ID: 1144552298

View in Genome Browser
Species Human (GRCh38)
Location 17:16251588-16251610
Sequence ATCTAGTTCTCAAGAAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 252}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144552291_1144552298 10 Left 1144552291 17:16251555-16251577 CCCTCAACTAATCAGTTAAAGAG 0: 1
1: 0
2: 1
3: 15
4: 150
Right 1144552298 17:16251588-16251610 ATCTAGTTCTCAAGAAAAGAAGG 0: 1
1: 0
2: 1
3: 20
4: 252
1144552289_1144552298 21 Left 1144552289 17:16251544-16251566 CCCAAGTAAATCCCTCAACTAAT 0: 1
1: 0
2: 0
3: 14
4: 141
Right 1144552298 17:16251588-16251610 ATCTAGTTCTCAAGAAAAGAAGG 0: 1
1: 0
2: 1
3: 20
4: 252
1144552290_1144552298 20 Left 1144552290 17:16251545-16251567 CCAAGTAAATCCCTCAACTAATC 0: 1
1: 0
2: 0
3: 9
4: 92
Right 1144552298 17:16251588-16251610 ATCTAGTTCTCAAGAAAAGAAGG 0: 1
1: 0
2: 1
3: 20
4: 252
1144552292_1144552298 9 Left 1144552292 17:16251556-16251578 CCTCAACTAATCAGTTAAAGAGG 0: 1
1: 0
2: 1
3: 11
4: 178
Right 1144552298 17:16251588-16251610 ATCTAGTTCTCAAGAAAAGAAGG 0: 1
1: 0
2: 1
3: 20
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144552298 Original CRISPR ATCTAGTTCTCAAGAAAAGA AGG Intronic
901122829 1:6909109-6909131 TTCTACTCCTCAAGAAAACAAGG + Intronic
901915654 1:12497494-12497516 ATCTAGGACTCAAGCACAGAGGG + Exonic
904656885 1:32055483-32055505 ATGTGGGTCTCAAGAGAAGAGGG - Intronic
904921979 1:34015042-34015064 GCATATTTCTCAAGAAAAGAAGG + Intronic
909367111 1:74838719-74838741 ATCTATTCCTAAAGCAAAGAAGG - Intergenic
911354488 1:96799212-96799234 ATCATGTGCTAAAGAAAAGAAGG - Intronic
911612881 1:99976383-99976405 ATCTTGTTCTCAAGGGAAGGTGG + Intronic
916290566 1:163161735-163161757 ATCCAGTTCACAAGAAAAGGAGG - Intronic
918006175 1:180544001-180544023 ATATATTCCTAAAGAAAAGAGGG - Intergenic
918135237 1:181667516-181667538 ATCTGTGTCTTAAGAAAAGAGGG + Intronic
918797184 1:188915688-188915710 ATATAATTCTAAAGAAAAGTTGG + Intergenic
921426868 1:215012845-215012867 ATCTTTTTCTCCATAAAAGATGG - Intronic
922558414 1:226549785-226549807 CTCTACTTCTCAGGAACAGAAGG - Intronic
924662189 1:246031262-246031284 AACTAGTTGTCAAGCAAAGAAGG + Intronic
1064096055 10:12425227-12425249 ATCTAGTGCTGAAGAGAAAACGG - Intronic
1064958124 10:20933840-20933862 TTCTAGTTCTCAAGTGAGGACGG + Intronic
1065137971 10:22691332-22691354 GTATAGGTCTGAAGAAAAGAGGG - Intronic
1065580579 10:27166927-27166949 ATCTAGTCCACAAGAACAGCTGG - Intronic
1066240577 10:33530628-33530650 ATCTAGTCCTACAGAAGAGAGGG + Intergenic
1067671236 10:48323730-48323752 ATCATTTTCTCAAGAGAAGAAGG - Intronic
