ID: 1144547957

View in Genome Browser
Species Human (GRCh38)
Location 17:16215309-16215331
Sequence CCGGACTAGCAGGAGCCCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 75}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144547947_1144547957 -3 Left 1144547947 17:16215289-16215311 CCGGGAGCCCTCGGAAGCCCCCG 0: 1
1: 0
2: 1
3: 13
4: 252
Right 1144547957 17:16215309-16215331 CCGGACTAGCAGGAGCCCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 75
1144547949_1144547957 -10 Left 1144547949 17:16215296-16215318 CCCTCGGAAGCCCCCGGACTAGC 0: 1
1: 0
2: 0
3: 3
4: 46
Right 1144547957 17:16215309-16215331 CCGGACTAGCAGGAGCCCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 75
1144547946_1144547957 -2 Left 1144547946 17:16215288-16215310 CCCGGGAGCCCTCGGAAGCCCCC 0: 1
1: 0
2: 1
3: 31
4: 296
Right 1144547957 17:16215309-16215331 CCGGACTAGCAGGAGCCCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 75
1144547945_1144547957 -1 Left 1144547945 17:16215287-16215309 CCCCGGGAGCCCTCGGAAGCCCC 0: 1
1: 0
2: 1
3: 18
4: 179
Right 1144547957 17:16215309-16215331 CCGGACTAGCAGGAGCCCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 75
1144547943_1144547957 12 Left 1144547943 17:16215274-16215296 CCAGCGGCTGCTGCCCCGGGAGC 0: 1
1: 0
2: 8
3: 39
4: 406
Right 1144547957 17:16215309-16215331 CCGGACTAGCAGGAGCCCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 75
1144547936_1144547957 30 Left 1144547936 17:16215256-16215278 CCCGGCGGAGAAACCGTCCCAGC 0: 1
1: 0
2: 1
3: 4
4: 67
Right 1144547957 17:16215309-16215331 CCGGACTAGCAGGAGCCCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 75
1144547937_1144547957 29 Left 1144547937 17:16215257-16215279 CCGGCGGAGAAACCGTCCCAGCG 0: 1
1: 0
2: 0
3: 8
4: 46
Right 1144547957 17:16215309-16215331 CCGGACTAGCAGGAGCCCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 75
1144547939_1144547957 17 Left 1144547939 17:16215269-16215291 CCGTCCCAGCGGCTGCTGCCCCG 0: 1
1: 0
2: 1
3: 40
4: 602
Right 1144547957 17:16215309-16215331 CCGGACTAGCAGGAGCCCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 75
1144547942_1144547957 13 Left 1144547942 17:16215273-16215295 CCCAGCGGCTGCTGCCCCGGGAG 0: 1
1: 0
2: 3
3: 16
4: 259
Right 1144547957 17:16215309-16215331 CCGGACTAGCAGGAGCCCGGAGG 0: 1
1: 0
2: 0
3: 4
4: 75

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144547957 Original CRISPR CCGGACTAGCAGGAGCCCGG AGG Intronic
900936279 1:5768221-5768243 CTGGAGCTGCAGGAGCCCGGAGG - Intergenic
901228213 1:7626869-7626891 CCTGACTTGCAGGACCCTGGAGG + Intronic
901652315 1:10750068-10750090 ACGAACTGGCAGGGGCCCGGGGG + Intronic
