 TCGACTATAAACTACATGCAAGG - Intergenic
934128615 2:88924057-88924079 TAGATTGAAAAGTATATGAATGG + Intergenic
934193315 2:89819187-89819209 TGGAATATAATGGACACGAATGG - Intergenic
934193847 2:89823424-89823446 TGGAATATAATGTACGGGAATGG - Intergenic
934194112 2:89825505-89825527 TAGATTGGAAAGTACTTGAATGG - Intergenic
935547769 2:104418892-104418914 TGGATTATGTAAGACATGAAAGG - Intergenic
938035165 2:128028672-128028694 CGGATTATAAAGGAGCTGAAGGG + Intergenic
938147084 2:128844209-128844231 TGGATCATATAGTACGTGTATGG + Intergenic
938403278 2:131011943-131011965 TGGATAATAAAGTAAAGGTAGGG + Intronic
939610586 2:144305272-144305294 TTTAATATATAGTACATGAAAGG + Intronic
940071080 2:149688783-149688805 TAGATTATAAATTCCATGAAAGG - Intergenic
940407248 2:153319217-153319239 TAGTTTATAAAGTACTTGCATGG - Intergenic
940895419 2:159077567-159077589 TGTATTATAAAGTCCATGTGGGG - Intronic
940895898 2:159081694-159081716 TGTATTTTAAAGTAAGTGAAAGG + Intronic
941359644 2:164536118-164536140 TGGATTACAAAGTACATAGAAGG - Intronic
941615828 2:167718097-167718119 TGGATTATAGAGTACACAAGAGG + Intergenic
942166892 2:173250140-173250162 TGGTTTTTAAAATACAAGAAAGG - Intronic
942209352 2:173654876-173654898 GGTATTATAAAGGACATGTATGG + Intergenic
944142596 2:196473474-196473496 TGGTTTAGAAAGTCCATTAATGG - Intronic
944161752 2:196668839-196668861 TCGAATTTAAAATACATGAAGGG - Intronic
944581059 2:201133259-201133281 TGGCTTTTAAACAACATGAATGG + Intronic
944756666 2:202770060-202770082 TTCATTATAAAGTACATGAGAGG + Intergenic
945399049 2:209356964-209356986 GTGATTTTAAAGTACATGCAGGG - Intergenic
945759697 2:213899213-213899235 TGGGTGATAAAGGAGATGAACGG + Intronic
947619445 2:231580153-231580175 TGTATTATAAAGGACACAAATGG + Intergenic
948219781 2:236260470-236260492 TGGATTCTAAGCTACATGTAGGG - Intronic
1168766384 20:384188-384210 TGGATTTGAAAGTACAAGACGGG - Intronic
1169296876 20:4407686-4407708 TGGAGTCTAGAGTACATGAAGGG - Intergenic
1169435917 20:5589676-5589698 AGGATTAAAAAATAAATGAAAGG - Intronic
1169569462 20:6890375-6890397 TGGATTGTAAAATTCATGGAAGG - Intergenic
1171917300 20:31070880-31070902 TGGAATGTAATGTACAGGAATGG + Intergenic
1171919606 20:31087830-31087852 TGGAATAAAATATACATGAATGG + Intergenic
1171920035 20:31091105-31091127 TGGAATGAAAAGGACATGAATGG + Intergenic
1171928104 20:31205989-31206011 TGGAATAAAATATACATGAATGG + Intergenic
1171928532 20:31209264-31209286 TGGAATGAAAAGGACATGAATGG + Intergenic
1172204603 20:33153995-33154017 TGGATTAAAGTGTACATAAATGG + Intergenic
1173885410 20:46453301-46453323 TGGATTCTCAAGACCATGAAAGG + Intergenic
1174466871 20:50724621-50724643 TGAATGAAAAAATACATGAATGG + Intergenic
1174986926 20:55465385-55465407 TGAATGATTAAGTAAATGAATGG + Intergenic