1073085987 10:100889321-100889343 ATCTACTTTTCTAGAAATGATGG - Intergenic
1073727191 10:106247130-106247152 ATTTAATTCTAAAGAAAGGAAGG + Intergenic
1074576648 10:114676136-114676158 GACGACTTCTCAAGAAAAGAAGG + Intronic
1077586563 11:3458380-3458402 TTCAAGTTCTGATGAAAAGATGG - Intergenic
1078275616 11:9842506-9842528 ACCTAGATCTCATGAGAAGATGG - Intronic
1079515943 11:21268739-21268761 GTCTGGTTATCAAGAAAAAATGG + Intronic
1082213934 11:49543825-49543847 ATGTAGTTATTAGGAAAAGAAGG + Intergenic
1084242563 11:67832411-67832433 TTCAAGTTCTGATGAAAAGATGG - Intergenic
1085060598 11:73442726-73442748 ATATAATTCTCAAGAATACATGG - Intronic
1086635668 11:89080664-89080686 ATGTAGTTATTAGGAAAAGAAGG - Intergenic
1087395993 11:97599540-97599562 ATCTAGTCCTGAAGAATAGAAGG - Intergenic
1087671500 11:101112413-101112435 ATCTAGTGGTCAAGGAGAGAGGG + Intronic
1087676583 11:101169471-101169493 ATCTACTCCTGAAGAAAGGAAGG + Intergenic
1088878743 11:113957397-113957419 GTCTTGTTCTCCAGAAAAGAGGG - Intergenic
1090609910 11:128461833-128461855 CTCTAGTTTTGAAGCAAAGATGG - Exonic
1092412791 12:8267114-8267136 TTCAAGTTCTGATGAAAAGATGG - Intergenic
1093702157 12:22233646-22233668 AACTACTTCTCAAAAAAAAAAGG + Intronic
1093814272 12:23525350-23525372 ATCTATTTACCAAAAAAAGATGG + Intergenic
1093853232 12:24066897-24066919 AGTTAGTTCTCTCGAAAAGATGG - Intergenic
1096740047 12:53686542-53686564 ATATATTTGTCAAGATAAGAGGG - Intergenic
1098784300 12:74730568-74730590 ATCTAGTTCTGAAGAATAGGAGG - Intergenic
1099142594 12:78997430-78997452 ATCTAGCTGTCAAGAATATAAGG - Intronic
1099382491 12:81971963-81971985 ATCTAGATCTCTAGAAAGGCTGG - Intergenic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1104448082 12:128848892-128848914 ACCCTGTTCTCAAGAAAAAAAGG + Intergenic
1106069502 13:26394787-26394809 CTCTAGTACTCAAGAACTGATGG - Intronic
1106835601 13:33631311-33631333 ATCCAGTTCTCAAAATAAGCAGG + Intergenic
1108213204 13:48158862-48158884 AGATAGTTATCAAGAACAGAGGG - Intergenic
1109068153 13:57727543-57727565 ATATAGTTCTCAAGAGAATAAGG - Exonic
1109241663 13:59897441-59897463 ATATAGTTCTTAAGGAAAGTGGG + Intronic
1109323164 13:60834604-60834626 TTCTATTACTCAAGAAAAAAAGG - Intergenic
1109956184 13:69569546-69569568 ATCTAGGTATCAAGAAAACAGGG + Intergenic
1109963793 13:69666130-69666152 AACTAGGTGTCAAGAAGAGATGG + Intergenic
1110346178 13:74450348-74450370 ATCCAGTTCTCATCAACAGAAGG - Intergenic
1111253501 13:85637808-85637830 ATCTAAGTATCAAGAAAACATGG + Intergenic
1112910919 13:104483256-104483278 AACTAGTTCTGAAAAAAAAATGG + Intergenic
