ID: 1144543996

View in Genome Browser
Species Human (GRCh38)
Location 17:16175324-16175346
Sequence CACTGCACAACACAACAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 205
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 190}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144543994_1144543996 10 Left 1144543994 17:16175291-16175313 CCAGGCAGAGGTTGCAGTGAGTC 0: 2
1: 36
2: 122
3: 276
4: 640
Right 1144543996 17:16175324-16175346 CACTGCACAACACAACAGTCTGG 0: 1
1: 0
2: 0
3: 14
4: 190
1144543993_1144543996 11 Left 1144543993 17:16175290-16175312 CCCAGGCAGAGGTTGCAGTGAGT 0: 5
1: 86
2: 161
3: 337
4: 815
Right 1144543996 17:16175324-16175346 CACTGCACAACACAACAGTCTGG 0: 1
1: 0
2: 0
3: 14
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144543996 Original CRISPR CACTGCACAACACAACAGTC TGG Intronic
901300820 1:8199010-8199032 CACTACACTACACTACAGTCTGG - Intergenic
902743636 1:18458226-18458248 CACTGCACAACGCAAGAGGGAGG + Intergenic
905083056 1:35342579-35342601 CACTTCACAAAACAACATTTAGG - Intronic
906839311 1:49119758-49119780 CACTGCACAACAAGACAGCAGGG - Intronic
910533974 1:88275198-88275220 CACAGCAAAACACAACACACAGG + Intergenic
913976997 1:143467780-143467802 CTCTTCAAAACACTACAGTCTGG + Intergenic
914071401 1:144293407-144293429 CTCTTCAAAACACTACAGTCTGG + Intergenic
914107754 1:144672949-144672971 CTCTTCAAAACACTACAGTCTGG - Intergenic
914204369 1:145514568-145514590 CACTGAACACCACAACCATCAGG - Intergenic
914483491 1:148087756-148087778 CACTGAACACCACAACCATCAGG - Intergenic
916019102 1:160777076-160777098 CACAGGACACAACAACAGTCTGG + Intergenic
917668023 1:177244589-177244611 CACTACACTACACTACAGCCTGG + Intronic
920173196 1:204084223-204084245 CACAGCACCACACCACAGGCAGG - Intronic
922181015 1:223232924-223232946 AACTGCATAACACAAAGGTCAGG + Intronic
922801085 1:228365087-228365109 CACTGCAGGACCCAGCAGTCTGG - Intronic
923488071 1:234455389-234455411 GACTGGACAACTCAACAGTTCGG + Intronic
924499402 1:244623114-244623136 CACTGCACTGCACTTCAGTCCGG - Intronic
1062767335 10:75757-75779 CACTGCACTGCACTCCAGTCTGG - Intergenic
1063582637 10:7322634-7322656 CACAGCACAGCACAAAAGTAAGG + Intronic
1064115161 10:12571408-12571430 CACTGCACTGCACTGCAGTCTGG + Intronic
1065423565 10:25575021-25575043 CACACCACTACACTACAGTCTGG + Intronic
1066260604 10:33726052-33726074 CACAGCACTGCACCACAGTCTGG - Intergenic
1067180998 10:43985962-43985984 CACAGCAAAACACCACAGGCTGG - Intergenic
1069391085 10:67935829-67935851 CACTTCACAAAACAAAAGTTTGG - Intronic
1070699712 10:78592682-78592704 CACTCCAGAACACATCTGTCTGG + Intergenic
1077327140 11:1968807-1968829 CACAGGACAACAGACCAGTCTGG + Intronic
1078748079 11:14134435-14134457 TAATGCACAACACAACAGCATGG - Intronic
1079080388 11:17409923-17409945 CACTGCACTCCACTACAGCCTGG - Intronic
1079845187 11:25457656-25457678 CACTGCACTACAATACAGCCTGG - Intergenic
1083125502 11:60561700-60561722 CACTGCACTACACTACAGCCTGG - Intergenic
1084241657 11:67825314-67825336 CTCTGCAAAACCCAACAGTTAGG - Intergenic
1087664297 11:101025513-101025535 CACTGCACTACACTACAGCCTGG - Intergenic