901839391 1:11944588-11944610 CCGTCCTGGCAGGAGCTCGGGGG + Intronic
903808707 1:26022693-26022715 CAGGACAAGCAGGAGCCAGGAGG - Exonic
913996333 1:143654153-143654175 CCAGACTAGGGGAAGCCCGGAGG - Intergenic
913996443 1:143654661-143654683 TGGGACCAGCAGGAGCCTGGAGG - Intergenic
921029803 1:211327074-211327096 CCGGGCTTGCGGGAGACCGGCGG + Intronic
1065727127 10:28677406-28677428 GCGGATTGACAGGAGCCCGGCGG + Exonic
1070305381 10:75236008-75236030 CCCGACAAGGTGGAGCCCGGCGG - Exonic
1071617982 10:87094249-87094271 CCGCACCGGCAGGAGGCCGGAGG + Intronic
1072782684 10:98261154-98261176 CTGGAGGAGCAGGAGCCCCGAGG - Intronic
1078891379 11:15561210-15561232 CAGGCCGCGCAGGAGCCCGGCGG - Intergenic
1080676640 11:34433992-34434014 CAGGCCTTGCAGGAGCCCAGAGG + Intergenic
1084101295 11:66951355-66951377 CTGGACTAGCAGGGGACCGGCGG + Intronic
1084400502 11:68940271-68940293 CCAGACTCACAGGAGCCCCGTGG - Exonic
1089609349 11:119660841-119660863 CCAGAGGAGCAGGAGCCCTGAGG - Intronic
1091358776 11:134958118-134958140 CCTGACCAGCAGGAGACCTGTGG + Intergenic
1095990929 12:48034139-48034161 CCAGTCTAGCAGGAGCCATGGGG - Intergenic
1101881429 12:108628677-108628699 CCGGACTTGCAGCAGGCCGGAGG + Intronic
1104966948 12:132512630-132512652 CTGTACTCACAGGAGCCCGGGGG - Intronic
1105726194 13:23164773-23164795 CAGGGCTGGCAGGAGGCCGGAGG - Intergenic
1113925248 13:113938365-113938387 CAGGGCTGGCAGGAGCCTGGTGG + Intergenic
1121104682 14:91272665-91272687 CCGGCCTCCCCGGAGCCCGGCGG - Exonic
1125317094 15:38442624-38442646 CAGGACTGGCAGGAACCTGGAGG - Intergenic
1130147201 15:81283060-81283082 CAGGGCTAGCAGGAGCGGGGTGG + Intronic
1137665391 16:50246340-50246362 CCGGCCTCGCGGGTGCCCGGCGG + Intronic
1142162763 16:88567492-88567514 CCGGACTAGAAGGAACCCCAAGG - Intergenic
1142308944 16:89300938-89300960 CAGGACAAGCAGGACCCCGGCGG + Intronic
1142941977 17:3387168-3387190 TGTGACTAGCAGGAACCCGGTGG + Intergenic
1144547957 17:16215309-16215331 CCGGACTAGCAGGAGCCCGGAGG + Intronic
1145922053 17:28616965-28616987 CCAGACTGGCAGGAGCTCTGGGG + Exonic
1145969655 17:28949680-28949702 CCGGCCGGGCAGGAGCCCCGAGG + Intronic
1146787443 17:35731990-35732012 CGGGACTAGGAGGGGGCCGGCGG + Intronic
1146917366 17:36686830-36686852 CCGGTGGAGCAGGAGCCCTGTGG - Intergenic
1148002858 17:44400131-44400153 CTGAACAAGCAGGAGCCTGGGGG - Exonic
1150482959 17:65524611-65524633 CCACACTAGCAAGAGCCTGGGGG + Intergenic
1151599034 17:75094995-75095017 CCGGCCTCGGAGGGGCCCGGTGG + Intronic
1152210648 17:79001378-79001400 CCAGAAGAGCAGGTGCCCGGCGG - Intronic
1152259150 17:79257405-79257427 TCTGACTAGCAGGTGCCCTGAGG + Intronic
1152783691 17:82237408-82237430 CAGGTCTAGCAGGCGCCGGGAGG - Exonic