1113302574 13:109038145-109038167 AGTTAATTCTGAAGAAAAGAGGG - Intronic
1113514312 13:110880540-110880562 CTCTAGTTCTCAAGCGAAAATGG + Intronic
1114903401 14:27095769-27095791 ATACAGTTCTCAAGAAAATCTGG - Intergenic
1115306730 14:31941298-31941320 ACCTAATAATCAAGAAAAGAGGG - Intergenic
1117157992 14:52959680-52959702 ACCTAGGTCTAAAAAAAAGATGG + Intergenic
1117359277 14:54957303-54957325 ATTTAGTTCTAAAGATGAGATGG - Intronic
1117796102 14:59395869-59395891 ATCTTGTTCTCAAGAGAAAAAGG - Intergenic
1118503193 14:66382754-66382776 TTCTACTTCTCAAGAAAATGCGG - Intergenic
1118603165 14:67484395-67484417 CTATATTTCTCAAGAAAGGAGGG - Intronic
1120782636 14:88499368-88499390 AACTAGTTCTCAAGAAGAAATGG + Intronic
1121625185 14:95379454-95379476 AACCAGTTTTCAAGAATAGAGGG - Intergenic
1123387276 15:19826138-19826160 GTCTAGTTCTTAAGTGAAGATGG + Intergenic
1123697833 15:22891794-22891816 ATCTCGCTCTGAAGAACAGAGGG + Intronic
1126523567 15:49623708-49623730 ATCTGAGGCTCAAGAAAAGAGGG + Exonic
1127814747 15:62598074-62598096 ATCAAGTCCTCAATAAATGATGG - Intronic
1128184228 15:65630610-65630632 CTCTAATTGTCAGGAAAAGATGG + Intronic
1128616203 15:69111980-69112002 CTCTGGTTCTTAAGAAAGGATGG - Intergenic
1129278628 15:74465345-74465367 TACTAGTTCTCAAGAACATAAGG + Intergenic
1130845363 15:87739094-87739116 ATCGAGATCTCAAGAAATAATGG + Intergenic
1131530654 15:93188844-93188866 ATCTAGTGTTCAAGAATAGAGGG + Intergenic
1133353994 16:5122612-5122634 TTCAAGTTCTGATGAAAAGATGG - Intergenic
1135302581 16:21343841-21343863 ATCAAGTTCTTAAGAGCAGAGGG + Intergenic
1135510263 16:23076746-23076768 CACTATTTCTCAAGAAAATATGG - Intronic
1136299341 16:29323057-29323079 ATCAAGTTCTTAAGAGCAGAGGG + Intergenic
1137573149 16:49579609-49579631 ATCCACTTCTCAGGAAAAGCTGG + Intronic
1137861657 16:51852840-51852862 ATCCAGTTATCAAGAATAAATGG + Intergenic
1138181415 16:54942762-54942784 CTCTATTTCTCTAGTAAAGATGG + Intergenic
1138849731 16:60612923-60612945 ATCTAGATGGAAAGAAAAGAGGG + Intergenic
1140776817 16:78256395-78256417 GTCAAGTTCTCAAGAGAAGCTGG - Intronic
1141237633 16:82233500-82233522 ACCTAGTTCTGAAGAAAGGGAGG + Intergenic
1141910320 16:87054077-87054099 CTCTAGTTCTCAAGTCAAAAAGG + Intergenic
1144552298 17:16251588-16251610 ATCTAGTTCTCAAGAAAAGAAGG + Intronic
1148138845 17:45313854-45313876 ACCTAGATATCAAGAAAAGGGGG + Intronic
1149305172 17:55340365-55340387 GCCTGGTTCTCCAGAAAAGACGG - Intergenic
1149338405 17:55661529-55661551 ATCTGGTTCTCATGTACAGATGG + Intergenic
1149385843 17:56142677-56142699 CCCTGGTTCTCAAGAAATGAAGG - Intronic