1089168134 11:116493434-116493456 TACTTCACAACACACCAGTTGGG + Intergenic
1202810122 11_KI270721v1_random:23987-24009 CACAGGACAACAGACCAGTCTGG + Intergenic
1092200530 12:6579543-6579565 CACTGCACTGCACATCAGCCTGG + Intronic
1094448075 12:30554572-30554594 CACTGCACTCCACTCCAGTCTGG - Intergenic
1094711135 12:32963765-32963787 CACTGCACAAGCCAACAGACAGG - Intergenic
1095713267 12:45313374-45313396 CACTGAACAACACTCCAGTGAGG - Intronic
1096814287 12:54191861-54191883 CACTGCACAAAACAAAGGTCGGG + Intergenic
1097516952 12:60618016-60618038 CACTGGCCACCACAACAGCCTGG + Intergenic
1099834028 12:87883972-87883994 CACTGCATAAAACAACAGCTCGG - Intergenic
1101072848 12:101094946-101094968 CACTGCACTCCAGAACAATCTGG + Intronic
1102165210 12:110800712-110800734 AACTGCACAAGACAACTGTAGGG + Intergenic
1102689777 12:114751318-114751340 CACTGCAACACACAGCAGTAAGG - Intergenic
1102924236 12:116814715-116814737 CACTGCACACTCCAGCAGTCTGG - Intronic
1103812183 12:123623991-123624013 CACTGTACTACACTACAGCCTGG + Intronic
1103957966 12:124589333-124589355 CACTGCACTGCACACCAGCCTGG - Intergenic
1104097992 12:125577359-125577381 CACTGCTCCACTCATCAGTCTGG + Intronic
1105222230 13:18342036-18342058 CTCTTCAAAACACTACAGTCTGG - Intergenic
1105243078 13:18624938-18624960 CACAGCACAGCACCACAGCCTGG + Intergenic
1105319415 13:19303931-19303953 CACTGCACTACACACCAGCCTGG + Intergenic
1105707375 13:22976738-22976760 CACAACACAACACAACAGAAAGG + Intergenic
1105758649 13:23493159-23493181 CCCAGCACAACACCACGGTCTGG - Intergenic
1106092302 13:26607673-26607695 CACTCCACAGCACTCCAGTCTGG - Intronic
1106841293 13:33687605-33687627 CTCTTCTCAACACAACAGTGTGG - Intergenic
1107062104 13:36170530-36170552 CACTACACATCCCAACTGTCTGG - Exonic
1107177165 13:37412081-37412103 CACTGCACACCACTCCAGCCTGG + Intergenic
1107579780 13:41770854-41770876 CACTTTACAAAATAACAGTCTGG - Intronic
1107706615 13:43113836-43113858 CACTGCACTGTACAACATTCTGG - Exonic
1108398980 13:50019992-50020014 CACACCACTACACACCAGTCTGG + Intronic
1108442307 13:50467251-50467273 CACTACAAAACACTGCAGTCTGG - Intronic
1109314688 13:60736080-60736102 GACTCCACAGAACAACAGTCTGG - Intergenic
1115911259 14:38258981-38259003 CACTGCACAAAACAAAAGCTAGG - Intergenic
1117270008 14:54133978-54134000 CACTGGAAGACAGAACAGTCTGG - Intergenic
1119713705 14:76843242-76843264 CACTGCACTGCACTCCAGTCTGG + Intronic
1119895520 14:78216471-78216493 CACTACACAACACAGCAGTGGGG + Intergenic
1121700171 14:95946938-95946960 CACTGCATGACACAAAAGACAGG - Intergenic
1122451551 14:101812521-101812543 AACAAAACAACACAACAGTCTGG - Intronic
1122461626 14:101900438-101900460 AATTGCACAGCACAAGAGTCGGG + Intronic
1123488210 15:20759696-20759718 CACAGCACAGCACCACAGCCTGG - Intergenic
1123544708 15:21328769-21328791 CACAGCACAGCACCACAGCCTGG - Intergenic
1126377169 15:48007920-48007942 CAGGGCAGAACACAGCAGTCAGG + Intergenic
1127138942 15:55954043-55954065 CACTTCAAAACCCTACAGTCTGG + Intronic
1128076091 15:64826467-64826489 CACTGCACTCCACTACAGCCTGG - Intergenic
1129095848 15:73206895-73206917 CACTTCACCACACTCCAGTCTGG - Intronic
