ID: 1144552759

View in Genome Browser
Species Human (GRCh38)
Location 17:16255864-16255886
Sequence GTTTCCTAGAAAAGAAACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 471
Summary {0: 1, 1: 0, 2: 1, 3: 50, 4: 419}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144552756_1144552759 2 Left 1144552756 17:16255839-16255861 CCCAAAGGGTGCAAAGGACAAGA 0: 1
1: 0
2: 5
3: 41
4: 479
Right 1144552759 17:16255864-16255886 GTTTCCTAGAAAAGAAACCAGGG 0: 1
1: 0
2: 1
3: 50
4: 419
1144552757_1144552759 1 Left 1144552757 17:16255840-16255862 CCAAAGGGTGCAAAGGACAAGAA 0: 1
1: 0
2: 3
3: 22
4: 346
Right 1144552759 17:16255864-16255886 GTTTCCTAGAAAAGAAACCAGGG 0: 1
1: 0
2: 1
3: 50
4: 419

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144552759 Original CRISPR GTTTCCTAGAAAAGAAACCA GGG Intronic
900305963 1:2008221-2008243 TTTCCCTTGAAAAGAAACCATGG + Intergenic
900814054 1:4829702-4829724 GTTTCCTAGCAAGTAAAACAAGG + Intergenic
901354205 1:8629207-8629229 GATGTCTAGAAATGAAACCATGG + Intronic
901776647 1:11564763-11564785 TTTTCCCAGGAAAGAAATCAAGG - Intergenic
902299892 1:15494212-15494234 TTTTCCCAGCAAGGAAACCAAGG + Intronic
902319999 1:15655449-15655471 GTTTCTAAAAAAAAAAACCACGG + Intronic
902426607 1:16328737-16328759 TTCTCCAATAAAAGAAACCAGGG + Intronic
903394428 1:22988763-22988785 GTTTCCTAGAAATGAATCTCAGG - Intergenic
904885062 1:33730955-33730977 GTTTCCACTAAAAGGAACCAGGG + Intronic
906854600 1:49291278-49291300 GTTTCTGAGAATAGAAAACAAGG + Intronic
907345040 1:53770137-53770159 TTTTCAGAGAAAAGAAACTAAGG + Intronic
907345046 1:53770239-53770261 TTTTCAGAGAAAAGAAACTAAGG + Intronic
907761264 1:57363245-57363267 CTTTCATAGGACAGAAACCACGG + Intronic
907960620 1:59277073-59277095 GTTTCCTGGAGAAGAAAATATGG + Intergenic
908984687 1:70003182-70003204 CTTTACAAGAAGAGAAACCAGGG - Intronic
909409138 1:75328869-75328891 CTTTCCTTAAAAGGAAACCAGGG - Intronic
910679159 1:89844338-89844360 CTTTCCCAAAACAGAAACCAAGG - Intronic
912511601 1:110193708-110193730 GTTACCTGGGGAAGAAACCAGGG - Intronic
912947245 1:114095577-114095599 GTTTCCTAGAAAAGCAAAGATGG + Intronic
914257566 1:145973125-145973147 TTTTCCAATAAAAGGAACCAGGG - Intronic
914875082 1:151507502-151507524 GAAGCCTAGAAAAGAAATCAGGG - Intergenic
917841245 1:178980822-178980844 GTTTCCCAGCAAAAAAACCCAGG + Intergenic
920357396 1:205384423-205384445 TTTTTCTAGAATAAAAACCAAGG - Intronic
920593609 1:207247005-207247027 GTTTATTAGAAAGGAAACAAAGG - Intergenic
920718607 1:208365812-208365834 GTCTCCTAGAGAATCAACCATGG + Intergenic
922409565 1:225358478-225358500 TTTACCTAAAAAAGAAAACATGG - Intronic
922534043 1:226366773-226366795 TTGTCCTAGGAAAGAAGCCAAGG + Intronic
922856321 1:228777914-228777936 GTTTCCAAGAAAAAAAAAAAAGG + Intergenic
923019757 1:230154284-230154306 TCTTACTAGAAAAGAAACCCCGG + Intronic
924221053 1:241875434-241875456 GTTTCCTTGAGAAGACTCCATGG - Intronic
924316601 1:242804035-242804057 GTCTCTTAGAAGAGAAACCAAGG + Intergenic
1063265283 10:4441339-4441361 TTTTCCTATACAAGAAACCAAGG - Intergenic
1064252435 10:13717132-13717154 CTTTCCTTGAAAAAAAGCCAAGG + Intronic
1066016336 10:31247962-31247984 ATTTTTTAAAAAAGAAACCAGGG - Intergenic
1066118811 10:32263772-32263794 GTTACCCAGAAAAAAAAGCAGGG - Intergenic
1066461465 10:35616079-35616101 GTTTCATAGATAAGAAATAAAGG - Intergenic
1066541105 10:36447630-36447652 TTTTCTTAGAAAAGAAATCTTGG - Intergenic
1067943325 10:50674853-50674875 GTTACCTAAAAATAAAACCAAGG - Intergenic
1068098587 10:52522693-52522715 AGTTCCTGGATAAGAAACCAAGG - Intergenic
1068205311 10:53842548-53842570 GTTTCCTTAAATAGAAAACAAGG + Intronic
1068563770 10:58547930-58547952 GTCTCCAATAAAAGAAACCAGGG - Intronic
1069112703 10:64466759-64466781 GTTTGCTAGAACAGAAACAGTGG + Intergenic
1070236328 10:74631161-74631183 GTGTACAATAAAAGAAACCAGGG - Intronic
1071341491 10:84653055-84653077 GTTACAAAGAAAAGAAAACACGG - Intergenic
1071358651 10:84822852-84822874 GTCACTTAGGAAAGAAACCAGGG - Intergenic
1071466546 10:85945799-85945821 GCTTACTAGAAAACAAACCTTGG - Intronic
1071796586 10:89013325-89013347 GTTTCCTAGAAAGCAAAAAATGG - Exonic
1072897390 10:99378549-99378571 GTAACCTTGAAAAGTAACCATGG + Intronic
1074218579 10:111412457-111412479 TTCTCCAATAAAAGAAACCAGGG - Intergenic