1151505102 17:74522330-74522352 ATCAGGTTCTCAGGCAAAGACGG + Exonic
1153091822 18:1355570-1355592 ATGTAGTAATCAAGAAAACATGG + Intergenic
1155304616 18:24466741-24466763 ATTTGGTTCTCATGAAAAAATGG + Intronic
1157270663 18:46273516-46273538 ATGGATTTTTCAAGAAAAGATGG + Intergenic
1158064046 18:53383824-53383846 ATCTGGTTCTCAGGGACAGAGGG + Intronic
1159306451 18:66649497-66649519 ATCTATTTTTTAATAAAAGAGGG + Intergenic
1159345519 18:67198321-67198343 TCCAATTTCTCAAGAAAAGAGGG - Intergenic
1164884333 19:31764728-31764750 TTTTGGTCCTCAAGAAAAGAGGG - Intergenic
926499713 2:13638591-13638613 ATCTTGTCCTCAAGTAAAGTGGG + Intergenic
926530506 2:14039116-14039138 TTCAAGTCCTGAAGAAAAGAAGG + Intergenic
928565793 2:32547275-32547297 AAATATTTATCAAGAAAAGAAGG - Intronic
929245924 2:39703510-39703532 TTCTAGATCTCGAGAAAAAAGGG - Intronic
929932869 2:46272365-46272387 ATTTATTTCTTAGGAAAAGAAGG - Intergenic
930505597 2:52279734-52279756 ATCAAGTTCTCAAGAAGACTTGG - Intergenic
930596357 2:53392995-53393017 ATTTAGCACTCAAGAAGAGAAGG - Intergenic
932450501 2:71807632-71807654 ATCTAGCTCCCAAGCAAAGAGGG + Intergenic
935408859 2:102737806-102737828 AACAAGTTCTAAAGAAAAGAGGG - Intronic
936555057 2:113488970-113488992 ATCTAGGTCTCTAGCAAAGCTGG - Intronic
936622012 2:114109691-114109713 ATCAAGTTCTCCACACAAGAAGG - Intergenic
936958392 2:118046816-118046838 TTCTACTTCTCAACAACAGATGG + Intergenic
939084160 2:137697132-137697154 ATATAGTTGTCAGGGAAAGAGGG - Intergenic
940801519 2:158137868-158137890 ATCTAGTTCTAAAGGAAGGAGGG - Intergenic
941434646 2:165454186-165454208 ATCTTGGTCTCTAGGAAAGATGG - Intergenic
943149075 2:184087353-184087375 ATATACTTTTAAAGAAAAGAAGG + Intergenic
943336647 2:186623348-186623370 ATTTAGTTCTAAAAAAAAAAGGG - Intronic
943883969 2:193187163-193187185 ATCTAATTCTCCTGAGAAGAGGG + Intergenic
944693400 2:202179053-202179075 ATCTACTTCTCAAGAGAGAAAGG + Intronic
945617123 2:212085901-212085923 ACCTAGTTCCAAAGATAAGAAGG + Intronic
946502394 2:220263433-220263455 ATCCAGTTCTTAAGAAATGTGGG + Intergenic
946841061 2:223820770-223820792 ATCTAGTTCCCGAGAAAAAGTGG - Intronic
947322144 2:228932130-228932152 AACTACTTCTCAAGGAAATATGG - Intronic
948110597 2:235452356-235452378 AGGGAGTGCTCAAGAAAAGATGG - Intergenic
1170389613 20:15857785-15857807 ACATCTTTCTCAAGAAAAGATGG - Intronic
1170605295 20:17871013-17871035 ATTTAGTTGTCAAGGAAAGATGG + Intergenic
1173088449 20:39947475-39947497 ATCTAGGCCTCAGGAAATGAAGG + Intergenic
1173701902 20:45079509-45079531 ACATAGTGCTTAAGAAAAGATGG - Exonic