1160708917 19:541852-541874 CCGGACTGGCCGCACCCCGGAGG + Exonic
1161224406 19:3136393-3136415 CCTGGCCAGCAGGGGCCCGGGGG + Exonic
1162315545 19:9936289-9936311 CCGGACAGGTAGGGGCCCGGCGG - Exonic
1162780985 19:13006966-13006988 CGGGACAAGCAGGGGCCTGGAGG - Intronic
1162932221 19:13962909-13962931 CGGGAGGAGGAGGAGCCCGGGGG - Intronic
1164477040 19:28583717-28583739 CAGGCCTGGCAGGAGCCAGGAGG + Intergenic
1168099477 19:54133681-54133703 CAGGACAAGCAGCAGCCTGGTGG + Intergenic
932779031 2:74548812-74548834 CAGGACTTCCAGGAGCCCCGAGG + Intronic
948517975 2:238517964-238517986 CCGGACTAAAAGGAGCCGCGGGG - Intergenic
948616026 2:239199621-239199643 CTTGACGAGCAGGAGCCCCGTGG + Intronic
1175964241 20:62652458-62652480 CCGGAGGAGCAAGAGCCCCGGGG - Intronic
1183279297 22:36923524-36923546 CCGGCCTCGCAGGTGCCTGGCGG - Intronic
951481511 3:23166914-23166936 CAGGACTAGCAGGAGGTCAGAGG - Intergenic
951522105 3:23619984-23620006 CCGGACCAGCAGGGGCCTTGTGG - Intergenic
954611859 3:51948494-51948516 CCAGCCTTGCAGGACCCCGGGGG - Exonic
962479370 3:135785518-135785540 CTGGACTAGCAGGAGAGCAGGGG - Intergenic
967218117 3:187227322-187227344 GCTGACTATCAGGAGCCCTGGGG - Intronic
986059560 5:4175182-4175204 CTGGACTAGCAAGATTCCGGTGG + Intergenic
986732464 5:10645372-10645394 CAGGACTAGCAGGAGGTGGGTGG - Intronic
988844127 5:35112422-35112444 AAGGACTAGCAGAAGCCCCGGGG - Intronic
1004272904 6:14211176-14211198 CCGGCCGAGCGGGAGCCCGCGGG - Intergenic
1006750212 6:36372305-36372327 CTGGAGCAGCAGGAGCACGGGGG + Intronic
1008308345 6:49933762-49933784 CCGCACTAGCAGGGGCCGGCTGG + Intergenic
1012145059 6:95670331-95670353 CCGGCCGAGCAGGAGCCCATGGG - Intergenic
1015922062 6:138276226-138276248 CCTGACTATCTGGAGCCTGGTGG - Intronic
1016999763 6:149988616-149988638 CATGACTAGGAGGAGCCCTGTGG + Intergenic
1026498997 7:70926804-70926826 CCTGACTAGCAAAAGCCCTGGGG + Intergenic
1032292003 7:130597141-130597163 ATGGACTAGCAGGAGTCTGGGGG - Intronic
1034570856 7:151955247-151955269 CGGGATTAGCAGGAGATCGGTGG + Intergenic
1035285990 7:157807528-157807550 TGGGACAAGCAGGAGCCCAGTGG + Intronic
1038494207 8:27990180-27990202 CTGGTCCAGCAGGAGCCCAGGGG + Intronic
1041085321 8:54251333-54251355 CCTGGCTAGGAGGAGCCTGGGGG - Intergenic
1049689820 8:143953546-143953568 CCGAACCAGGTGGAGCCCGGAGG + Intronic
1049936411 9:504910-504932 CCGCACGAGCGGGAGCCCGCGGG - Intronic
1050308267 9:4327860-4327882 CCGGTGTAGCAGAAGCCCAGTGG + Intronic
1058176005 9:101737639-101737661 CCGGGCTTACGGGAGCCCGGCGG + Exonic
1062529175 9:136992417-136992439 CCGGGCGAGCGGGAACCCGGCGG - Exonic
1185468624 X:369775-369797 CCGGAGCAGCAGGGGGCCGGCGG + Intronic
1198311954 X:135433116-135433138 CTGGAGATGCAGGAGCCCGGGGG + Intergenic