1074950095 10:118325480-118325502 TTTTCCTAGAAAGGAAAAAAAGG + Intronic
1075687401 10:124373906-124373928 GTGTCCTGGAAAAGAAAACCTGG - Intergenic
1075830129 10:125402110-125402132 GTTTCCAAGAACATACACCAAGG - Intergenic
1077489886 11:2855972-2855994 GTTTGATAGATGAGAAACCAAGG - Intergenic
1077931067 11:6733493-6733515 GTCTCATAGAGAAGAAACCATGG - Intergenic
1078155409 11:8795698-8795720 GATTTGTAGAAAAGAAACCTAGG - Intronic
1079072431 11:17359100-17359122 CTTTCCAATAAAAGGAACCAAGG - Intronic
1079395323 11:20057318-20057340 GTTACCAAGAAAATAAACCAGGG - Intronic
1080379653 11:31754957-31754979 TTTTCCAGTAAAAGAAACCAGGG + Intronic
1081108127 11:39098891-39098913 GTTTCCAGTAAAAGAAAACATGG + Intergenic
1081497384 11:43629106-43629128 GTTTCCTAGAAAATGCACCTGGG - Intronic
1081937573 11:46916136-46916158 TTTTCCTTAAAAAGAAACCTGGG + Intronic
1083179912 11:60978538-60978560 GTTTTCCAGAAAGGAAACTAGGG - Intronic
1083422880 11:62565381-62565403 GTTTCCAAAAAAAAAAACCTTGG + Intronic
1084117562 11:67050843-67050865 GATTCCTAGAGAAGAGACGAAGG - Exonic
1085261467 11:75207739-75207761 GTCTACAAGAAAAGAAACCTAGG - Intergenic
1085584221 11:77686066-77686088 GTTTCTTGGAAATGAAACTATGG - Intronic
1085693828 11:78687251-78687273 TTTTCCTGGAGAAGAAACCAAGG + Intronic
1087249810 11:95885357-95885379 TTTTCCAAAAAAAGGAACCAGGG + Intronic
1087721646 11:101672406-101672428 CTTTCCTAGTAAAAGAACCATGG + Intronic
1087741368 11:101891099-101891121 GTATTCTATAAAAGAAAACATGG - Exonic
1088640926 11:111872129-111872151 GTTTCCTGGTAAATAAAACAAGG - Intergenic
1089035262 11:115382677-115382699 GTTTCCTATAAAGGAAATAAAGG - Intronic
1089236999 11:117037850-117037872 GTTTCTTGGCAAGGAAACCAGGG - Intronic
1089626305 11:119753186-119753208 TTTTCACAGAAAAGAATCCAAGG - Intergenic
1089830742 11:121325654-121325676 GTTTCCTGGAGAGGAAACTATGG + Intergenic
1090074495 11:123571526-123571548 GTTTGCTAGCAAGGTAACCAGGG + Intronic
1092812187 12:12281777-12281799 TTTTCCTTGAAAAGGAACCAGGG + Intergenic
1092884823 12:12915816-12915838 GTTTCTTAGAAGGGAAACAACGG - Exonic
1093623908 12:21324035-21324057 GTTTCCTTGGAAGTAAACCAAGG + Intronic
1093879591 12:24388581-24388603 GTTTTAAAGAAAACAAACCAAGG - Intergenic
1094663520 12:32495352-32495374 TTATCTTAGAAAAGAACCCAGGG + Intronic
1094865416 12:34525182-34525204 AGTTCCTATAAAAGAAAACAGGG + Intergenic
1095318502 12:40796405-40796427 GCTTCCTAGAAAAGCAAACTTGG + Intronic
1097438633 12:59582287-59582309 GTTTCTTAGAAAAAAAATCTGGG - Intergenic
1099065534 12:77973638-77973660 GTTTCCTGGAAAAGATACCCTGG - Intronic
1102848484 12:116214383-116214405 GTTTCTTAGAAAAGAATTCCAGG - Intronic
1103147431 12:118607732-118607754 GTTTCCTAAAGCAGAAACCAAGG + Intergenic
1104838937 12:131811225-131811247 CTGTACTAGAAAAGAAACCTGGG - Intergenic
1105947143 13:25199859-25199881 ATTTCCACTAAAAGAAACCAGGG + Intergenic
1105956833 13:25291269-25291291 TTTTCCAATAAAAGGAACCAGGG - Intergenic
1106944558 13:34812258-34812280 GTTTCCAAGAAAAGAATAAAAGG - Intergenic
1107560903 13:41556429-41556451 GTGTCATAGCTAAGAAACCATGG - Intergenic
1108069730 13:46616033-46616055 GTTTCTTAGAAATGTAAACATGG + Intronic
1108753355 13:53471640-53471662 TTTTCATAGCAAAGAAACAAAGG + Intergenic
1109036815 13:57273524-57273546 TTTGCCGATAAAAGAAACCACGG + Intergenic
1109492791 13:63125891-63125913 GTTTCTTACATAAGATACCATGG + Intergenic
1109814858 13:67567936-67567958 TTCTCCAAAAAAAGAAACCAGGG - Intergenic
1111655916 13:91152951-91152973 CATTCCTAGAAAACAGACCAAGG + Intergenic
1112284691 13:98093896-98093918 GTGTTTTAGAAAAGAAACAAGGG - Intergenic
1112561422 13:100518089-100518111 TTTTCCTTGAAAATACACCAAGG - Intronic
1113092397 13:106629574-106629596 GATTCCAGGAAAAGAAACTAGGG + Intergenic
1113126940 13:106989783-106989805 GTTACCTAGAAACAAAACCATGG - Intergenic
1113130505 13:107031469-107031491 ATTTCCTAGAACAGATAGCAGGG + Intergenic
1113859544 13:113472374-113472396 GTTTCCGCTAAAAGAAATCAGGG + Intronic
1114221237 14:20699337-20699359 GGTGCCTAGAAAAGAAAGCAAGG - Exonic
1114325017 14:21580184-21580206 GTCTCCTAGGAAACAAACTATGG - Intergenic
1114521741 14:23343517-23343539 GTTTCCTAGGAAATAAAACAAGG - Intergenic
1115253800 14:31377153-31377175 ATTTCCTACAAAAGGAATCAAGG + Intronic
