ID: 1144552802

View in Genome Browser
Species Human (GRCh38)
Location 17:16256422-16256444
Sequence GAGGCAGAGGAATCGGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1137
Summary {0: 1, 1: 0, 2: 12, 3: 88, 4: 1036}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144552802_1144552811 20 Left 1144552802 17:16256422-16256444 CCACCTCCCGATTCCTCTGCCTC 0: 1
1: 0
2: 12
3: 88
4: 1036
Right 1144552811 17:16256465-16256487 CCTCAGCCTCCCGAGTAGCTGGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
1144552802_1144552809 19 Left 1144552802 17:16256422-16256444 CCACCTCCCGATTCCTCTGCCTC 0: 1
1: 0
2: 12
3: 88
4: 1036
Right 1144552809 17:16256464-16256486 GCCTCAGCCTCCCGAGTAGCTGG 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144552802 Original CRISPR GAGGCAGAGGAATCGGGAGG TGG (reversed) Intronic
900121667 1:1050951-1050973 GAGGCAGAGGACAGGGCAGGCGG - Intronic
900158919 1:1214214-1214236 AGGGCAGAGGAGGCGGGAGGAGG + Intergenic
900459296 1:2793915-2793937 GAGGTAGGGGAGTGGGGAGGTGG - Intronic
900522308 1:3111566-3111588 GAGGAAGGGGAAGAGGGAGGAGG + Intronic
900567908 1:3343718-3343740 GAGGCGGAGAACCCGGGAGGCGG - Intronic
900847023 1:5112306-5112328 GAGGCAGAGGAAGAGGAAGAGGG + Intergenic
900847047 1:5112390-5112412 GAGGCAGAGGGAGAGGAAGGGGG + Intergenic
900891706 1:5454441-5454463 GAAGTAGAGAAATGGGGAGGGGG - Intergenic
901453908 1:9352638-9352660 GAGGCAGAGGAGGGAGGAGGAGG - Intronic
901555435 1:10028361-10028383 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
901761834 1:11476986-11477008 GAGGCAGAGGCCTGTGGAGGGGG - Intergenic
901764727 1:11492538-11492560 TGGGGAGAGGAATCGGGTGGGGG - Intronic
901766350 1:11502336-11502358 GAGGTAGAGAAATCGTGGGGTGG + Intronic
901850051 1:12009219-12009241 GAGGGAGAGGGAGCGGGAGAGGG + Intronic
902165802 1:14570391-14570413 TAGGGATAGGAATTGGGAGGAGG - Intergenic
902258548 1:15206811-15206833 GAGGCAGGGGAGCTGGGAGGAGG - Intronic
902563363 1:17292894-17292916 GAGGGAGGGGAATGGGGAAGGGG + Intergenic
902829327 1:19000065-19000087 GAGGAGGAGGAAAGGGGAGGGGG + Intergenic
902835288 1:19043343-19043365 GATGCAGAGGGCTCTGGAGGCGG + Intergenic
902835558 1:19044664-19044686 GATGCAGAGGGCTCTGGAGGCGG + Intergenic
903100176 1:21023252-21023274 GAGGGAGAGGGAGGGGGAGGGGG - Intronic
903234551 1:21941332-21941354 GAGGAAGAGGAGGCAGGAGGTGG + Intergenic
903572284 1:24315051-24315073 GAGGCACAGGAATGGAGACGGGG - Intergenic
903771184 1:25765440-25765462 GAGGCAGGGGAAAGGGAAGGGGG - Intronic
903852716 1:26317900-26317922 GAGGCAGAGGAGGCGGGGTGAGG - Intronic
904256294 1:29257128-29257150 GAGGCAGAGGGAGCAGGAGGAGG + Intronic
904487822 1:30839361-30839383 AAGGCAGAGGAAGAGGGGGGTGG - Intergenic
904930129 1:34081416-34081438 GAAGAAGAGGGAGCGGGAGGGGG - Intronic
905037976 1:34929750-34929772 GAGGGAGAGGAAGAGGGAGGGGG + Intergenic
905266936 1:36760734-36760756 GAGGGAGAGGGAGAGGGAGGGGG + Intergenic
