ID: 1144539873

View in Genome Browser
Species Human (GRCh38)
Location 17:16130498-16130520
Sequence TCAAGTATTGAGTTTAAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 218}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144539873_1144539876 9 Left 1144539873 17:16130498-16130520 CCTTCTTTAAACTCAATACTTGA 0: 1
1: 0
2: 2
3: 19
4: 218
Right 1144539876 17:16130530-16130552 AAACAAGTTTAATTCTGTCAGGG 0: 1
1: 0
2: 1
3: 46
4: 700
1144539873_1144539875 8 Left 1144539873 17:16130498-16130520 CCTTCTTTAAACTCAATACTTGA 0: 1
1: 0
2: 2
3: 19
4: 218
Right 1144539875 17:16130529-16130551 AAAACAAGTTTAATTCTGTCAGG 0: 1
1: 0
2: 5
3: 46
4: 447

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144539873 Original CRISPR TCAAGTATTGAGTTTAAAGA AGG (reversed) Intronic
903637248 1:24830205-24830227 TCATGTAATGTGATTAAAGAGGG - Intronic
906751462 1:48266263-48266285 TTAGGTATTGAGTTTAATGTTGG - Intergenic
909003839 1:70252462-70252484 CCAAGTTTTGAGTATAAATAGGG + Exonic
909109927 1:71462294-71462316 TCAAGTAAAGATTTTAAAGCTGG + Intronic
910112468 1:83697277-83697299 TAAATTATTGACTTTAGAGAAGG + Intergenic
911743051 1:101408469-101408491 TGCAGTGTTTAGTTTAAAGAGGG + Intergenic
912039162 1:105363976-105363998 TCAAATATGAAATTTAAAGATGG + Intergenic
913998901 1:143675606-143675628 TCCTGCATTAAGTTTAAAGAAGG + Intergenic
915235834 1:154480907-154480929 GCAAGTATTTTTTTTAAAGAAGG + Exonic
915645302 1:157267560-157267582 TCAGGTATACAGTTTAAAGCTGG + Intergenic
918746038 1:188201124-188201146 TCAAGTATTGGGTTGAAATTTGG + Intergenic
918984922 1:191612757-191612779 ATAAGTATTGACTTAAAAGAAGG + Intergenic
919337175 1:196250783-196250805 TCTAGTATTCAATTTAAAAATGG + Intronic
919607892 1:199708589-199708611 TCAAGTATTTAGTTGAATGAGGG + Intergenic
921491450 1:215781167-215781189 TGAAGTAATGAGTATAAATATGG - Intronic
922636745 1:227180869-227180891 TCTAGTGCTGAGTTTAAACATGG + Intronic
923219196 1:231877575-231877597 TCAAGTATTGCGTTGAAAGCTGG - Intronic
924373195 1:243377136-243377158 TTAACTACTGAGTTTAGAGATGG + Intronic
924377881 1:243431962-243431984 TCTAGTAATGAGTTTAAAATAGG + Intronic
924604798 1:245523758-245523780 TCAACTTATGAATTTAAAGAGGG + Intronic
1064923726 10:20547380-20547402 TGAAGAATTGAAATTAAAGAAGG + Intergenic
1068078977 10:52294689-52294711 TAAAATATTGTGCTTAAAGATGG + Exonic
1068682753 10:59838074-59838096 TGAAGTACTGAGTTTGAAGTGGG - Intronic
1070171221 10:73934161-73934183 TGGAGTATTGAGTTTGGAGAGGG + Intergenic
1070547626 10:77465086-77465108 TCAAGTATTAAGTTCTGAGACGG + Intronic
1071390068 10:85165077-85165099 TCTAATATTGAGTATGAAGATGG + Intergenic
1076586749 10:131553932-131553954 TCAAGCCTGGAGTTTAAAGTGGG - Intergenic
1077677849 11:4213233-4213255 TCAACTGTTGACTTTAAAAAGGG + Intergenic
1077903224 11:6507166-6507188 TCAAGTATTGTGGTCAGAGATGG - Intronic
1078713654 11:13818645-13818667 TTAAGTATTCAGTTTAGTGAAGG - Intergenic
1079801350 11:24873639-24873661 TCAAGTATTCAGTTTAAGCTTGG - Intronic