1116936942 14:50750220-50750242 TTCTCCTATAAAAGGAACCAGGG - Intronic
1117570445 14:57043693-57043715 TTTTCCTAAAAATGAAACCTTGG - Intergenic
1117804683 14:59479620-59479642 GTTTCCTAGAAAAGATCCTCAGG - Intronic
1118669655 14:68109981-68110003 GTTTCCAAGCAATAAAACCAGGG - Intronic
1119042522 14:71287850-71287872 CTTTCCTAAAAAAGAAAGAAAGG + Intergenic
1119575571 14:75718338-75718360 AGTTCCTAGAAATGGAACCATGG - Intronic
1120471080 14:84925325-84925347 GTTCCCAAGATAGGAAACCAAGG - Intergenic
1202895828 14_GL000194v1_random:9455-9477 ATTTCCAAGAGAAGAAACCCAGG + Intergenic
1124628510 15:31324563-31324585 CTTACTTAGAAAAGAAAACATGG + Intergenic
1125683658 15:41549253-41549275 TGATCCTAGAAAAGAAACAATGG - Intergenic
1126788091 15:52195601-52195623 ATTTCCAAGAAAAGAAAACAAGG + Intronic
1126955186 15:53925945-53925967 GTTCCCTTGAAGAGCAACCACGG + Intergenic
1128620285 15:69143317-69143339 GTCTCCTAGAAACCAACCCAAGG + Intergenic
1129102352 15:73277767-73277789 TTCTCCTAGAAAAGCAACCAAGG - Intronic
1129147239 15:73659686-73659708 GTTGACTAAAAAAGAAAACAAGG - Intergenic
1129366378 15:75058066-75058088 GTTTCATAGACAAGAAACTGAGG + Intronic
1130351812 15:83099499-83099521 GTTTCCTAGCAACCAAAGCAAGG - Intergenic
1130880654 15:88052970-88052992 GTTTTCCAGATAGGAAACCAAGG - Intronic
1132220187 15:100099567-100099589 GATTCCTAGGAAAGTAACTAAGG - Intronic
1135471475 16:22735414-22735436 GCTTCCTAGGAAAAAAACTAGGG - Intergenic
1137477174 16:48818829-48818851 GTTTCCTACAAAGGAAAAGATGG - Intergenic
1137833312 16:51565689-51565711 TTCTCCAATAAAAGAAACCAAGG + Intergenic
1138802128 16:60046241-60046263 ATTTCTTAGAAAAGAAGACAAGG + Intergenic
1139891189 16:70254134-70254156 GTGTCCTGGAAAGGAAAGCAAGG + Intronic
1140029329 16:71322391-71322413 TTTTCCAATAAAAGGAACCAGGG + Intergenic
1140157479 16:72446943-72446965 GTTTTCTGGAAAAGAAATTAAGG - Intergenic
1140594916 16:76397211-76397233 GTTTCCAAGCAGAGAATCCATGG + Intronic
1140930247 16:79620810-79620832 TTTTCCTATAAATGAAAACAGGG + Intergenic
1143313259 17:6011125-6011147 TTCTCCAATAAAAGAAACCAGGG - Intronic
1144552759 17:16255864-16255886 GTTTCCTAGAAAAGAAACCAGGG + Intronic
1144726563 17:17505348-17505370 GTCTCCTGGAGATGAAACCATGG + Intergenic
1144726901 17:17506725-17506747 GTTTTCTAGAAATGAGTCCAGGG + Intronic
1145290289 17:21539229-21539251 TTCTCCTATAAAAGAAACCAAGG + Intronic
1145372558 17:22319163-22319185 CTTTTCAATAAAAGAAACCAAGG - Intergenic
1147891683 17:43721806-43721828 GTGTCCAAGAGAAGAAACCTAGG + Intergenic
1148034028 17:44644531-44644553 GTCTCTTAGAAAAGAAAGCCGGG + Intergenic
1149227209 17:54487137-54487159 GGTTCCTTGAGAAGTAACCATGG + Intergenic
1149249967 17:54756980-54757002 GTTTCCTAAAATATAAACCAAGG + Intergenic
1150272049 17:63873013-63873035 GGTTCCCAGAAAAGCAACAATGG - Intronic
1150273412 17:63881194-63881216 GGTTCCCAGAAAAGTAACAATGG - Intronic
1150275596 17:63895909-63895931 GGTTCCCAGAAAAGCAACAATGG - Intronic
1150279018 17:63918182-63918204 GGTTCCCAGAAAAGTAACAATGG - Intronic
1152267206 17:79302268-79302290 ATTTCATGGATAAGAAACCAAGG + Intronic
1152897607 17:82922094-82922116 ATTGCATAGATAAGAAACCATGG + Intronic
1153207514 18:2719142-2719164 AATTCCTAGAAAATAAAACAGGG - Intronic
1153248697 18:3098625-3098647 CATTCCTGGAAAAGAAACCAAGG + Intronic
1153720916 18:7901688-7901710 GTTTGTTAGAAAAAAAACAAAGG + Intronic
1153750545 18:8225508-8225530 TTTTCCAGTAAAAGAAACCAGGG - Intronic
1153975239 18:10263254-10263276 TTTTCCAAGAAAAGAACACAGGG + Intergenic
1154222359 18:12467491-12467513 GTCTCTTAGAAAAGGAACAAAGG + Intronic
1154388257 18:13914752-13914774 GTTACCTAGAAAAGAGGCCCAGG - Intronic
1155600237 18:27537555-27537577 TTTTCCAATAAAAGGAACCAAGG + Intergenic
1155644394 18:28060035-28060057 GTTTGCCAAAAAAAAAACCAGGG - Intronic
1156274519 18:35570603-35570625 GTCTCCAATAAAAGAAAACAAGG - Intergenic
1156501574 18:37563222-37563244 GGATTGTAGAAAAGAAACCAAGG + Intronic
1157560134 18:48639866-48639888 GTTTCCTGGGAAGGAAACCCAGG - Intronic
1157593317 18:48848940-48848962 GTTTCTTGGACAAGAATCCAAGG - Intronic
1158296450 18:56002262-56002284 GTTTCCTAAACAACAAACCCAGG + Intergenic
1159461844 18:68731478-68731500 TTTTCCATGAAAAGAAGCCAGGG - Intronic
1159711695 18:71767390-71767412 GTTTCCCAGAAATAAAACCTGGG + Intronic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