905315420 1:37079752-37079774 GAGGGAGAGGGAGAGGGAGGCGG - Intergenic
905362286 1:37429509-37429531 GAGGGAGAGGGAGCGAGAGGGGG - Intergenic
905362364 1:37429780-37429802 GAGGGAGAGAAAGAGGGAGGGGG - Intergenic
905526877 1:38646706-38646728 GAGGCAGAGGGAGAGGGAGAGGG - Intergenic
905526879 1:38646712-38646734 GAGGCAGAGGCAGAGGGAGAGGG - Intergenic
905686803 1:39914035-39914057 GAGGGAGAGGGAGAGGGAGGGGG + Intergenic
905686807 1:39914041-39914063 GAGGGAGAGGGAGGGGGAGGGGG + Intergenic
905723600 1:40228905-40228927 GAGGCAGAGGCAGCGGGGGGCGG - Intronic
905825537 1:41023543-41023565 GGGGCAGAGGGATAGGGAAGAGG + Intergenic
906427019 1:45723970-45723992 GAGGGAGAGGGAGGGGGAGGGGG - Intronic
907454035 1:54563820-54563842 GAGGCTGAGGGAGCGGGGGGCGG + Intronic
907461155 1:54606390-54606412 CAGGCAGGGGAGTGGGGAGGAGG + Intronic
907513873 1:54981056-54981078 GGGGCAGGGCCATCGGGAGGCGG - Exonic
907555053 1:55336155-55336177 GAGGCAGAAGAAGGGGCAGGAGG + Intergenic
907791240 1:57666856-57666878 GAGGGAGAGGGAGAGGGAGGGGG + Intronic
907977391 1:59445136-59445158 GAGGGAGAGAAAGAGGGAGGAGG + Intronic
908107067 1:60855981-60856003 GAGGAAGAGGATTTGGGAGACGG - Intergenic
908467674 1:64414225-64414247 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
908545946 1:65162259-65162281 GAGGCAGAGGAAGCAGTATGTGG + Intronic
908752700 1:67439813-67439835 GAGGTTTAGGAATCAGGAGGAGG - Intergenic
908960783 1:69694739-69694761 GAGGAAGAGGAAGTGGGGGGGGG - Intronic
909967396 1:81931875-81931897 GAGGCAGAAGCAAAGGGAGGAGG - Intronic
910332968 1:86097441-86097463 GAGGAAGAGGAGGGGGGAGGAGG - Intronic
910396498 1:86799369-86799391 GAAGGAGAAGAAGCGGGAGGAGG - Intergenic
910804110 1:91173536-91173558 GAGACAGAGGAATCTGGGGATGG + Intergenic
910985450 1:93000535-93000557 GAGGAAGAGGAAAGGGGAGAAGG + Intergenic
911064657 1:93777473-93777495 GAGGAAGAGGAAGGAGGAGGAGG - Intronic
911486870 1:98513641-98513663 GAGGCAGAGGGAGAGGGAGAGGG + Intergenic
911767924 1:101701660-101701682 GAGGGAGGGGAGTGGGGAGGGGG - Intergenic
911874910 1:103148488-103148510 GAGGCAGAGGCAGAGGCAGGAGG + Intergenic
912069574 1:105792843-105792865 GAGGCAGAAGAAGTAGGAGGAGG - Intergenic
912280904 1:108312394-108312416 GAGTCAGTGGATTAGGGAGGGGG + Intergenic
912640674 1:111342627-111342649 CAGGCAGAGGCAAAGGGAGGAGG - Intergenic
912797547 1:112701969-112701991 GAGGCAGAGCAGTCAGGAGGTGG - Intronic
913022981 1:114805350-114805372 GAGGGAGAGGGAGGGGGAGGGGG + Intergenic
913203869 1:116517667-116517689 GAGGCAGAGGAGGCGGGACTGGG - Intronic
913997358 1:143662176-143662198 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
915076191 1:153309680-153309702 GACACAGAGGACTGGGGAGGGGG + Intronic
915112619 1:153574470-153574492 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
915465614 1:156096208-156096230 CAGGCAGAGGAAACGGAAGGGGG - Intronic
915733664 1:158071256-158071278 GAGGCAGAGGGAGAGCGAGGAGG - Intronic