1176150813 20:63589847-63589869 ATATATTTCCCAAGAAAAAAGGG + Exonic
1176347476 21:5762895-5762917 ATGTATTTATCATGAAAAGATGG + Intergenic
1176354290 21:5883479-5883501 ATGTATTTATCATGAAAAGATGG + Intergenic
1176497351 21:7561560-7561582 ATGTATTTATCATGAAAAGATGG - Intergenic
1176541797 21:8160965-8160987 ATGTATTTATCATGAAAAGATGG + Intergenic
1176560748 21:8344010-8344032 ATGTATTTATCATGAAAAGATGG + Intergenic
1179286537 21:39982633-39982655 GTCTAGTTCTCAAGGAGGGAAGG + Intergenic
1181011790 22:20045119-20045141 AACAAGTTCTCAAGTAAAGCTGG - Intronic
1181170968 22:21009823-21009845 GTCTAGTTCTCAGGTAGAGAGGG - Intronic
1183329234 22:37210559-37210581 TTCCAGCTCTAAAGAAAAGACGG - Intronic
1203246737 22_KI270733v1_random:77384-77406 ATGTATTTATCATGAAAAGATGG + Intergenic
949446456 3:4139805-4139827 TACTATTTTTCAAGAAAAGATGG - Intronic
949977901 3:9477470-9477492 ATCTTGTCCAAAAGAAAAGAAGG - Exonic
950075535 3:10184288-10184310 TTCTAGTACTCTAGAAAAGGAGG + Intronic
950160462 3:10756898-10756920 ATCAAGGTTTCAAGAAAAGCAGG - Intergenic
950311463 3:11962089-11962111 TTCTAGTTCAAAAGAACAGATGG + Intergenic
951885926 3:27524483-27524505 ACTTAGTTCTCAAACAAAGATGG + Intergenic
952321830 3:32284880-32284902 GTCTTGTTCTCAAGAAAATTGGG + Intronic
953036534 3:39216507-39216529 TTCTAATTCTCAAGAAAGTAAGG - Intergenic
954495986 3:50962462-50962484 ATCTAGTCCTCATGAAAACTGGG - Intronic
955833036 3:63025245-63025267 CCCTAGTTCTAAAAAAAAGAGGG - Intergenic
956802492 3:72773304-72773326 ATCTAGCTCCAAAGACAAGAAGG + Intronic
957023111 3:75146636-75146658 CTTTTGTACTCAAGAAAAGAAGG - Intergenic
957057895 3:75458304-75458326 TTCAAGTTCTGATGAAAAGATGG - Intergenic
957306239 3:78461819-78461841 ATCTAGATCTCCAGAAATCAAGG - Intergenic
958633902 3:96717745-96717767 ATCTTGTTTTTAAGAAAAAAGGG - Intergenic
959376689 3:105596284-105596306 ATCTAGTTGTCACTAAAAGTGGG - Intergenic
959983825 3:112550035-112550057 ATATAGTTGTCAAGATACGAAGG - Intronic
961629252 3:128284305-128284327 CTTTAGTCGTCAAGAAAAGATGG - Intronic
962881720 3:139584198-139584220 AACAAGTTCTCAAGGAAAGAAGG - Intronic
963095901 3:141539775-141539797 ATCAACTTCTCAAGAAATAAAGG - Intronic
964051641 3:152401303-152401325 TTCTACTTGGCAAGAAAAGAAGG + Intronic
964061134 3:152525231-152525253 ATATACTTCTCAAGAGAAAAAGG - Intergenic
964120490 3:153178389-153178411 GTGTAGTTCTTAAGAATAGAAGG + Intergenic
964701063 3:159567374-159567396 AAGTATTTCTCAAGAAAAAAAGG - Intronic
964735997 3:159917802-159917824 ATCAAGTTCTTAAGAAATGATGG - Intergenic
965684277 3:171285013-171285035 ACTTAGTTCTCAAGGAAAGAAGG - Intronic