1080483280 11:32675564-32675586 TGAAATATGCAGTTTAAAGAAGG - Exonic
1081136509 11:39446100-39446122 TTAAGTATTGACTTTAAAAATGG - Intergenic
1081858511 11:46318802-46318824 TTAAGGAGTGAGTTTCAAGAAGG + Intronic
1085076289 11:73596083-73596105 TCAAGCAATCAATTTAAAGAGGG + Intronic
1085233282 11:74991237-74991259 TCTAGTATTGAGTGAGAAGATGG + Intronic
1085393139 11:76192815-76192837 CCAAGTCTTGTGTTGAAAGAAGG - Intronic
1087189591 11:95238759-95238781 AAAATTATAGAGTTTAAAGAGGG - Intergenic
1089053177 11:115563746-115563768 TTAAGTATCGAGGTTAGAGAGGG + Intergenic
1089110391 11:116051201-116051223 TCAAGTCCTGAGACTAAAGAGGG + Intergenic
1089286586 11:117411486-117411508 CCAAGGATTGAGTTGACAGAGGG + Intronic
1092584473 12:9882855-9882877 CAAAGTATTGAGATTTAAGAAGG - Intronic
1093376006 12:18428961-18428983 TCAAGTATTGAGTTGAGTGGTGG + Intronic
1093515937 12:19986976-19986998 TCAGGTATTGTGTTTTAAAATGG - Intergenic
1094123315 12:26997007-26997029 TCATGAACTGAGGTTAAAGAGGG + Intronic
1095149980 12:38782490-38782512 TCAAGTATTTAGAGGAAAGAGGG + Intronic
1097178176 12:57155641-57155663 TAAAGCATTGAGTTAAAAAATGG + Intronic
1097542925 12:60962830-60962852 TCAAATAATATGTTTAAAGAAGG + Intergenic
1099057525 12:77863411-77863433 TCAAATAGTGACTATAAAGATGG - Intronic
1099695686 12:86015656-86015678 TCATGTAGAGAGTTTCAAGATGG + Intronic
1100918380 12:99454165-99454187 TAAAGTATTCAGATGAAAGATGG + Intronic
1104290829 12:127465180-127465202 TCAAGTGATTGGTTTAAAGATGG + Intergenic
1105063422 12:133174397-133174419 CAAAATATTGATTTTAAAGATGG + Intronic
1105954696 13:25269370-25269392 TCAAGTATTGAGTTTATAGTAGG - Intronic
1108728689 13:53209386-53209408 TGAGGAAATGAGTTTAAAGAGGG + Intergenic
1108771289 13:53703567-53703589 TCAAGTATAGAATTTGAACAAGG + Intergenic
1109496343 13:63177630-63177652 ACAAGTATTCAGTTTTAAAAGGG + Intergenic
1110477245 13:75930656-75930678 TTAAGTATCGAGGTTAAAAAGGG + Intergenic
1111974911 13:94956218-94956240 TCAAGTAATGATTTAAAACATGG - Intergenic
1111992892 13:95134370-95134392 GCGAGTCTTGAGTTTAAAGAAGG + Intronic
1113993357 14:16046306-16046328 TCAAAAATTGTGTTTAAAGGAGG - Intergenic
1114965300 14:27952000-27952022 TCATGTGTTGATTTTAAACACGG + Intergenic
1115343657 14:32318935-32318957 TCAAGTGTTGATCTTAAAGCAGG - Intergenic
1115667770 14:35571960-35571982 TGAAGAATTCAGTTTAAAAAAGG + Intronic
1117482272 14:56159453-56159475 TAAAGTATGGAGTATAAAAATGG + Intronic
1117863593 14:60120870-60120892 AAAAGTATTGAGTTTATAAAAGG - Intronic
1118011809 14:61617389-61617411 TCAAGTATGTGGTTTATAGAGGG + Intronic
1118625184 14:67652266-67652288 TCAAATATTGTCTTCAAAGAAGG + Intronic
1120258304 14:82148340-82148362 TAAAGTATTGAATTTGAATATGG + Intergenic
1124134016 15:27018130-27018152 TCAAATATTCAGTTTATAGATGG + Intronic
1125699793 15:41671947-41671969 TGAAGAATCAAGTTTAAAGATGG - Intronic
1126463854 15:48942663-48942685 TTAAGTATTGACTTTCTAGAAGG + Intronic