1161260730 19:3336602-3336624 ATTTCCCAGAAGAGAAACCAAGG + Intergenic
1161529889 19:4781998-4782020 GTTTCTTAGAAACTAAACCATGG + Intergenic
1161548340 19:4896005-4896027 TTTTTTTAGAAAAGAAACAAGGG - Intronic
1161729566 19:5951120-5951142 GTTTCCCAAAAAAGACACGAGGG - Intronic
1163303989 19:16465858-16465880 CTTTCCAAGACAAGAAACTATGG + Intronic
1163673151 19:18640837-18640859 GTTTCCTAAAAATTAAAACATGG - Intronic
1163720547 19:18896295-18896317 GTTTCCCAGCAGAGAAACCCAGG + Intronic
1163868465 19:19796312-19796334 GTTTTTTAAAAAAGAAACCAGGG - Intronic
1163874821 19:19859165-19859187 GTCTCCTAGAAATGAAAGCCAGG + Intergenic
1165240142 19:34459892-34459914 ATTTCCTAGAAAAGAAACTGGGG - Intronic
1165464331 19:35963892-35963914 GTTTCTTAGAAATGAAGACAAGG + Intergenic
1165619669 19:37234946-37234968 TTTTCAAATAAAAGAAACCAAGG - Intronic
925053544 2:835998-836020 TTTTCCTGGAAAAGAAGCAATGG - Intergenic
925243842 2:2361105-2361127 TTCTCCTATAAAAGAATCCAGGG - Intergenic
925545984 2:5017231-5017253 GATTTCTTGAAAAGAAATCAAGG - Intergenic
925681175 2:6422884-6422906 TTTTCCTATAAAAGGAACAAGGG + Intergenic
926106501 2:10155510-10155532 ATTTCATAGTAACGAAACCAGGG - Intronic
926389390 2:12372379-12372401 GTTTCCTAGAAAGAAGACTAAGG - Intergenic
927606938 2:24493722-24493744 GATTTCTAGAAATGAAACCCTGG - Intronic
928075702 2:28262573-28262595 GATGCCTAAAAAAGAAACCTGGG - Intronic
928353006 2:30580127-30580149 GTTTTCTAGGAAAGAAACTCTGG + Intronic
928400698 2:30976726-30976748 GTTTCCTAAAAAAGATACCTTGG + Intronic
928756121 2:34527717-34527739 ATTTTGTAGAAAAGAAATCAGGG + Intergenic
929906526 2:46050843-46050865 CTTTTCTAGAAAAGAAATCATGG + Intronic
930321673 2:49862533-49862555 GTCTCTTAGAAAAGAAAGGAAGG - Intergenic
930968667 2:57366043-57366065 GTTTCCTAGTAAAGTGACCAAGG - Intergenic
930973642 2:57427639-57427661 TTTTCCTAGAAAAGGAAGCAGGG + Intergenic
931981725 2:67700274-67700296 CTTTCCTAGAATGGAAACCTAGG + Intergenic
931994772 2:67829376-67829398 TTTTCAAAAAAAAGAAACCAAGG + Intergenic
932055143 2:68435864-68435886 GTTTCCAAAAATAGAAATCATGG + Intergenic
932500665 2:72180235-72180257 TATTCCTAGAACACAAACCATGG + Intronic
934876789 2:97929066-97929088 TTTTCCAATAAAAGAAACCAGGG + Intronic
935138405 2:100328827-100328849 CTTTCCCACTAAAGAAACCAGGG - Intergenic
935754570 2:106266949-106266971 TTCTCCAAGAAGAGAAACCAGGG + Intergenic
935984865 2:108662698-108662720 GTTTTCCAGAAAAGAAAGCTTGG + Intronic
936019864 2:108986742-108986764 TTTTCCTAAAAAATAAAGCAAGG - Intronic
936113957 2:109687436-109687458 TTCTCCAAGAAGAGAAACCAGGG - Intergenic
937951774 2:127393767-127393789 TTCTCCAACAAAAGAAACCAGGG - Intergenic
939444794 2:142294965-142294987 CTTTCCAATAAAAGGAACCAGGG - Intergenic
940042684 2:149377201-149377223 GTTTCCAAGAAAAAAAAAAAAGG - Intronic
940405998 2:153303327-153303349 CTTTCCAAAAAAAGAAATCAGGG - Intergenic
941183865 2:162296439-162296461 GTTTCATAGGTGAGAAACCAAGG + Intronic
941544194 2:166827069-166827091 TTCTCCAAGAAAAGGAACCAGGG + Intergenic
943601621 2:189927588-189927610 GTTTCAGAGAAAAGAAAGAATGG - Intronic
943786948 2:191887752-191887774 ATTTCCGAGAGGAGAAACCAAGG - Intergenic
943968376 2:194368206-194368228 TTTTCCAATAAAAGAAGCCAGGG - Intergenic
944305392 2:198173085-198173107 TTTTCATAGAAATGAAAGCAGGG - Intronic
944587210 2:201182943-201182965 GCTTCCTAGAAACGAACCCGTGG - Exonic
944902001 2:204224746-204224768 CTTTCCAAGAAGAGAAAGCATGG + Intergenic
945691534 2:213042981-213043003 GTTTTTTATTAAAGAAACCATGG + Intronic
946127489 2:217576545-217576567 TTATCCAACAAAAGAAACCAGGG + Intronic
946518732 2:220442638-220442660 GTTTCATAGAAAAAAAGTCAAGG - Intergenic
947473697 2:230422017-230422039 ATTTTCAAGAAAAAAAACCAGGG - Intronic
948237885 2:236403965-236403987 GTTTCCCCGAATAGAAACCAGGG + Intronic
948647853 2:239419526-239419548 TTTTTCTAGAAAAAAAAACAGGG - Intergenic
948875174 2:240822661-240822683 GTTTCCTAGGAAGGGAGCCAGGG + Intergenic
1168859366 20:1035026-1035048 GTCTTCAAGAAAAGAATCCAGGG - Intergenic
1169382901 20:5124292-5124314 TTTTCCTACAGAAGAAATCAGGG + Intronic
1169450657 20:5707929-5707951 GTCTCTTAAAAAACAAACCAAGG - Intergenic
1169602992 20:7283596-7283618 TTTTCCAAGAAAAGGAACCAGGG - Intergenic