915893829 1:159795610-159795632 GAGGCAGGAGAATCAGGAGAGGG + Intergenic
916087666 1:161282406-161282428 GAGGGAGAGGGAGGGGGAGGGGG + Intronic
916863973 1:168836746-168836768 GAGGGAGGGGAAGGGGGAGGGGG - Intergenic
917482349 1:175423281-175423303 GAGGCTGAGGAAGATGGAGGAGG - Intronic
917510390 1:175664472-175664494 GAGGCAGGGAAATGGGGAGAGGG + Intronic
917639929 1:176973651-176973673 GAGGGAGAAGATTGGGGAGGAGG - Intronic
918069506 1:181124573-181124595 GAGGAAGAGGAAGGAGGAGGAGG - Intergenic
918118570 1:181517612-181517634 GAGGCAGAGGAAAAGGGAGCAGG + Intronic
919465395 1:197918231-197918253 CAGGGAGAGGAACTGGGAGGAGG + Intronic
919906933 1:202084918-202084940 GAGGAGGAGGAATCGCGAGGTGG + Intergenic
920041455 1:203100365-203100387 GAAGTAGAGGCATTGGGAGGTGG + Intronic
920365318 1:205445182-205445204 GAGGGAGAGGGAGAGGGAGGAGG - Intronic
922176135 1:223199482-223199504 GAGGAAGAGGAAAAGGAAGGAGG - Intergenic
922452961 1:225751321-225751343 GAGACAGTGGAATCTGTAGGAGG + Intergenic
922822616 1:228494489-228494511 GAGGCACAGGAGTGGGGTGGGGG - Exonic
923118764 1:230970361-230970383 GAGGCAGAGGGATGGGGCAGTGG + Intronic
923150596 1:231229832-231229854 GAGGGAGGGGAATGGGGAGCTGG + Intronic
923218429 1:231871349-231871371 GAGGGAGAAGGATAGGGAGGTGG + Intronic
923468420 1:234268461-234268483 GAGGGAGAGGGAGAGGGAGGGGG + Intronic
923716537 1:236429186-236429208 GAGGGAGAGGGAGCGGGAGCGGG + Intronic
924216892 1:241831716-241831738 GAGGCAGGAGAATCGGTTGGAGG + Intergenic
924235544 1:241996822-241996844 GAGGCAGGAGAACCAGGAGGCGG + Intronic
924588598 1:245381666-245381688 GATGCAGAGTATTCTGGAGGTGG - Intronic
1062996317 10:1870292-1870314 GAGGCAGAGGAATAGGGCTCAGG - Intergenic
1063084846 10:2806983-2807005 GAGGGAGAGGGAGGGGGAGGGGG + Intergenic
1063173369 10:3529754-3529776 GAGGAAGAGGAGGAGGGAGGAGG - Intergenic
1063744762 10:8868374-8868396 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
1064108840 10:12520936-12520958 GAGGGAGAGGGAGGGGGAGGGGG + Intronic
1064177327 10:13086541-13086563 GAGGCAGGAGAACCGGGAGGCGG - Intronic
1064244340 10:13657218-13657240 GAGGCAGCGGCAGCGGGCGGCGG - Exonic
1064244342 10:13657224-13657246 GAGGCAGAGGCAGCGGCAGCGGG - Exonic
1064635255 10:17358682-17358704 GAGGAAGAGGAAAAAGGAGGAGG + Intronic
1064635262 10:17358727-17358749 GAGGAAGAGGAAAAAGGAGGAGG + Intronic
1064732645 10:18348598-18348620 GAGGCAGGAGAATCAGGAGGTGG - Intronic
1064788837 10:18932147-18932169 AAGGCAGAAGACTCAGGAGGAGG - Intergenic
1064817523 10:19283534-19283556 GAAGAAGAGGAAATGGGAGGAGG - Intronic
1064887418 10:20125192-20125214 GAAGCAGAGTATTAGGGAGGTGG + Intronic
1065623816 10:27610619-27610641 GAGGAAGAGGAAGAAGGAGGAGG - Intergenic
1065669822 10:28103844-28103866 AAGCCATAGGAATGGGGAGGAGG + Intronic
1065729161 10:28694750-28694772 GAGGCAGAGTAAGCCAGAGGTGG - Intergenic
1065866426 10:29919080-29919102 GAGGCAGAAGAGAGGGGAGGAGG - Intergenic