1129627059 15:77212680-77212702 ACAAGTATAGAGTTTAGTGAAGG - Intronic
1135394643 16:22121979-22122001 TCAAGTATGAAGTATAAAGAGGG + Intronic
1136912715 16:34158020-34158042 TCAAAAATTGTGTTTAAAGGAGG - Intergenic
1138177436 16:54913619-54913641 TCATATATAAAGTTTAAAGATGG + Intergenic
1140181485 16:72723579-72723601 TCAAGCAATGACTTTACAGAAGG + Intergenic
1141606303 16:85155586-85155608 TCATGTATTGAATTCAAACATGG - Intergenic
1142077638 16:88129508-88129530 CCAAGTACTGTGTTGAAAGAGGG - Intergenic
1143982635 17:10883289-10883311 TCATGTATTTAGTTTATAGAGGG + Intergenic
1144313051 17:14031368-14031390 TCAAGTATTTATATGAAAGACGG + Intergenic
1144433363 17:15216539-15216561 TCAGGTATTCAGTTAACAGAAGG + Intergenic
1144539873 17:16130498-16130520 TCAAGTATTGAGTTTAAAGAAGG - Intronic
1147139945 17:38455203-38455225 TGAAGGATTGAGGTTAAACAAGG + Intronic
1147362233 17:39938264-39938286 TCACGTATTGAGTCTAGAGGTGG + Intergenic
1148375036 17:47135697-47135719 TCAAAAATTGTGTTTAAAGGAGG - Intronic
1148729411 17:49822883-49822905 TCAAAAATTGCGTTTAAAGTGGG + Intronic
1149559502 17:57598322-57598344 TCTATTATTGAATTTAAAGTTGG - Intronic
1150037795 17:61822807-61822829 ACAAGTTTTCAGTTTAAAGGTGG + Intronic
1152446000 17:80344161-80344183 TTAAAAAGTGAGTTTAAAGATGG - Intronic
1154982758 18:21517325-21517347 TCAAGGCTTTAGTTTCAAGATGG + Intronic
1155681607 18:28493248-28493270 TGAAACATTGAGTTTTAAGAAGG + Intergenic
1158065051 18:53396859-53396881 TCAAAAATTGAGTTGACAGAAGG + Intronic
1162690090 19:12422390-12422412 TCAGGGATTGAGTGTAGAGAAGG + Intronic
1163986297 19:20953994-20954016 TCAAGAATGTAGTTAAAAGATGG + Intergenic
1165132051 19:33639008-33639030 TCAAATATTGTGCTTAAAGGTGG + Intronic
1168235012 19:55057300-55057322 TCTAAGATTGATTTTAAAGATGG + Intronic
925697888 2:6601589-6601611 TCAAGTGCTGAAATTAAAGATGG - Intergenic
926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG + Intronic
926824153 2:16885487-16885509 TAAAATATTTAATTTAAAGACGG - Intergenic
930566620 2:53028616-53028638 CCCAGTCTTGAGTTTAAAAAAGG - Intergenic
931017186 2:57996537-57996559 TCAAGACATGAGTTTAAAAAAGG - Intronic
933384622 2:81594158-81594180 TCAATTTTTTATTTTAAAGAAGG + Intergenic
935536040 2:104295623-104295645 ACAAGGTTTGACTTTAAAGATGG - Intergenic
938538326 2:132264543-132264565 TCAAAAATTGTGTTTAAAGGAGG + Intergenic
939524791 2:143279318-143279340 TCAAGTATTGCGTCTGATGATGG + Intronic
939743624 2:145941723-145941745 ACAAGCATTGAGTTACAAGACGG - Intergenic
940537420 2:154963294-154963316 TAAAGCACTGAGTTTAAAAAGGG - Intergenic
940839205 2:158559543-158559565 CCAAGCATTCAGTTTAGAGATGG + Intronic
941194938 2:162437798-162437820 CTAAGTATTGCGTTTAAAAAGGG - Intronic
941234464 2:162952825-162952847 TCATGTCTTGAATTTAGAGATGG - Intergenic
941830259 2:169950229-169950251 TGATGTATTGAGTTTATTGATGG + Intronic
942536350 2:176968537-176968559 TCAATTAGGGAGATTAAAGATGG + Intergenic
944482322 2:200170674-200170696 TCAAGTGATGAGGTTAAACAAGG - Intergenic