1170872145 20:20215706-20215728 GTTTCTTGAAAAAGAAATCATGG - Intronic
1172642022 20:36446261-36446283 TTTTACAAGGAAAGAAACCAAGG - Intronic
1172816540 20:37691715-37691737 GTTTCCTACAAATTTAACCATGG + Intergenic
1172988879 20:39017087-39017109 GTTTCTTAGACATGACACCAAGG - Intronic
1175590529 20:60187225-60187247 GATTCATATAAAAGAAAGCAAGG - Intergenic
1176425288 21:6544923-6544945 GTTTCCTAAAAAAAAAAAAAGGG + Intergenic
1176615517 21:9025515-9025537 ATTTCCAAGAGAAGAAACCCAGG + Intergenic
1176709663 21:10138291-10138313 ATTTCCAAGAGAAGAAACCCAGG - Intergenic
1177413694 21:20767075-20767097 GTGTTCTAGAAATGAAACAAAGG - Intergenic
1177484814 21:21743568-21743590 GTTTCCTTGGGATGAAACCAAGG - Intergenic
1178381732 21:32115306-32115328 ATTTCCAATAACAGAAACCAAGG + Intergenic
1178760447 21:35397011-35397033 GTCTCAAAAAAAAGAAACCATGG - Intronic
1178808711 21:35861198-35861220 ATTTGATAGATAAGAAACCAAGG - Intronic
1179700779 21:43153240-43153262 GTTTCCTAAAAAAAAAAAAAGGG + Intergenic
1181021634 22:20106578-20106600 GTTTTCTCTTAAAGAAACCATGG + Exonic
1181393443 22:22600564-22600586 GTTTCAGAGAAATCAAACCAGGG + Intergenic
1181601450 22:23954166-23954188 GTTTCATAGGAGGGAAACCAAGG + Intergenic
1181607056 22:23987171-23987193 GTTTCATAGGAGGGAAACCAAGG - Intergenic
1182433638 22:30316009-30316031 GTTTCCTGATAAGGAAACCAAGG - Intronic
1182635120 22:31720059-31720081 TTTTACAATAAAAGAAACCAAGG - Intronic
1182840442 22:33385135-33385157 GTAACCAAGAAAAGATACCAAGG - Intronic
1183656040 22:39185314-39185336 GTTTCCCAAGAAATAAACCAGGG + Intergenic
1184177537 22:42797322-42797344 GGTTCCAAGAAAATAAAGCAAGG + Exonic
1184251234 22:43261477-43261499 GTCTCCTAGAATAGTCACCAAGG - Intronic
1184307650 22:43617441-43617463 ATATTCTAGAAAAGAAATCAGGG - Intronic
1184563723 22:45278570-45278592 TCTTCCTGAAAAAGAAACCAAGG + Intergenic
1184779871 22:46642259-46642281 GCTTCCACCAAAAGAAACCAGGG - Intronic
1184846109 22:47088246-47088268 TTTCCCATGAAAAGAAACCAAGG + Intronic
949504854 3:4717967-4717989 TTTTCCTAGAAGAGAAGCCATGG - Intronic
949588858 3:5471953-5471975 GTTACATAGAAAAGGAACCATGG - Intergenic
949944520 3:9179343-9179365 TCTTCCTAGAAAAGCAACCTTGG + Intronic
950423462 3:12912091-12912113 GTTCCCGAGAAAGGAAGCCATGG - Intronic
950803271 3:15573180-15573202 GTTTCCTAGCAAAGTAACAGCGG + Exonic
951217040 3:20035087-20035109 CTTTCCTAGAAATGAGACCCTGG + Intergenic
951553330 3:23896663-23896685 GTTACCAAGAAAAAAAAACAGGG + Intronic
951889725 3:27557079-27557101 GTTTCCAAGAATAGAATACAGGG - Intergenic
952229082 3:31410669-31410691 TTTTCCAATAAAAGAAACCAAGG + Intergenic
952442006 3:33340392-33340414 TTTTCCACAAAAAGAAACCAGGG + Intronic
953066404 3:39475843-39475865 GTGTCCAATAAAAGGAACCATGG - Intronic
953119380 3:40025013-40025035 TTTGCCAAAAAAAGAAACCAAGG + Intronic
953374182 3:42414732-42414754 GGTTTCTAGAAAATAAAGCAAGG - Intergenic
953424527 3:42782479-42782501 ATTTTATAGATAAGAAACCATGG + Intronic
954803575 3:53201852-53201874 TTTACCCAGAAAAGAATCCAAGG - Intergenic
955205094 3:56888599-56888621 GCTTCTTAAAAAAGCAACCAGGG + Intronic
955230387 3:57093940-57093962 GTCCTCTAGAAAAGAGACCAGGG - Exonic
955268537 3:57472667-57472689 GATTCCTACAAAAGAAACTCTGG + Intronic
955560593 3:60185082-60185104 TTTCCCAATAAAAGAAACCAAGG - Intronic
955777237 3:62446981-62447003 GTCTCCCAGAAAAGTACCCAGGG + Intronic
956039610 3:65132205-65132227 AATTCCTAGAAAAGTACCCAGGG + Intergenic
956039832 3:65134077-65134099 AATTCCTAGAAAAGTACCCAGGG + Intergenic
957135374 3:76281022-76281044 GATTCCTAGAAGTGAAACTATGG - Intronic
957626355 3:82657587-82657609 GTTTCTTAAAAAAGAACCTATGG + Intergenic
958644091 3:96846755-96846777 GTTTCCTATGAAAGAAACTATGG + Intronic
958869978 3:99546772-99546794 GTTTTATAGAAGAGAAAACATGG + Intergenic
959095344 3:101949572-101949594 GTTCCCCAGAAAAGAGACTATGG - Intergenic
959729764 3:109588227-109588249 GTTTCCAATAAAAGAAAAAAAGG + Intergenic
960807279 3:121596377-121596399 GTTTCCTAGAGGAGAAACTGAGG - Intronic
960836628 3:121913289-121913311 GTTTCAAAGGAAAGAGACCAGGG + Intronic
960950401 3:122995230-122995252 GTTTTCTGGAACAGAACCCAGGG + Intronic
961253346 3:125524747-125524769 GTTGCATAGAACAGAGACCAGGG - Intergenic
961585651 3:127920545-127920567 GTTTCCTAGAAAAGAAGGCACGG + Intronic