1065954509 10:30681881-30681903 GAGGCAGAGGGAGAGGGTGGAGG - Intergenic
1065985149 10:30943355-30943377 GAGACAGAGGGAAAGGGAGGAGG + Intronic
1066022010 10:31313133-31313155 GAGAAAGAGAAATCTGGAGGAGG + Intergenic
1066336232 10:34481234-34481256 GAGGGAGAGGGAAAGGGAGGAGG - Intronic
1066660694 10:37736482-37736504 GAGGGAGAGGAAGAGAGAGGGGG + Intergenic
1067114246 10:43422641-43422663 GAGGGAGAGGGAGAGGGAGGGGG - Intergenic
1068334083 10:55608297-55608319 GAAGCAGAGGGAAGGGGAGGGGG + Intronic
1068478405 10:57558086-57558108 GAGGAAGAAGAAGCAGGAGGAGG + Intergenic
1069302770 10:66928545-66928567 GAGGGAGAGGGAAGGGGAGGGGG - Intronic
1069606050 10:69739405-69739427 GGGGCAGAGGAATCAGGCTGAGG + Intergenic
1069930227 10:71876721-71876743 GAGGGAGAGGGAGCGGGAGCGGG + Intergenic
1070158452 10:73850988-73851010 GAGGGAGAGCTATAGGGAGGGGG - Intronic
1070255966 10:74813537-74813559 GAGGCAGGGGAGGCGGGCGGAGG - Intergenic
1070704685 10:78629161-78629183 GAGGCAGAGGAAGGGGAAGCGGG - Intergenic
1070791647 10:79193019-79193041 GATGCAGAGGAAGAGGGTGGTGG - Intronic
1070810084 10:79293268-79293290 GAGGTGGAGGAGTGGGGAGGGGG - Intronic
1071473720 10:86006883-86006905 GAGGCAGGGGAAGCTGGCGGTGG + Intronic
1071497556 10:86179297-86179319 GAGGGAGGGGAAGAGGGAGGAGG - Intronic
1071564776 10:86666013-86666035 GAGGCAGACAACTCGGGAAGTGG - Exonic
1071617163 10:87086106-87086128 GAGGCAGAGGAATCCTAGGGAGG + Intronic
1072206822 10:93212218-93212240 GACGCAAAGGCATGGGGAGGCGG - Intergenic
1072544102 10:96421116-96421138 GAGGCAGAGGAAGGAGAAGGAGG + Intronic
1072583683 10:96762820-96762842 GAGGCAGGAGACCCGGGAGGCGG - Intergenic
1072587074 10:96792170-96792192 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
1072680076 10:97499550-97499572 GGGGCCGACGGATCGGGAGGAGG + Intronic
1072908453 10:99477283-99477305 GAGGGAGAGGGAGGGGGAGGGGG + Intergenic
1072934863 10:99702386-99702408 GAGGAAGGTGAAGCGGGAGGAGG + Intronic
1073249861 10:102114783-102114805 GAGGCAGAGGCAGCAAGAGGCGG - Intronic
1073288357 10:102401537-102401559 GAGTCAGAGGAGTCGGGCTGGGG - Intronic
1073351928 10:102825998-102826020 GGGGCAGAGGAACCGGGAGAGGG - Intergenic
1073450495 10:103606471-103606493 GAGGGAGAGGGAAGGGGAGGGGG - Intronic
1073849917 10:107602928-107602950 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
1073966719 10:108998669-108998691 GAGGCAGAGGAAACAGCAGTTGG + Intergenic
1074062936 10:109984468-109984490 GAGGCAAAGGAATCGAGAAAGGG - Intergenic
1074360496 10:112821326-112821348 GAGGCCGGGGAAGTGGGAGGGGG - Intergenic
1074561576 10:114539875-114539897 GGGGCAGGGGAAGGGGGAGGAGG + Intronic
1074724458 10:116293709-116293731 GATGCAGAGGAAAAGGAAGGAGG + Intergenic
1074773767 10:116751058-116751080 GAGGAAGAGGAATAGGAAGAAGG + Intergenic
1074801256 10:117003982-117004004 GAGGCAGGAGAATCGCCAGGAGG - Intronic
1075010549 10:118866137-118866159 GTAGCAGGGGAATCGGCAGGGGG - Intergenic