946378513 2:219328901-219328923 GTAAGTATTGAGTTTAAAATAGG - Intronic
1168981801 20:2010319-2010341 TCAGGTTTTGAGTTTTAAGAAGG - Intergenic
1171811666 20:29749553-29749575 TCAAAAATTGTGTTTAAAGGAGG + Intergenic
1171867226 20:30496348-30496370 TCAAAAATTGTGTTTAAAGGAGG + Intergenic
1171908003 20:30916168-30916190 TCAAAAATTGTGTTTAAAGGAGG - Intergenic
1177006048 21:15673390-15673412 TCAAGTTTTTACTTGAAAGAGGG + Intergenic
1178725048 21:35044051-35044073 ACAAGTTTTGATTTTAAATATGG - Intronic
1180313911 22:11261207-11261229 TCAAAAATTGTGTTTAAAGGAGG + Intergenic
1180341437 22:11622320-11622342 TCAAAAATTGTGTTTAAAGGAGG - Intergenic
1182919131 22:34063541-34063563 TCCAGTATTGAGATTAAAGAAGG + Intergenic
949769064 3:7558882-7558904 TCAAGAATTGTGTTCAAATATGG + Intronic
951744638 3:25963590-25963612 TGAAATATTGAGTTTGATGAAGG + Intergenic
952124589 3:30285577-30285599 GCAAGTATTCAGTTGAAAGAAGG + Intergenic
952419805 3:33120738-33120760 TTAATTATTTAGTTTTAAGAGGG + Intronic
955786493 3:62546105-62546127 TCAAGTATTGCATTTTAAAAAGG - Intronic
956352099 3:68348874-68348896 TCAAGGATTCATATTAAAGAGGG + Intronic
957006252 3:74951112-74951134 TTAATTATGGAGTTTAAATATGG + Intergenic
959514168 3:107246773-107246795 TGAAGTTTTGATTATAAAGAAGG - Intergenic
959897692 3:111623280-111623302 ACAATTATGGAGTATAAAGATGG + Intronic
960819158 3:121708660-121708682 TAAAGTATACAGTTTAAAGAGGG - Intronic
960885503 3:122390154-122390176 TTTAGTTTTGATTTTAAAGATGG + Intronic
961757164 3:129135412-129135434 CCAAGTACTGATTTTAAAAAGGG - Intronic
963505373 3:146178469-146178491 CCAATTCTTGAGTTGAAAGATGG - Intergenic
965322719 3:167268189-167268211 ACAAGTCTGGAATTTAAAGAAGG + Intronic
967860523 3:194148004-194148026 TCAAGGATGGAGTTTGAACATGG - Intergenic
970020810 4:11566421-11566443 TCAAGTATTAAGTTTTAAAATGG - Intergenic
974190816 4:58500339-58500361 CCAAGTTTTGTGATTAAAGATGG + Intergenic
978529674 4:109701402-109701424 TCAAGAATCAGGTTTAAAGAAGG - Intronic
978683043 4:111405954-111405976 TAAAGTTTTAACTTTAAAGAAGG + Intergenic
980050043 4:128030159-128030181 TCAATCATTTATTTTAAAGATGG - Intronic
980200242 4:129647411-129647433 TGAATTATAGAGTTGAAAGATGG - Intergenic
983116496 4:163823988-163824010 TCAAGTTTTTAATTAAAAGATGG + Intronic
983128338 4:163982630-163982652 ACAAGGATTGGTTTTAAAGAAGG + Intronic
983339302 4:166437520-166437542 TCTGGTATTGAGCTTAAAAAAGG - Intergenic
983990225 4:174109103-174109125 TCAAGTATTAATATTAAAAAGGG - Intergenic
984195447 4:176653359-176653381 TCAACTTTTGATTTTAAATAAGG - Intergenic
986591994 5:9380450-9380472 TAAAATATTTAGTTTTAAGAAGG + Intronic
987778119 5:22395946-22395968 GCAAGGAATGAGGTTAAAGATGG - Intronic
988176715 5:27736332-27736354 TAAACTATTGAGTTTTAAGGTGG - Intergenic
988915434 5:35889287-35889309 TCCAGTTTTGAGTTTGCAGATGG - Intergenic
992660892 5:78959504-78959526 TCAAGTACAGAGTTTAAGGATGG - Intronic
992887435 5:81172720-81172742 TCAAATGATGAGTTTATAGAAGG + Intronic