967617514 3:191589674-191589696 ATCTATTTCTAGAGAAATGAGGG - Intergenic
969001762 4:3988311-3988333 TTCAAGTTCTGATGAAAAGATGG - Intergenic
969752265 4:9120349-9120371 TTCAAGTTCTGATGAAAAGATGG + Intergenic
969812152 4:9656500-9656522 TTCAAGTTCTGATGAAAAGATGG + Intergenic
970769419 4:19592631-19592653 TTCTAGGTCTCAAGAGAATATGG - Intergenic
972036533 4:34529954-34529976 ATCTAAATGTCAAGAAAAAAAGG + Intergenic
973116937 4:46473138-46473160 CTGTAGCTCTCATGAAAAGATGG + Intronic
973165656 4:47074740-47074762 ATATAGTTGTCATAAAAAGATGG + Intronic
974730176 4:65853620-65853642 ATCATCTCCTCAAGAAAAGATGG - Intergenic
975257129 4:72250584-72250606 ATCTAGATTTCAAGTGAAGAAGG - Intergenic
976504555 4:85832047-85832069 CTCAAGTTCCCAAGAAGAGAGGG + Intronic
982529192 4:156517481-156517503 ATTCATTTCTAAAGAAAAGAGGG - Intergenic
985978144 5:3438510-3438532 ATGTAGGTATCAAGAAAAGCAGG - Intergenic
987070583 5:14333771-14333793 ACCAAGTTCTCAAGAAAAAGAGG + Intronic
988463470 5:31464539-31464561 ATCTAGTTGCCAAGAAAGGCTGG - Intronic
988615506 5:32771160-32771182 ATGTTCTTCTCAAGAAAAGCCGG + Intronic
988832171 5:34998528-34998550 ATGGAGTTCTCAAGATAAGAGGG + Exonic
989158128 5:38364328-38364350 ACCTAGTTTTGAAGGAAAGAAGG + Intronic
989554717 5:42780464-42780486 CTCTAGATCTCAAAAATAGATGG + Intronic
991511493 5:67382047-67382069 AACTAGTTCTGTAGCAAAGAAGG + Intergenic
992722443 5:79574074-79574096 ATCTAGATCTCCAGAAATCAAGG + Intergenic
993152324 5:84176421-84176443 TCCTACTTTTCAAGAAAAGAGGG - Intronic
993325107 5:86524528-86524550 AGCTATTTTTTAAGAAAAGAAGG - Intergenic
994823036 5:104677990-104678012 ATCTAGATCTCTAGCAAAGCTGG - Intergenic
995390606 5:111636589-111636611 ATCTACTCCTCAAGAAAACTAGG - Intergenic
997232019 5:132252397-132252419 TTCTAGTGGTCAAGAAGAGAAGG + Intronic
998491187 5:142548220-142548242 ATTAAGCTCTCAAGAAATGATGG + Intergenic
998703510 5:144732320-144732342 ATATAGTTCACCAGAAAAGTGGG + Intergenic
998980760 5:147699475-147699497 AGCAAGACCTCAAGAAAAGAGGG + Intronic
999565360 5:152854182-152854204 ATCTAGTTCTTAGGGAAACATGG + Intergenic
1000505523 5:162112660-162112682 ATCTCCTTTTAAAGAAAAGAAGG - Intronic
1000633052 5:163612873-163612895 AGCTGGTTCTGGAGAAAAGATGG + Intergenic
1001629579 5:173164715-173164737 ATCTGGACATCAAGAAAAGAGGG - Intergenic
1003639866 6:7867597-7867619 TTCTAGTTCTCCAGGAAAGTTGG + Intronic
1004521769 6:16367622-16367644 TTCTACTTCTAAGGAAAAGAAGG - Intronic
1005420783 6:25647920-25647942 ATCAACTCCTTAAGAAAAGATGG + Intergenic