1132236703 15:100227508-100227530 CATTGCTCAACACAGAAGTCTGG + Intronic
1202953052 15_KI270727v1_random:56040-56062 CACAGCACAGCACCACAGCCTGG - Intergenic
1134653455 16:15928698-15928720 CACTGCACTGCACTCCAGTCTGG + Intergenic
1135118608 16:19745640-19745662 TACTGTACAACACAGCAATCAGG - Intronic
1136464971 16:30436486-30436508 CACAGCACTACACAGCAGCCTGG - Intergenic
1137537283 16:49337049-49337071 CACTGCTGAGCAGAACAGTCAGG + Intergenic
1142033683 16:87851066-87851088 CACAGCACAAGACCAAAGTCTGG + Intronic
1143189891 17:5033525-5033547 CACTGCCCAGCACCACAGCCAGG + Exonic
1144543996 17:16175324-16175346 CACTGCACAACACAACAGTCTGG + Intronic
1144878421 17:18416453-18416475 CGCTCCACTACACAGCAGTCTGG + Intergenic
1145153812 17:20527940-20527962 CGCTCCACTACACAGCAGTCTGG - Intergenic
1149720723 17:58841562-58841584 CACTGCACTGCACTCCAGTCTGG - Intronic
1149921674 17:60666324-60666346 CACTGCACTCCACATCAGCCTGG - Intergenic
1152518340 17:80839076-80839098 CAGTGCACACCACAGCCGTCAGG + Intronic
1152614233 17:81330561-81330583 CACTGAAAAACCCAACAGTGGGG + Exonic
1153408094 18:4762544-4762566 CAGTGGATAAGACAACAGTCTGG + Intergenic
1154445855 18:14434959-14434981 CACAGCACAGCACCACAGCCTGG - Intergenic
1155180417 18:23340501-23340523 CACTGCACAGCCCAAGAGTGAGG + Intronic
1155182444 18:23359462-23359484 AACTGCAGAACACAACAGTGAGG - Intronic
1156993105 18:43434241-43434263 CACAGGACACCACAACTGTCTGG - Intergenic
1157154980 18:45256438-45256460 CCCTGCACAACACACCTATCAGG - Intronic
1157749035 18:50161764-50161786 CACTGCAAAACACAACTCTAAGG + Intronic
1158265955 18:55660955-55660977 CCCTACACAACAGCACAGTCAGG + Intronic
1158512760 18:58106189-58106211 CACTGCCCAAATCAACTGTCAGG + Intronic
1160586805 18:79917682-79917704 CACTGCCCAACCCAACAGTGAGG + Intronic
1161097263 19:2399667-2399689 CACAACACAACACAACACTCTGG - Intronic
1163430393 19:17263825-17263847 CACTGCACTGCACTACAGCCTGG + Intronic
1164161565 19:22628574-22628596 CACCGCCCAGCACCACAGTCTGG - Intergenic
1167443085 19:49521095-49521117 CACTGCACTCCACTCCAGTCTGG - Intronic
925517124 2:4695351-4695373 CATTTCTCAACACAACATTCAGG - Intergenic
934181701 2:89628758-89628780 CTCTTCAAAACACTACAGTCTGG + Intergenic
934292002 2:91702977-91702999 CTCTTCAAAACACTACAGTCTGG + Intergenic
934576306 2:95403568-95403590 CACTTCTCACCACAACATTCTGG + Intronic
934615238 2:95766535-95766557 CAGTGCAAAACACAGCAGCCAGG - Intergenic
934638495 2:96011397-96011419 CACTTCTCACCACAACATTCTGG + Intergenic
934795163 2:97094014-97094036 CACTTCTCACCACAACATTCTGG - Intronic
935924535 2:108052723-108052745 CTCTGCACAACACAGAAGACAGG - Intergenic
937297133 2:120816232-120816254 CACTGCACTGCACTCCAGTCTGG - Intronic
937796452 2:126027870-126027892 CACTGCACTACACTCCAGCCTGG + Intergenic
938492606 2:131771893-131771915 CACACCACAGCACTACAGTCTGG - Intergenic
938679646 2:133676623-133676645 CATTGCACAAGACAAAAGTAGGG - Intergenic
938811515 2:134857397-134857419 CACTGCACTCCACTCCAGTCTGG + Intronic
941019514 2:160392851-160392873 CACTGCACCACACTCCAGCCCGG + Intronic