962642979 3:137407573-137407595 ATTTCCTAGCAAAGGAATCATGG - Intergenic
963197433 3:142548342-142548364 GTTTCATAGATAAGGAACTAAGG - Intronic
964461368 3:156933705-156933727 GTTTCCTGAAAAAGAAAACATGG - Intronic
967178240 3:186880724-186880746 ATTTCCTCGAAGAGAAACCAAGG - Intergenic
967410649 3:189163615-189163637 GTTTCCTTGAAAAGGAAATACGG + Intronic
970191247 4:13521736-13521758 ATTTCATGTAAAAGAAACCAAGG + Intergenic
970297812 4:14649951-14649973 TTTTCCAGGTAAAGAAACCAGGG - Intergenic
970350689 4:15198871-15198893 GTTTCCTAAAAGAAAAACCCAGG + Intergenic
971018786 4:22514567-22514589 GTTTCCTAAAAAAAGAATCAAGG - Intronic
971083408 4:23242082-23242104 ATTTCCTGGAAAATAAAACAGGG - Intergenic
972727928 4:41762047-41762069 GTTCCCAAGAAAAGGAACCAGGG - Intergenic
972985217 4:44755122-44755144 GTTTCTTAGGCAAGAAACCAGGG + Intergenic
973000290 4:44939688-44939710 GTTTCATAAAAAATAAACGAAGG - Intergenic
974971231 4:68830843-68830865 GTTTGCTAGAAAAGGAAAGAAGG + Exonic
974992583 4:69112700-69112722 GTTTGCTAGAAAAGCAAAGAAGG + Exonic
976050227 4:81003258-81003280 GTTTTCTAGGGAAGAAATCAAGG - Intergenic
976411801 4:84721767-84721789 GTTTTATAGATAAGAAACTAAGG - Intronic
976632857 4:87256892-87256914 GTTTTAAAGAAAAGAAAACAGGG - Intergenic
976942476 4:90720272-90720294 TTTTTCTAAAAAACAAACCAGGG - Intronic
977409516 4:96644052-96644074 TTTTTTTAGAAAAGAAAACATGG - Intergenic
978152486 4:105453638-105453660 TTTTCCTATAAAAGAAAAGATGG + Exonic
978343970 4:107746594-107746616 ATTTCCAACAAAAGGAACCAGGG + Intergenic
978430233 4:108625887-108625909 GTTTCATAGGATAGAAACCTTGG + Intronic
978614810 4:110583976-110583998 TTCTCCCATAAAAGAAACCAGGG + Intergenic
979497395 4:121398571-121398593 GTTTCATTAAAAAAAAACCAGGG + Intergenic
979644672 4:123053949-123053971 GTTGCTTACACAAGAAACCAGGG - Intronic
980002121 4:127501842-127501864 ATTTTCAAGAAAAGAAAGCATGG - Intergenic
980608955 4:135131581-135131603 GTCACCAATAAAAGAAACCAGGG - Intergenic
982816357 4:159890145-159890167 TTTTCCAATAAAAGAAACCAGGG - Intergenic
983144802 4:164200300-164200322 GTTTCCCAGAAGAAAAATCAAGG + Intronic
983160846 4:164412574-164412596 TTTTCTTAAAAAAGAAAACATGG + Intergenic
983201711 4:164868080-164868102 GTTTCCTAGATATGTAACCTTGG + Intergenic
983441177 4:167787130-167787152 CTTCTCTAGAACAGAAACCATGG - Intergenic
983745736 4:171197478-171197500 TTTTGCAATAAAAGAAACCATGG - Intergenic
984217139 4:176927780-176927802 GTTTCATAAAAAAGAAACTCTGG - Intergenic
984227061 4:177047605-177047627 GTTACTTAGAAAAGTAACAAAGG + Intergenic
986794086 5:11192153-11192175 GTTTCCTAAAGAAGAGACAATGG + Intronic
988333223 5:29870523-29870545 TTTTCCAATGAAAGAAACCATGG + Intergenic
988987186 5:36631928-36631950 GTTGCCTAGGGAAGAAACAAAGG + Intronic
989005753 5:36810342-36810364 CTTTCCTAGAAAGGAAACTTAGG - Intergenic
989354359 5:40525865-40525887 CTTTCTGATAAAAGAAACCAGGG + Intergenic
989450514 5:41581711-41581733 ATTCCCCAGAAAAGAAAGCAGGG + Intergenic
989545409 5:42666957-42666979 GTTTCCCACAAAGGCAACCATGG + Intronic
990303733 5:54474784-54474806 GTTGCCTCAAAAAGAAACCCTGG + Intergenic
990344405 5:54857183-54857205 GTTCCCTGGAAAAAAACCCACGG - Intergenic
990621784 5:57567802-57567824 GCCTCCTAGAGAAGAAAGCAGGG - Intergenic
990917402 5:60924641-60924663 AGTTCCCAAAAAAGAAACCAAGG - Intronic
993187623 5:84640222-84640244 GATTCCTAGTAAAGAAAATAAGG + Intergenic
993322659 5:86492505-86492527 TTATCCTAGAAAAGTAAGCAAGG - Intergenic
993393384 5:87351326-87351348 GTTTATTAGAAAAGAAAGTATGG + Intronic
994056759 5:95425618-95425640 GGATCTTAGAAAAGAAATCATGG + Intronic
994797903 5:104330152-104330174 GTTACATAGAAAAATAACCATGG - Intergenic
995022850 5:107385384-107385406 ATTCCCTGGAAAAAAAACCATGG + Intronic
996013496 5:118506447-118506469 GTATCCTGGAAGAGAAAGCATGG + Intergenic
996167527 5:120243346-120243368 GGTTCCAAAAAAAGAAACTAAGG - Intergenic
996269144 5:121580955-121580977 ATTTTCTAGAAAAATAACCAGGG + Intergenic
996598456 5:125232226-125232248 TTCTCCAATAAAAGAAACCAGGG - Intergenic
997617812 5:135263912-135263934 GTATTCTAGCAAAGAAAACAAGG - Intronic
998366744 5:141637130-141637152 GCTTCCTAGAGAAGTGACCACGG - Exonic
998709832 5:144811040-144811062 GTGTGTTTGAAAAGAAACCAAGG - Intergenic
1000213885 5:159136563-159136585 GCTTCCTAGAAGAGACAGCAAGG - Intergenic