1006277041 6:33013298-33013320 AGCTAGTTCAGAACAAAAGAGGG - Intergenic
1006732400 6:36246101-36246123 ATCTACTTCTCAGAAACAGAGGG + Intronic
1008477498 6:51948231-51948253 ATATGGTTCACATGAAAAGAAGG - Intronic
1008592446 6:53008105-53008127 ATGTATTTATCAAGAAGAGAAGG + Intronic
1008962440 6:57279533-57279555 ATATAGTTCTCCAAAACAGAGGG - Intergenic
1009272696 6:61634693-61634715 ATAAAGGTCTCAAGAAAAAATGG + Intergenic
1010707622 6:79133960-79133982 ATCTAGTTCTCTAGCAAGGCTGG + Intergenic
1011320365 6:86085010-86085032 ATGTAGGTTTTAAGAAAAGAAGG - Intergenic
1011922239 6:92593726-92593748 TTCTACTTCTCAAGTATAGAAGG + Intergenic
1012317104 6:97794632-97794654 ATATGGTTCCCAAGCAAAGATGG + Intergenic
1012614079 6:101253525-101253547 ATGTAGTCCTCAGGAAAAAAAGG + Intergenic
1014492444 6:122079155-122079177 GTCTAGATCTCAAGAAAAAATGG + Intergenic
1014502061 6:122203699-122203721 TTTTACTTCTAAAGAAAAGAAGG - Intergenic
1014886406 6:126786909-126786931 TTGTAGTTCTCATGTAAAGAGGG + Intergenic
1016484938 6:144527534-144527556 ATCTAGATCTCTAGCAAAGCCGG + Intronic
1018335411 6:162782291-162782313 ACCTATTCCTCAAGAACAGATGG + Intronic
1018719123 6:166559072-166559094 ATCTAATCCTCATGAAGAGATGG - Intronic
1023430001 7:40081166-40081188 ATCTAATTCTGATAAAAAGAAGG - Intronic
1024795981 7:53020604-53020626 ATTAAGTTCTCAACAAAAAAAGG + Intergenic
1027251124 7:76399442-76399464 TTCTAGTTTTCAAGAAAATCAGG - Intronic
1028511859 7:91634080-91634102 ACCCAGTTCTCAAGATAAGCAGG + Intergenic
1029902546 7:104056931-104056953 ATCTAGGTCTAAAGGAAAGTTGG + Intergenic
1030405578 7:109108098-109108120 ATTTAGTTGTCAAGACTAGAAGG - Intergenic
1030574946 7:111273914-111273936 ATATAGTTCTTAATAAAAAATGG - Intronic
1034719946 7:153282375-153282397 ATCCAGTTCTCTTCAAAAGAGGG + Intergenic
1036375472 8:8195760-8195782 TTCAAGTTCTGATGAAAAGATGG + Intergenic
1036854060 8:12227389-12227411 TTCAAGTTCTGATGAAAAGATGG - Intergenic
1036875433 8:12469887-12469909 TTCAAGTTCTGATGAAAAGATGG - Intergenic
1040647613 8:49418294-49418316 ATCTAGTCCTCAAGCAAGAAAGG - Intergenic
1040792139 8:51244118-51244140 ATCTAGTACTCAAGTAGAGGTGG + Intergenic
1040883373 8:52232923-52232945 AACTAGTTCTCCAGTAAAGCTGG + Intronic
1041472785 8:58229948-58229970 TCCTAGTTCTCATGAACAGATGG + Intergenic
1041475369 8:58259559-58259581 ATGTAGTTGGCAATAAAAGAGGG + Intergenic
1041961919 8:63627747-63627769 TTCTAGTCCTCATGAAAAGAAGG + Intergenic
1044594491 8:93944621-93944643 GTCTAGTTTTCAACAAAAAAAGG + Intergenic
1046268601 8:111863051-111863073 ATCTCGTTCTGAAGAATAAAAGG - Intergenic
1046269557 8:111876281-111876303 CTCCAGTTCTCAGGAAGAGAAGG + Intergenic