1175045679 20:56102918-56102940 TGGCTCATAAAGGACATCAATGG + Intergenic
1175082328 20:56431068-56431090 TGGATTATAAGGTGAAAGAATGG + Intronic
1176746850 21:10659749-10659771 TGGAATAGAATGGACATGAATGG - Intergenic
1176749437 21:10679249-10679271 TGGAATAGAATGCACATGAATGG - Intergenic
1176751984 21:10698346-10698368 TGGATTGGAATGGACATGAATGG - Intergenic
1177959110 21:27639710-27639732 AGTATTATAAAATAAATGAAAGG - Intergenic
1178183058 21:30186635-30186657 AGTATTATAATGTACATGTATGG + Intergenic
1180530137 22:16343571-16343593 TCGAATATAATGTAGATGAATGG + Intergenic
1180531719 22:16355120-16355142 TGGATTGGAAAGGACTTGAATGG + Intergenic
1180681511 22:17630262-17630284 AGGGTTATAAAGTACATTGATGG - Intronic
1181899851 22:26144656-26144678 TGGAATATTAAGTAAATTAATGG + Intergenic
1183769474 22:39911748-39911770 TGGATTAAAAATCACGTGAAAGG - Intronic
1185154576 22:49185472-49185494 TGGATTAATAGGTAGATGAATGG - Intergenic
1203317923 22_KI270737v1_random:30667-30689 TGGATTGGAAAGGACTTGAATGG - Intergenic
1203319511 22_KI270737v1_random:42240-42262 TCGAATATAATGTAGATGAATGG - Intergenic
949294267 3:2502441-2502463 TACATTAGATAGTACATGAATGG + Intronic
952612988 3:35233727-35233749 TGGATAACAAAATAAATGAAAGG - Intergenic
955655787 3:61243423-61243445 TGGATTATCAAGAAAATTAAAGG + Intronic
955695482 3:61631856-61631878 TGGATTATGAATTCCTTGAAGGG - Intronic
955851808 3:63228092-63228114 TGGATTATACAGAAAAAGAAGGG + Intergenic
955860876 3:63328847-63328869 TTGATTATAATGTCCATGAGAGG + Intronic
956878050 3:73483037-73483059 TGGATTATAAAGCAAAGGCAAGG - Intronic
957199597 3:77115537-77115559 TGGTTTATAAAGTAGAGAAAGGG - Intronic
957271928 3:78041468-78041490 TGGATCATAAAGGAAATAAATGG - Intergenic
957330990 3:78763628-78763650 TAAATTATAAATTAAATGAAAGG - Intronic
957720446 3:83990132-83990154 TTGATGATAAAATACATAAAAGG + Intergenic
958605038 3:96346647-96346669 TGAATTATTAAGTAAATGTAAGG + Intergenic
960167298 3:114417833-114417855 TTGATTATTAAGTATCTGAAGGG - Intronic
960805767 3:121582648-121582670 TGGACTTTTAAGTACAAGAAGGG + Intronic
962582329 3:136809478-136809500 GGAATTATAAATTCCATGAAAGG + Intergenic
964379773 3:156086600-156086622 TGGATTAGAAAGTCTCTGAAAGG - Intronic
967064163 3:185899788-185899810 TGGAGTATAATTTACATGCATGG - Intergenic
967491202 3:190092910-190092932 GGGATTAGAAAGTAAAGGAAGGG - Intronic
967649616 3:191970335-191970357 TTGAATATAAAGTTTATGAAAGG + Intergenic
970080048 4:12272472-12272494 TGTATAATAAAATACATTAAAGG - Intergenic
971036743 4:22701606-22701628 TGGCTTATAAAGAACAGAAATGG - Intergenic
971190336 4:24422149-24422171 TGGATGATACAATAAATGAATGG - Intergenic
971644764 4:29184574-29184596 TGGATTTTAAACTACATAAAAGG + Intergenic