992993723 5:82312325-82312347 TCAAGTGTTGATTCTAAAAAAGG + Intronic
994022365 5:95042287-95042309 TCAAGTACACACTTTAAAGAGGG + Intronic
994655479 5:102587734-102587756 TCAAGTTCTGAGTTTAAAAAAGG - Intergenic
994925892 5:106116727-106116749 TGAAGTTTTTTGTTTAAAGAGGG - Intergenic
995102140 5:108325142-108325164 TTAAGTATTCAGTTTAGTGACGG - Intronic
995271872 5:110228736-110228758 TAAAATATTGATTTTAAAGAAGG + Intergenic
995355284 5:111229983-111230005 TCAACAAATGATTTTAAAGAGGG + Intronic
996993942 5:129671665-129671687 TTAAGAATACAGTTTAAAGAAGG - Intronic
1000695931 5:164383691-164383713 TCGAGTATTAGTTTTAAAGAAGG - Intergenic
1003019803 6:2499826-2499848 GCAAGCATTGAGTTAAGAGATGG + Intergenic
1003704944 6:8515338-8515360 TCATGTTTTGAGTTTTAAAATGG - Intergenic
1003793609 6:9575105-9575127 GCAAGTATTCAGCTTAAAGTGGG + Intergenic
1005144859 6:22677648-22677670 TCAAAATTTTAGTTTAAAGAAGG + Intergenic
1006745494 6:36339080-36339102 TCAACTTTTGAGTTTGGAGATGG + Intergenic
1006758928 6:36442534-36442556 TCAAATACTGAGTTTCATGAAGG - Exonic
1008504301 6:52214416-52214438 CCAACTACTGAGTGTAAAGATGG + Intergenic
1008924922 6:56881592-56881614 TAAACTTTTGAGTTTGAAGATGG - Intronic
1008948677 6:57129963-57129985 TAAAGTATTGAGATCACAGATGG - Intronic
1012104012 6:95129635-95129657 TCAACTGTTGAGTTAAAAAATGG - Intergenic
1013904168 6:115195611-115195633 CCAAGCATTGAGTTCAGAGAAGG + Intergenic
1014846932 6:126289046-126289068 TAAGGTATTGAGTGTAGAGATGG - Intergenic
1016121621 6:140349486-140349508 TGAATTATTGATTTTAAAAAAGG + Intergenic
1019638986 7:2092648-2092670 CCTATTATTGAGTTTTAAGAAGG + Intronic
1020586552 7:10077578-10077600 TAGAGTATTGAGGTGAAAGATGG - Intergenic
1021094872 7:16524846-16524868 TCAAGGATGGAGGTTAATGAAGG - Intronic
1022666003 7:32410922-32410944 TCAAATAAAGAGTTTAATGAAGG - Intergenic
1022766941 7:33423722-33423744 TCAAGTTTTGTCTTTGAAGAAGG - Intronic
1024228778 7:47348101-47348123 TCCAAGAATGAGTTTAAAGAGGG + Intronic
1024474444 7:49795486-49795508 TAAAGCAATGACTTTAAAGAAGG - Intronic
1025195743 7:56931365-56931387 TCATTTAATGAGTTTTAAGAGGG + Intergenic
1025676206 7:63645570-63645592 TCATTTAATGAGTTTTAAGAGGG - Intergenic
1025715341 7:63950680-63950702 TCATGTGTTGAGGTGAAAGATGG - Intergenic
1030267794 7:107638258-107638280 TCAAGTACAAAGTTTGAAGATGG - Intergenic
1030504838 7:110408413-110408435 TGAAGTAGTGAGTTTAAAAAAGG - Intergenic
1031471960 7:122176883-122176905 ACAAGCCTTGTGTTTAAAGATGG - Intergenic
1031656701 7:124364928-124364950 TCAATTATGGAGTCTAAACAGGG + Intergenic
1031934616 7:127723917-127723939 TCAAATATTCAGTTTTAAAAAGG - Intronic
1034851713 7:154499984-154500006 GCATGTATTGTGTTTAGAGAGGG - Intronic
1034916067 7:155040147-155040169 TCAAAAATTGAATTTAAAAAGGG + Intergenic
1036078963 8:5532040-5532062 TTAAGTGTTTAGTTTTAAGATGG + Intergenic
1036430809 8:8688788-8688810 TCTAGTAGTGAGATTAAAAAAGG - Intergenic
1039120348 8:34139087-34139109 TGAAGTAATCAGTTTAAATATGG + Intergenic