942867610 2:180694705-180694727 CACTGCACACGAGAACAGTAAGG - Intergenic
942980279 2:182072397-182072419 CACTACACTACACAACTGTAAGG - Intronic
944445715 2:199786191-199786213 CACTACACAACTCCACAATCAGG - Intronic
944985492 2:205170886-205170908 AACTGCACAACACAAAAATAGGG - Intronic
945926993 2:215816005-215816027 CAATGCACAACTGAAAAGTCTGG + Intergenic
946848123 2:223879141-223879163 CACACCACTACACTACAGTCTGG + Intronic
946862795 2:224015698-224015720 CACTGCGCATGACAACAGGCAGG + Intronic
948789237 2:240368836-240368858 CACTGCATTGCACAACAGGCTGG + Intergenic
1176450122 21:6854898-6854920 CACAGCACAGCACCACAGCCTGG + Intergenic
1176730779 21:10494459-10494481 CTCTTCAAAACACTACAGTCTGG - Intergenic
1176828291 21:13719916-13719938 CACAGCACAGCACCACAGCCTGG + Intergenic
1177141402 21:17361738-17361760 CACACCACTACACACCAGTCTGG + Intergenic
1178952627 21:36997743-36997765 CACAGCACTGCACACCAGTCTGG + Intergenic
1180105582 21:45616309-45616331 CACTGCAGAACACACGTGTCTGG + Intergenic
1180136859 21:45867572-45867594 CTGTGCACAACACAAGGGTCGGG - Intronic
1181768088 22:25106290-25106312 CAATACAGAACACAACACTCAGG - Intronic
1182808781 22:33098257-33098279 CACTCCACTACACATCAGTCTGG + Intergenic
1185171342 22:49296346-49296368 CCCTGCACAGCACAGCAGCCAGG + Intergenic
949118616 3:358655-358677 CACTGCACAACCTCACACTCAGG + Intronic
954568444 3:51620134-51620156 CACTGCACCACACTCTAGTCTGG - Intronic
955708131 3:61750056-61750078 CACTGCAAAACAAAACAGATAGG - Intronic
962766535 3:138568938-138568960 CACTGCACACCACATCAGCCTGG + Intronic
966557044 3:181274161-181274183 CACTGCACAATCCAATAGACTGG - Intergenic
968731575 4:2271627-2271649 CACTGCACTAGACACCAGTGGGG - Intronic
974595202 4:64005174-64005196 CACTCCACTACACTCCAGTCTGG - Intergenic
975090560 4:70397684-70397706 GACTGCACATCACAACTATCTGG - Intergenic
976711977 4:88082149-88082171 CACTGCACTACACTCCAGCCTGG + Intergenic
980447439 4:132928953-132928975 CACAGCAAAATACCACAGTCTGG + Intergenic
980758351 4:137194874-137194896 TACTGGACAACACAACCATCTGG + Intergenic
981171921 4:141635994-141636016 CACTGGACTACACAATAGGCTGG + Intergenic
984583343 4:181535152-181535174 GGCTGCACCACTCAACAGTCGGG + Intergenic
989381972 5:40817940-40817962 CACTGCACTGCACACCAGCCTGG + Intergenic
992006717 5:72485624-72485646 GTCTGCTCAACACAATAGTCAGG + Intronic
993476211 5:88368041-88368063 CACCACACAAGACAAAAGTCAGG - Intergenic
995468642 5:112477215-112477237 CACTGCACTGCACAGCAGCCTGG - Intergenic
996138753 5:119877918-119877940 CACTGCACTGCACTACAGTTTGG - Intergenic
997359570 5:133286112-133286134 CACTGCACAACATCACACCCAGG - Intronic
999642071 5:153681993-153682015 CACTGCATACCACACCAGCCTGG + Intronic
1000613750 5:163405351-163405373 CACTGCACTACACTCCAGCCTGG - Intergenic
1001326269 5:170727895-170727917 CACTGCACCACACTCCAGCCTGG + Intronic
1004187029 6:13429657-13429679 CAGGGCACAACACAATAGTGTGG + Intronic
1004608569 6:17216971-17216993 CACTGCACTGCACTCCAGTCGGG + Intergenic
1008467568 6:51847686-51847708 CACTTCACAGCACAAATGTCTGG + Intronic
1010023621 6:71190122-71190144 CACTACACTACACTACAGCCTGG - Intergenic