973192529 4:47401745-47401767 TGTATTCTAAAATCCATGAATGG + Intronic
975892357 4:79044908-79044930 TGCATTATAAAGGACAAAAAGGG - Intergenic
975974422 4:80078948-80078970 TGGAGCATCAAGTATATGAAGGG - Intronic
977451004 4:97197891-97197913 TGCATTTTTAAGTACCTGAAGGG - Intronic
978339268 4:107705032-107705054 TGAATTATATAGCACATTAAAGG - Intronic
978349811 4:107809738-107809760 TAGACTACAAAGTCCATGAAGGG - Intergenic
978826471 4:113030074-113030096 TGAATTATAAATACCATGAAAGG + Intronic
979029909 4:115630245-115630267 TGGAAAATAAAGGAAATGAATGG - Intergenic
981245549 4:142533008-142533030 TGCATTAGAAAGCAAATGAAAGG + Intronic
981599149 4:146466088-146466110 GGGATTAGAAAGTAGATGTAAGG - Intronic
982509962 4:156269795-156269817 TGGATTACAAACCACATGGAAGG + Intergenic
985663747 5:1170906-1170928 TGGATTAAAAAGAACATCCAGGG + Intergenic
987810187 5:22825092-22825114 TGGATTAAGAAATAAATGAATGG - Intronic
988093660 5:26573534-26573556 TTGATTCTAAAATATATGAAGGG - Intergenic
989159967 5:38381130-38381152 TGGATAATTAAGTAAATAAAAGG - Intronic
989230745 5:39084035-39084057 AGGCTTAAAAAGTACATAAAAGG + Intergenic
989281185 5:39645411-39645433 AGGATTATAAAGGACAGGCAAGG - Intergenic
991350987 5:65720909-65720931 TGGGTTATAAAGTGTATTAAAGG + Intronic
991899508 5:71445048-71445070 AGGACTATAAATTATATGAATGG + Intergenic
992735662 5:79717616-79717638 TGGATTATAGAGTTAATGAATGG + Intronic
992797371 5:80265234-80265256 TGGGTTATATATTACTTGAATGG + Intergenic
993557339 5:89356835-89356857 TAGATTTTAAAGTAAAAGAATGG + Intergenic
993820560 5:92610159-92610181 TGTATTATAAATAACATTAATGG + Intergenic
994292694 5:98048075-98048097 TGGAATATAAAGGTGATGAATGG - Intergenic
994673269 5:102788289-102788311 TGAATTATGGAGTATATGAAGGG - Intronic
994976037 5:106808087-106808109 TGGGTTATAAAGAAAATAAATGG - Intergenic
995026801 5:107433140-107433162 TGGATTTTCAACTACATGCAGGG + Intronic
995094220 5:108216426-108216448 TTGATAATAATGTAAATGAAAGG + Intronic
995238057 5:109852897-109852919 ATGATAAGAAAGTACATGAATGG + Intronic
995461126 5:112404273-112404295 TGAATTAAATAGTACATGTAAGG - Intronic
996069206 5:119115228-119115250 TTGATTGTATACTACATGAAAGG - Intronic
996131600 5:119788345-119788367 TACATTATAAATTACATTAAAGG + Intergenic
997804987 5:136908001-136908023 TGGATTTAAAAGTACATAAATGG + Intergenic
998843913 5:146286319-146286341 TGGATTATGATGTAAATGACAGG + Exonic
999632894 5:153588885-153588907 TGCAATATATAGTACCTGAAAGG - Intronic
1002439112 5:179255080-179255102 TGGATGAGTAAGTAGATGAATGG + Intronic
1003090228 6:3095478-3095500 TGGAAAATAAGGTACAAGAAAGG + Intronic
1005672743 6:28123689-28123711 AAGATTATAAATTCCATGAAAGG + Intergenic
1007771481 6:44195906-44195928 GTTATTATAAAGAACATGAATGG + Intergenic