1039312186 8:36329225-36329247 TAAAGTTTTGACTTAAAAGATGG + Intergenic
1040892718 8:52334615-52334637 CCAAGGATTGAGGTTTAAGAGGG + Intronic
1040917358 8:52576724-52576746 TCATGTATTGAGGTGAAAGAGGG + Intergenic
1041488593 8:58407202-58407224 TAAATTATTGAGTTGAAAGGGGG - Intergenic
1043679838 8:83009699-83009721 ACAAGAATTGACTTTAAAGAGGG - Intergenic
1043802495 8:84627835-84627857 TGAAGGATTGAATTTAAATATGG - Intronic
1043910696 8:85859937-85859959 ACAAATATTGAGCTTACAGAGGG - Intergenic
1044186445 8:89257739-89257761 TCATATATTGAGGTTAAAAATGG - Intergenic
1044495293 8:92870919-92870941 TAAAGTATTGAGTTCAATTATGG + Intergenic
1044639549 8:94364214-94364236 TCAGATTTTGAGTTAAAAGAGGG + Intergenic
1044872435 8:96632505-96632527 TCAAGTATTTGGTTTTAATATGG - Intergenic
1046306531 8:112374122-112374144 CTAAGTATTGAGTTTAAATTCGG - Intronic
1047317959 8:123751971-123751993 TGTACTATTGAGTTGAAAGAAGG + Intergenic
1047901270 8:129424503-129424525 AAAATTAGTGAGTTTAAAGACGG + Intergenic
1048618634 8:136107133-136107155 GCAAGGATGGTGTTTAAAGATGG - Intergenic
1051408914 9:16768849-16768871 TCAAGCGTTGAATTTAAACAGGG + Intronic
1052643852 9:31206277-31206299 TGAAGTATTGAGTTTGCAGCTGG + Intergenic
1054837641 9:69695762-69695784 TCAAATATTGTATCTAAAGAGGG - Intergenic
1057972048 9:99567818-99567840 TAAAGAGTTGAGTTTAAAAAGGG + Intergenic
1058771577 9:108238536-108238558 TCAAGCATTCATTTTAAAGCAGG - Intergenic
1059038636 9:110788024-110788046 TGAAGTGATGAATTTAAAGAGGG - Intronic
1059964576 9:119601088-119601110 ACAAGTATGGAGATAAAAGAGGG - Intergenic
1203758819 EBV:962-984 ACAAGTAATGAGTTAAAGGAAGG - Intergenic
1203362291 Un_KI270442v1:227420-227442 TCAAAAATTGTGTTTAAAGGAGG + Intergenic
1186565922 X:10662364-10662386 TTAACTATGGAGTTAAAAGAGGG - Intronic
1186566064 X:10664097-10664119 TTAACTATGGAGTTAAAAGAGGG + Intronic
1186714083 X:12231938-12231960 TCAAGCATTAATTTTAAATAGGG - Intronic
1186975604 X:14900063-14900085 TTAAGTATTGTGTTTAAAAAAGG + Intronic
1187717250 X:22114893-22114915 TGAGGTATTGAATTTAAAGAGGG + Intronic
1188550665 X:31361194-31361216 TCAAGTATTTACTATAAAAAAGG - Intronic
1190138731 X:47821211-47821233 TGAAGTATAGAATTTAAAAAGGG + Intergenic
1191220498 X:57983294-57983316 TCAAGTATTTTGTTTAATAAAGG + Intergenic
1193136876 X:77981705-77981727 CAAAGTACTCAGTTTAAAGATGG + Intronic
1194469069 X:94270033-94270055 TAAATTATTTTGTTTAAAGAGGG - Intergenic
1194593098 X:95824911-95824933 TTGAGTATTGAGTGAAAAGAAGG + Intergenic
1195601451 X:106752970-106752992 AAAAGTATTGAGCTTGAAGAGGG + Intronic
1196988036 X:121296235-121296257 TAAAGAGTTGAGTTTGAAGAGGG - Intergenic
1197423057 X:126262139-126262161 TAAAGTATTGAAGGTAAAGACGG - Intergenic
1198302995 X:135349672-135349694 TAAAGTATTAAGTTTGAATAAGG - Intronic
1201076024 Y:10188919-10188941 TCAAAAATTGTGTTTAAAGGAGG - Intergenic
1202178644 Y:22120518-22120540 GCAGGGATGGAGTTTAAAGAAGG + Intergenic
1202212717 Y:22465876-22465898 GCAGGGATGGAGTTTAAAGAAGG - Intergenic