1001540287 5:172533118-172533140 GTTTCCTAAAAAAGAAATTACGG - Intergenic
1001849395 5:174950622-174950644 GTTATCTAGCAAACAAACCAGGG + Intergenic
1001989401 5:176103926-176103948 GTTTTCTAGATAAGAAACAGTGG + Intronic
1002108669 5:176893290-176893312 GTTCCCTTGAAAAGAACTCAAGG + Intronic
1002227471 5:177734212-177734234 GTTTTCTAGATAAGAAACAGTGG - Intronic
1002477303 5:179475142-179475164 CTTTCCTAAGAAAGAGACCAAGG - Intergenic
1003469855 6:6419292-6419314 GTCTTCAATAAAAGAAACCAGGG - Intergenic
1003756481 6:9126525-9126547 ATTTTTTAAAAAAGAAACCAAGG + Intergenic
1004130301 6:12913096-12913118 GTTTCCTACAGAAAAACCCAAGG + Intronic
1004394839 6:15238703-15238725 GATTCATAGATAAGAAACTATGG + Intergenic
1004868476 6:19878087-19878109 GTCTCCAATAAAAGGAACCAGGG + Intergenic
1004907929 6:20253931-20253953 TTTCCCTCTAAAAGAAACCAGGG - Intergenic
1005316418 6:24606847-24606869 GCTGCCTAGAACAGAAAACAAGG + Intronic
1005707678 6:28471449-28471471 TTTTCCAATAAAAGGAACCAGGG - Intergenic
1006534772 6:34689837-34689859 GTTTTCTAGAAAAGTAACTTGGG - Intronic
1006888793 6:37405366-37405388 GTTTACTACAAAGGACACCATGG + Intergenic
1007344087 6:41215266-41215288 GATTCCTAGAAGAGAAACTTGGG + Intergenic
1008914813 6:56775552-56775574 GCTTCCAATAAAAGGAACCAGGG + Intronic
1009337787 6:62514670-62514692 GTTTCCAAGAAAGGCTACCAAGG + Intergenic
1009373239 6:62934815-62934837 GTCTCCCAGAAAAGAAAACCTGG - Intergenic
1009996518 6:70901345-70901367 TTCTCTTATAAAAGAAACCAGGG + Intronic
1010895307 6:81355586-81355608 GTTTTCTAATAAAGCAACCAAGG - Intergenic
1012157093 6:95833158-95833180 GTTCTATAGAAAAGAAACCTTGG + Intergenic
1012298799 6:97558448-97558470 ATTTTATAGATAAGAAACCAAGG - Intergenic
1012627363 6:101420559-101420581 ATTTCATAAAAAAGAAACTAGGG + Intronic
1012637792 6:101567706-101567728 GTTTCTTAGAGAGGTAACCAGGG + Intronic
1012672223 6:102068484-102068506 GTTGCCAGGTAAAGAAACCATGG + Exonic
1013182471 6:107729836-107729858 GTTGTCTAGAAAAGAAACTATGG + Intronic
1014689893 6:124550497-124550519 TTTTCCAATAAAAGTAACCAGGG - Intronic
1014874400 6:126639305-126639327 TTTGCCAATAAAAGAAACCAGGG - Intergenic
1015022643 6:128494732-128494754 GTTTACTAGAAAAAACATCATGG - Intronic
1016532694 6:145075796-145075818 TTTTCCTAGAAAGGAAACTCTGG + Intergenic
1017137733 6:151162987-151163009 TTTTCCAATAAAAGGAACCAAGG - Intergenic
1017479166 6:154832630-154832652 GTTTCCTCCTATAGAAACCAGGG + Exonic
1017695121 6:157007100-157007122 GTTGCCTAAATAAGATACCAAGG - Intronic
1019004926 6:168789045-168789067 TTTTTCTAGGAAAGAAGCCATGG + Intergenic
1020986624 7:15143091-15143113 GGCTACTAGAAGAGAAACCAGGG - Intergenic
1021237436 7:18159452-18159474 GTTGCCTGGAAAAGAAAGAAGGG - Intronic
1021254094 7:18368541-18368563 TTTTCCCAGAAAATAAAGCACGG - Intronic
1021349396 7:19571730-19571752 TTTTCCAGGAAAGGAAACCAAGG - Intergenic
1021860408 7:24900520-24900542 CTTTCCCAGAAAAGAACTCAGGG - Intronic
1021920900 7:25483895-25483917 GTTCCTTAGAAAAGCAACCTGGG + Intergenic
1022678863 7:32525770-32525792 GTTTCCTTGAAAGTAAAACAAGG - Intronic
1022768928 7:33448177-33448199 GTTTCCCACACAGGAAACCAAGG - Intronic
1023500580 7:40845009-40845031 GATTCCTAGAATAGAAAACAAGG - Intronic
1023781705 7:43661677-43661699 GTTTCCTAGATCACAATCCAGGG + Intronic
1024427810 7:49247783-49247805 GATTCTCAGAATAGAAACCAGGG - Intergenic
1027345612 7:77256802-77256824 GTTTCCTTGAAGAACAACCATGG + Intronic
1027945317 7:84737665-84737687 TATTCCAATAAAAGAAACCAGGG - Intergenic
1028445998 7:90924788-90924810 GTTTTTTAAAAAAGAAACTAGGG - Intronic
1029026949 7:97426805-97426827 GTTTCTCAGAAAATAAAACAAGG + Intergenic
1029101229 7:98131937-98131959 GTTCACTTTAAAAGAAACCAGGG + Intronic
1031113864 7:117645829-117645851 GTATCCTAGTTAAGAAAGCAAGG + Intronic
1031481005 7:122278565-122278587 GAATCCTAGAAAAAAAACCTAGG - Intergenic
1031842525 7:126761562-126761584 GTGTTTTAGAAAAGAAACTATGG - Intronic
1032938020 7:136756422-136756444 TTTTCCAAGGAAAGAAACTAAGG - Intergenic
1033433807 7:141314117-141314139 GTTTCCAAGCAAAGAAGCTATGG - Intronic
1034651350 7:152693247-152693269 TTTTCCTACAAAAGGAATCAGGG + Intergenic
1034915175 7:155033036-155033058 GGTTTCTAGAAAAGAAAAAAAGG + Intergenic
1035868025 8:3106000-3106022 TAGTCCTAGAAAATAAACCAAGG - Intronic