1046653464 8:116866694-116866716 ATTTTGTTCTCAGTAAAAGAGGG - Exonic
1047915152 8:129575106-129575128 CTCAAGTGCACAAGAAAAGAAGG + Intergenic
1047929348 8:129711480-129711502 ATCTGCTTATCAAGAAAAAATGG - Intergenic
1049897946 9:128216-128238 ATCTAGGTCTCTAGCAAAGCTGG + Intronic
1049935850 9:501352-501374 TTCTCATTTTCAAGAAAAGATGG - Intronic
1050082616 9:1930838-1930860 TTCTATCTCTCATGAAAAGAAGG + Intergenic
1050616154 9:7403750-7403772 ATCTAGTCCTTGAGTAAAGATGG - Intergenic
1050880824 9:10698257-10698279 ATCTAGCTCACAGGGAAAGAGGG - Intergenic
1051114793 9:13682400-13682422 TACTAGTTCTCAAGTAATGAGGG + Intergenic
1051803991 9:20970755-20970777 GTCTAGTTTTCAAAAAAATATGG - Intronic
1052391367 9:27882118-27882140 ATGTAGTTCTCAATACCAGAGGG - Intergenic
1052591988 9:30509748-30509770 ATCTAATGCTCAAGAAAAGAAGG - Intergenic
1052745537 9:32436751-32436773 ATCTAATCCACATGAAAAGAAGG + Intronic
1053741027 9:41138509-41138531 ATCTAGGTCTCTAGCAAAGCTGG + Intronic
1054444015 9:65294652-65294674 ATCTAGGTCTCTAGCAAAGCTGG + Intergenic
1054486257 9:65726853-65726875 ATCTAGGTCTCTAGCAAAGCTGG - Intronic
1054687322 9:68292788-68292810 ATCTAGGTCTCTAGCAAAGCTGG - Intronic
1055179967 9:73374183-73374205 ATCTAATTAACAAGAACAGAAGG - Intergenic
1056109206 9:83377859-83377881 ATCTACTTTTTAAAAAAAGACGG + Intronic
1056902883 9:90616928-90616950 ATCTAGTTATCAACAAAGGCAGG + Intronic
1058738884 9:107922789-107922811 ATCTAGTTTTGAAGATGAGAAGG + Intergenic
1059027750 9:110654594-110654616 TTCTATTTTTCAAGAAAATAAGG - Intergenic
1203463071 Un_GL000220v1:60446-60468 ATGTATTTATCATGAAAAGATGG + Intergenic
1185670346 X:1804538-1804560 ATCCAGTCCACAAGAAGAGATGG - Intergenic
1186371961 X:8955885-8955907 ATCTAGTTCTCATGAGATGGAGG - Intergenic
1187674178 X:21699538-21699560 AGGTAGTCCTCAATAAAAGAAGG + Intergenic
1188712594 X:33419399-33419421 AACTTTTTCTCAAGAAAAAAAGG + Intergenic
1189141649 X:38613421-38613443 TTCTAGTTCCCAAGAAACCAAGG - Intronic
1191970782 X:66814131-66814153 ATCTAGATCTCTAGCAAAGCTGG + Intergenic
1192217266 X:69169959-69169981 ATATACTTCTAAAGAAAACATGG - Intergenic
1192888076 X:75358307-75358329 CTGTAGTCCTCAAGAAAAGGGGG - Intergenic
1193169253 X:78316611-78316633 ATATAGTTCACAAGAGAAGTGGG - Intronic
1195157350 X:102137433-102137455 GACTAGTTGCCAAGAAAAGAGGG + Intergenic
1196111758 X:111953997-111954019 ATCTAAATCCCAAGAGAAGAGGG + Intronic
1198691377 X:139288544-139288566 ATGTAGTGCTTAAGAAAAGCAGG + Intergenic
1202014974 Y:20394767-20394789 ATATATTTTTCAAGAAAAGCTGG + Intergenic