1008548410 6:52604142-52604164 TGGATTTTATTGTACATAAAAGG - Intergenic
1008759800 6:54839905-54839927 CTGATTATAAAGTAAATAAAAGG + Intergenic
1009763033 6:68032808-68032830 TAGTTTATAAAATAAATGAATGG - Intergenic
1010429664 6:75764486-75764508 GGTATTATAATGTACATCAAAGG + Intronic
1012999064 6:106003755-106003777 TGGAATATAAAGAATCTGAAAGG + Intergenic
1013343173 6:109235556-109235578 TGGATTACAAAGTACTGTAAGGG - Intergenic
1013353199 6:109324556-109324578 TAGATTATAAACTCAATGAAAGG - Intergenic
1013690727 6:112639366-112639388 TGGATTATGAAGTACACAATTGG - Intergenic
1014351953 6:120356842-120356864 AGGATTATAAAGTAAAGCAAAGG - Intergenic
1016250702 6:142038305-142038327 TGAATTATTAAATACATGTAAGG + Intergenic
1016300773 6:142628896-142628918 TGGATTATAAAGAACACCATTGG + Intergenic
1018161366 6:161046604-161046626 TGGATCATAAAGTAAATTTAAGG + Intronic
1018511773 6:164532272-164532294 TGGTTTATAAGGTACAGAAAGGG - Intergenic
1021311182 7:19099700-19099722 TTGAATATAAAGTAAAAGAAAGG + Intronic
1021669261 7:23018637-23018659 TGGGTTATACAGTTCATGAAGGG - Intergenic
1022543515 7:31162052-31162074 TGAATTATAAATTATATGTATGG - Intergenic
1022964464 7:35459519-35459541 TGGATGAGAAAGTAGATAAATGG - Intergenic
1024537159 7:50446472-50446494 TGGATTGGAAAGTGCATCAATGG + Exonic
1024748004 7:52430034-52430056 TGGAGTATAAACTTCATGAAAGG - Intergenic
1025222187 7:57121712-57121734 TGCATTATAAAGATCATGAAAGG + Intronic
1025266800 7:57468017-57468039 TGCATTATAAAGATCGTGAAAGG - Intronic
1025632972 7:63293383-63293405 TGCATTATAAAGATCATGAAAGG + Intergenic
1025649725 7:63454800-63454822 TGCATTATAAAGATCATGAAAGG - Intergenic
1025748163 7:64265186-64265208 TGCATTATAAAGATCGTGAAAGG - Intronic
1027559155 7:79705450-79705472 TGGATTCTAACATACATGATGGG - Intergenic
1027766972 7:82356266-82356288 TGGATTAAAAAGTCTTTGAAAGG - Intronic
1030465222 7:109893032-109893054 TGTATTATAAAATACTGGAAAGG - Intergenic
1030945945 7:115720411-115720433 TAAATCATAAAGTAGATGAAAGG - Intergenic
1031518519 7:122733122-122733144 TAGGTTAGAAAGAACATGAAAGG + Intronic
1031608881 7:123801372-123801394 TGAATATTAAAGTACATGGATGG - Intergenic
1032732638 7:134659022-134659044 TTGATTATAAACTATATCAAGGG - Intronic
1033519999 7:142150792-142150814 TCGATTATAAAGTACCTTATAGG - Intronic
1037081518 8:14793297-14793319 TGGATTATAAAAGGCAGGAATGG - Intronic
1038971589 8:32642523-32642545 TGGAGGATAAAGTACACCAATGG - Intronic
1039050858 8:33491933-33491955 TGGATTAAAAAGTGAATAAAAGG - Intronic
1041173390 8:55168399-55168421 TTCATTCTAAAGTACATGAGAGG + Intronic
1042108616 8:65355678-65355700 TGGATTTTCCAGTACCTGAAGGG + Intergenic
1042894589 8:73651982-73652004 TGGTTTAGGAAGTAAATGAAGGG + Intronic
1043273872 8:78368837-78368859 TGAGTTATGAGGTACATGAAAGG - Intergenic