1017229707 6:152060529-152060551 CACTACAAAACACAACCATCAGG + Intronic
1017611526 6:156191337-156191359 CACTGCACTGCACTCCAGTCTGG + Intergenic
1018804071 6:167245215-167245237 CAGAGCACTACACCACAGTCAGG - Intergenic
1021490155 7:21210993-21211015 CACTGCACAGCACTCCAGCCTGG + Intergenic
1021730741 7:23592993-23593015 CACAGCACTACACTTCAGTCTGG + Intergenic
1025086209 7:56025630-56025652 CACTGCACTACACTCCAGCCTGG - Intronic
1026154625 7:67816355-67816377 CACAGCACAGCACAGCAGGCTGG + Intergenic
1029896689 7:103990426-103990448 CAATGAATAACAGAACAGTCCGG - Intergenic
1030834228 7:114263495-114263517 CACAGCACTAAACACCAGTCTGG - Intronic
1031135658 7:117881293-117881315 CACTCCACTGCACTACAGTCTGG - Intergenic
1031994803 7:128222935-128222957 CACAGCACAACCCAGCAGTGTGG + Intergenic
1032707595 7:134434605-134434627 CACTGGATAACAAAACAATCTGG + Intergenic
1034598804 7:152227067-152227089 CTCTTCAAAACACTACAGTCTGG + Intronic
1036975217 8:13403677-13403699 CACTGCACTGCACTACAGCCTGG - Intronic
1037076369 8:14724188-14724210 TACAGCAGAACACAACATTCAGG - Intronic
1037588672 8:20295313-20295335 CACTGCAGAACAGACCAGCCAGG - Intronic
1038161814 8:25046671-25046693 CACTGCACTCCACTACAGCCTGG + Intergenic
1041241102 8:55849781-55849803 CTCAGCACAACACAGCAGCCTGG + Intergenic
1042562682 8:70084947-70084969 CACTGCACTGCACTCCAGTCTGG - Intergenic
1042584221 8:70317428-70317450 CATTGCACAACCCAACACTGTGG + Intronic
1043644320 8:82498633-82498655 GACTGCACAAAACAGCAGTGGGG - Intergenic
1044307976 8:90659543-90659565 CACTGCACTGCACTCCAGTCTGG - Intronic
1046799961 8:118415161-118415183 AACTGCACAACACAACTGAAAGG + Intronic
1049728405 8:144162432-144162454 CACTGCACTACACTCCAGCCTGG - Intronic
1049767206 8:144360425-144360447 CACTGCCCAGCACCACAGCCAGG - Exonic
1051325162 9:15958948-15958970 CACTGCACAACCAAGAAGTCAGG - Intronic
1056778562 9:89532430-89532452 CCCTGCACAACACAAGAGGCAGG - Intergenic
1058622064 9:106893732-106893754 CACTGCACAACAATATAGTGAGG - Intronic
1058760402 9:108125491-108125513 CACTGCAAAGCACAGCAGCCTGG - Intergenic
1059651616 9:116320764-116320786 CACAACACAACACAACACACAGG - Intronic
1060225767 9:121789788-121789810 CACTGCACCACACTCCAGCCTGG + Intergenic
1060607048 9:124924591-124924613 CACTGCACTACACTCCAGCCTGG + Intronic
1061611831 9:131751878-131751900 CACTGCACTCCACTCCAGTCTGG - Intergenic
1203794141 EBV:167375-167397 CTCTGCACAACACAACTACCAGG - Intergenic
1203519060 Un_GL000213v1:29619-29641 CACAGCACAGCACCACAGCCTGG - Intergenic
1186423337 X:9443934-9443956 CACTGCACGACAGAGCAGCCTGG + Intergenic
1191986652 X:66988233-66988255 CCCTGCACAAAACACCTGTCTGG + Intergenic
1192910046 X:75593674-75593696 CACTACACAACACAGCAGTGGGG - Intergenic
1193613977 X:83666402-83666424 CACTGCACTACAAAACACTTTGG - Intergenic
1197790526 X:130249377-130249399 CACTGCCCTACAAAACAGTTTGG + Intronic
1197803431 X:130376021-130376043 CACTTCACAAAACAAAATTCTGG + Intergenic
1198668795 X:139054857-139054879 CACAACACAACACAACACTTAGG - Intronic
1199935298 X:152567603-152567625 CACTGCAGGACAAAACAGGCTGG + Intergenic