1036024380 8:4888658-4888680 TTTGCCAACAAAAGAAACCAGGG + Intronic
1037492734 8:19411251-19411273 GTTACAGAGAAAATAAACCAGGG - Intronic
1038487441 8:27946856-27946878 GTTTGCTAAAACAGAAATCAGGG - Intronic
1039795831 8:40914039-40914061 AATTCCTAGAAATGAAATCATGG - Intergenic
1040465727 8:47693363-47693385 GTTTCTTACAGAAGAAATCAGGG + Intronic
1041692113 8:60698691-60698713 GTTTCTTAGTAAAGAGAACATGG + Intronic
1042770773 8:72379456-72379478 GCATCCTAGAAGAAAAACCAAGG + Intergenic
1043749053 8:83912158-83912180 GTTACCTATAAGAGAAAACAAGG + Intergenic
1043919440 8:85964438-85964460 GTTTCTTAAAACAGAAAGCAGGG + Intergenic
1044221048 8:89669932-89669954 GTTTCCTACAAAAAAAAGAAAGG - Intergenic
1044750220 8:95408616-95408638 CTTTCATAGACAAGAAACCATGG - Intergenic
1045239075 8:100382791-100382813 GTTTCCATGAAAAGAACCCATGG + Intronic
1045637285 8:104206987-104207009 TCTTTTTAGAAAAGAAACCAAGG + Intronic
1045658685 8:104413031-104413053 ATTTCATATAAAACAAACCAGGG + Intronic
1046315810 8:112500414-112500436 GTTTTCTAGAACTGAAACTATGG - Intronic
1047888055 8:129274753-129274775 GTGTCCCAGAAAGGAAACAATGG + Intergenic
1048084939 8:131167252-131167274 GTTTCCCAGAGAGAAAACCAAGG - Intergenic
1048200416 8:132369452-132369474 TTGTCCAATAAAAGAAACCAGGG + Intronic
1049011865 8:139892603-139892625 GTTTCCAAGAAAATAAACCGTGG - Intronic
1049461950 8:142734361-142734383 CTTTCCCAGAAAAGCAACCCTGG - Intronic
1051477800 9:17527715-17527737 GTTTCCAATAAGAGGAACCAGGG + Intergenic
1051871498 9:21742826-21742848 ATCACCTAGCAAAGAAACCAAGG + Intergenic
1052682957 9:31717605-31717627 GGTTCCAAGAAGAGAAACCTCGG - Intergenic
1053258428 9:36639691-36639713 GTGTGGTAGAAAAGATACCAAGG - Intronic
1053759086 9:41339743-41339765 ATTTCCAAGAGAAGAAACCCAGG + Intergenic
1054327640 9:63721710-63721732 ATTTCCAAGAGAAGAAACCCAGG - Intergenic
1054992142 9:71340810-71340832 TTTTCCAGTAAAAGAAACCAGGG + Intronic
1056049196 9:82750403-82750425 GTTTTCTAGAGAAGAAAACATGG + Intergenic
1056061913 9:82892169-82892191 GTTTCCTAGTAGACAAAGCAAGG - Intergenic
1057053757 9:91946223-91946245 GTTTCAAAGTAAAGAAACCAGGG - Intronic
1057323876 9:94041823-94041845 TTTTCCAATAAAAGGAACCAGGG - Intronic
1058352428 9:104041658-104041680 GTTTCCTTGAAAGTAAAACAAGG + Intergenic
1058482434 9:105410173-105410195 GTTTCATAGCCAAGAAACAATGG - Intronic
1059183737 9:112245635-112245657 TTTTCCCCTAAAAGAAACCAGGG + Intronic
1059465753 9:114467753-114467775 GATTCATGGAAAAGAAAGCAGGG + Intronic
1059858548 9:118429737-118429759 GTTTCTTAGAAAACTAAACATGG - Intergenic
1202794422 9_KI270719v1_random:107258-107280 ATTTCCAAGAGAAGAAACCCAGG - Intergenic
1185821233 X:3206844-3206866 TATTGCTAGGAAAGAAACCAAGG - Intergenic
1186555716 X:10556226-10556248 GTTTCCAAGAAAAGAAAAGCTGG - Intronic
1186859230 X:13654931-13654953 GTCTCCTACGAAAGAAGCCAAGG + Intronic
1187119121 X:16386542-16386564 GTTTCCAAGAAAAAAAATTAAGG - Intergenic
1187900565 X:24024441-24024463 ATTTCATAGATAAGAAACCAAGG + Intronic
1188137730 X:26510385-26510407 ATTCCCAAGAAAAGGAACCAGGG - Intergenic
1188306761 X:28568683-28568705 GTTTCCTAGAAAAGTAAGTTGGG - Intergenic
1188657171 X:32712497-32712519 GTTTCCTCCAAAAGAAACACAGG + Intronic
1189067451 X:37825578-37825600 GTTTCATGAAAAAGAAACCTTGG - Intronic
1189221681 X:39377610-39377632 GATTCCTAAAAAAGAACCCAGGG - Intergenic
1190402237 X:50048757-50048779 TTTTCCAATAAAAGGAACCAGGG - Intronic
1190450327 X:50572960-50572982 TTTTCCAATAAAAGGAACCAAGG - Intergenic
1192373107 X:70532181-70532203 GTTTTACAGTAAAGAAACCATGG + Intronic
1192387576 X:70687841-70687863 GTTTCAAAGAAAAGAAAGAAAGG + Intronic
1192903141 X:75521876-75521898 GTTTCCTAAAAAAGATAACGAGG + Intronic
1192945604 X:75963327-75963349 CTTTCCTGAGAAAGAAACCATGG + Intergenic
1195914490 X:109922762-109922784 ATTTTACAGAAAAGAAACCAAGG + Intergenic
1196868452 X:120090231-120090253 GTCTGGTAGATAAGAAACCAGGG - Intergenic
1198468642 X:136925876-136925898 GTTTCTTAAAAAAGAAAATAAGG - Intergenic
1199030316 X:142990200-142990222 CTTTCCTAAAACAAAAACCAAGG + Intergenic
1201148909 Y:11084167-11084189 ATTTCCAAGAGAAGAAACCCAGG + Intergenic
1201220110 Y:11760579-11760601 GTCTCTTAGAAGAGAAACCAAGG + Intergenic
1201396575 Y:13555053-13555075 GTTTCCCACATAGGAAACCAGGG - Intergenic