1043800592 8:84605055-84605077 TTTATTATAAAGTAAATCAAGGG + Intronic
1044132170 8:88537499-88537521 TGGAGTATATAGTACATATAGGG - Intergenic
1044365861 8:91344614-91344636 TGTATCATAGAGTACATGAAAGG + Intronic
1044640310 8:94373283-94373305 TGGATTATGCAAAACATGAATGG + Intronic
1045906817 8:107355539-107355561 TGGAGCATAAAGTACATGTAGGG - Intronic
1046041060 8:108905496-108905518 TGGAGGATAAAGCACATGGAAGG + Intergenic
1046721915 8:117629771-117629793 TGGATCATAAGTTCCATGAAGGG + Intergenic
1046827705 8:118709945-118709967 TGGATTATAAAGAGCAAAAATGG + Intergenic
1047554868 8:125918544-125918566 TGGATTAAAAACAACATAAATGG + Intergenic
1047707095 8:127510255-127510277 TGAATTAATAAGGACATGAAAGG + Intergenic
1051059310 9:13027737-13027759 TGGATTATCAAGTACATGTGAGG - Intergenic
1051792478 9:20822420-20822442 TGGATTAGAAAGGAGAGGAAGGG + Intronic
1055937235 9:81614482-81614504 TGTGTTGTAAAGCACATGAAAGG - Intronic
1056205538 9:84316198-84316220 TGGTTTAGAAAGTGAATGAAAGG - Intronic
1056240607 9:84642712-84642734 TGGAATAGATATTACATGAAAGG + Intergenic
1056426377 9:86481240-86481262 TGCATTTTAAAATACATAAATGG - Intergenic
1058260699 9:102827024-102827046 TGTTCTATAAAGTATATGAAGGG - Intergenic
1058320579 9:103625433-103625455 TGGCTTATAAAATAGAAGAAGGG + Intergenic
1059146593 9:111905174-111905196 TCGGTTAAAAAGTAAATGAATGG - Intronic
1059233506 9:112742706-112742728 TGGGTTACAAAGCACAGGAAGGG + Intergenic
1060248895 9:121969974-121969996 TGGATTACAAAGTACTTTCATGG + Intronic
1062349173 9:136130803-136130825 TGAATTTTGAAGGACATGAAAGG - Intergenic
1203725089 Un_GL000216v2:43136-43158 TGGAATGCAAAGTACATGAATGG - Intergenic
1203730422 Un_GL000216v2:84754-84776 TGGAATAGAATGGACATGAAAGG - Intergenic
1203386732 Un_KI270438v1:62242-62264 TGGAATAGAATGGACATGAATGG + Intergenic
1203387040 Un_KI270438v1:65513-65535 TGGAATACAATGGACATGAATGG + Intergenic
1203343355 Un_KI270442v1:13956-13978 TGGAATAGAATGGACATGAATGG + Intergenic
1203673450 Un_KI270756v1:1529-1551 TGGAATAGAATGGACATGAATGG - Intergenic
1203675267 Un_KI270756v1:16675-16697 TGGAGTGTAAAGGACACGAATGG - Intergenic
1203677222 Un_KI270756v1:33015-33037 TGGATTGGAATGGACATGAATGG - Intergenic
1186990159 X:15058222-15058244 GGGATTCTAAAGTACAGGCAGGG + Intergenic
1186991673 X:15076170-15076192 TGGATTTAAAAGTACTTGAGTGG + Intergenic
1187326019 X:18289500-18289522 TTTATTATAAACTACATTAAGGG + Intronic
1187804811 X:23107796-23107818 TGAATTATTAAGTAAATGAATGG - Intergenic
1189135889 X:38549321-38549343 TGGATTATAAGGAACAAGACTGG + Intronic
1193587930 X:83350107-83350129 TGAATTATATACTACAAGAAAGG + Intergenic
1194340079 X:92696637-92696659 TGGATTACACTGTACTTGAAGGG + Intergenic
1195994203 X:110715124-110715146 TGAATTATCAAGTATATAAAGGG + Intronic
1196974847 X:121148075-121148097 TGGCTTTTAAAGGAGATGAAGGG + Intergenic
1199778260 X:151034580-151034602 TGGATTATAAAGGGCAGGATTGG - Intergenic
1199935109 X:152565681-152565703 TGGGTTATGAAGAACATGTAAGG - Intergenic
1200648451 Y:5813401-5813423 TGGATTACATTGTACTTGAAGGG + Intergenic
1200789714 Y:7288508-7288530 TTGATTATATGGTAAATGAAAGG + Intergenic
1200830408 Y:7683692-7683714 TAGACTATATAGTACATGAACGG + Intergenic
1201120912 Y:10872874-10872896 TGGAATTTAAAGTAAAAGAAAGG - Intergenic
1201121036 Y:10873766-10873788 TGGAGTGTAAAGTACAGGAATGG - Intergenic
1201209412 Y:11665768-11665790 TGGAATGGAAAGTACTTGAAAGG + Intergenic
1201218123 Y:11741084-11741106 TGGATTGGAATGTACTTGAATGG + Intergenic
1202021736 Y:20472444-20472466 TGGGCTATAATGTACATTAATGG - Intergenic
1202610693 Y:56676282-56676304 TGGAATGGAATGTACATGAATGG + Intergenic
1202610927 Y:56678252-56678274 TGGAATGGAATGTACATGAATGG + Intergenic
1202611350 Y:56681835-56681857 TGGAATGGAATGTACATGAATGG + Intergenic
1202611769 Y:56685419-56685441 TGGAATGGAATGTACATGAATGG + Intergenic
1202612184 Y:56688977-56688999 TGGAATGGAATGTACATGAATGG + Intergenic
1202612609 Y:56692556-56692578 TGGAATGGAATGTACATGAATGG + Intergenic
1202613029 Y:56696115-56696137 TGGAATGGAATGTACATGAATGG + Intergenic
1202613868 Y:56703273-56703295 TGGAATGGAATGTACATGAATGG + Intergenic
1202614292 Y:56706842-56706864 TGGAATGGAATGTACATGAATGG + Intergenic
1202614699 Y:56710356-56710378 TGGAATGGAATGTACATGAATGG + Intergenic
1202615119 Y:56713940-56713962 TGGAATGGAATGTACATGAATGG + Intergenic
1202615537 Y:56717514-56717536 TGGAATGGAATGTACATGAATGG + Intergenic
1202615954 Y:56721059-56721081 TGGAATGGAATGTACATGAATGG + Intergenic
1202616374 Y:56724647-56724669 TGGAATGGAATGTACATGAATGG + Intergenic
1202616799 Y:56728241-56728263 TGGAATGGAATGTACATGAATGG + Intergenic
1202617217 Y:56731823-56731845 TGGAATGGAATGTACATGAATGG + Intergenic
1202617637 Y:56735397-56735419 TGGAATGGAATGTACATGAATGG + Intergenic
1202618053 Y:56738941-56738963 TGGAATGGAATGTACATGAATGG + Intergenic
1202618473 Y:56742520-56742542 TGGAATGGAATGTACATGAATGG + Intergenic
1202618892 Y:56746099-56746121 TGGAATGGAATGTACATGAATGG + Intergenic
1202619312 Y:56749689-56749711 TGGAATGGAATGTACATGAATGG + Intergenic
1202619724 Y:56753163-56753185 TGGAATGGAATGTACATGAATGG + Intergenic
1202620146 Y:56756727-56756749 TGGAATGGAATGTACATGAATGG + Intergenic
1202620560 Y:56760276-56760298 TGGAATGGAATGTACATGAATGG + Intergenic
1202620979 Y:56763850-56763872 TGGAATGGAATGTACATGAATGG + Intergenic
1202621395 Y:56767399-56767421 TGGAATGGAATGTACATGAATGG + Intergenic
1202621813 Y:56770987-56771009 TGGAATGGAATGTACATGAATGG + Intergenic