1075074376 10:119341081-119341103 GAGGCCGAGGCATCGGGACCTGG - Intronic
1075136601 10:119791991-119792013 GAGGCAGAGCACTGGGGAGAGGG + Exonic
1075446685 10:122518229-122518251 GAGGCTGAGGAGTCTGGAGCAGG + Intergenic
1075534988 10:123263321-123263343 GAGGCAGAGGGAGAGGGAGTGGG + Intergenic
1075923080 10:126229182-126229204 GAGGGAGAGGAACCAGGAGGTGG + Intronic
1077091263 11:779397-779419 GGGGAAGAGGAATGGGGAGGGGG - Intronic
1077272223 11:1686736-1686758 GAGGCAGAGAAGGAGGGAGGAGG - Intergenic
1077392547 11:2306837-2306859 GAGGGAGAGGGAGGGGGAGGGGG + Intronic
1077680593 11:4237148-4237170 GAGGGAGAGGGATAGGGAGAGGG - Intergenic
1077839489 11:5960234-5960256 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
1078168225 11:8909413-8909435 GAGGAAGAGGAAGGAGGAGGAGG + Intronic
1078238925 11:9512285-9512307 GAGGTGGAGGAATTGGAAGGAGG + Intronic
1078433058 11:11302415-11302437 GTGGCAGAAGAATCTGGATGAGG - Intronic
1078586863 11:12599404-12599426 GTGGCTGAGGAATTGGGTGGAGG - Intergenic
1078910259 11:15724501-15724523 GTGGCAGAGGAAGAAGGAGGAGG - Intergenic
1078934500 11:15939555-15939577 GACCCAGAGGACTAGGGAGGAGG + Intergenic
1079087130 11:17454511-17454533 GAGGGAGAGGCAGAGGGAGGAGG + Intronic
1079243212 11:18735320-18735342 GAGACAGGGTAAACGGGAGGGGG + Intronic
1079362040 11:19777421-19777443 GGGGCAGAGGAAAAAGGAGGAGG - Intronic
1079372187 11:19861032-19861054 GAGGGAGAGGGAGGGGGAGGGGG + Intronic
1079384673 11:19968311-19968333 GAGGCAGAAGAATCAGGAAGCGG - Intronic
1079410282 11:20181104-20181126 GAAGAAGAGGAAGAGGGAGGAGG - Intergenic
1079485906 11:20935769-20935791 GAGGGTGAGGAATGGAGAGGAGG + Intronic
1079667693 11:23128510-23128532 GAGGCAGAAGAATGGCGTGGAGG - Intergenic
1080546565 11:33324862-33324884 CAGGCAGAGGAAGCAGAAGGAGG - Intronic
1082259111 11:50063800-50063822 GAGGGAGAGGAAGAGGGAGAGGG + Intergenic
1082762091 11:57136900-57136922 GAGGAAGAGGAAGGAGGAGGAGG + Intergenic
1082762094 11:57136913-57136935 GAGGAGGAGGAATAGGAAGGAGG + Intergenic
1083154421 11:60814463-60814485 GAGGCAGAGGGAGAGGGAGAGGG - Intergenic
1083318140 11:61828744-61828766 GAGGAGGAGGATTGGGGAGGGGG - Intronic
1083624872 11:64067298-64067320 GAGGCTGAGCAGTGGGGAGGAGG - Intronic
1083704177 11:64501832-64501854 TAAGCAGAGTAACCGGGAGGGGG - Intergenic
1083735384 11:64677327-64677349 GGGGAAGAGGAATCCAGAGGAGG - Intronic
1083771864 11:64872040-64872062 GAAGCAGAGGGAGTGGGAGGTGG + Intronic
1083784347 11:64935230-64935252 GAGGCACAGGCAACGGGAGCTGG - Intronic
1084471760 11:69365746-69365768 GAGGGTGAGGAGTGGGGAGGAGG + Intronic
1084699327 11:70776292-70776314 GAGCCAGAGGAATGGGGTTGGGG - Intronic
1084941329 11:72614954-72614976 GAGGAAGAGAAAGAGGGAGGAGG - Intronic
1084978945 11:72818384-72818406 AAGGGACAGGAATAGGGAGGAGG - Intronic
1085443534 11:76583371-76583393 GAGGGAGAGGGAGGGGGAGGGGG + Intergenic
1085467416 11:76733698-76733720 AAGGCAGATGGATCGGTAGGTGG + Intergenic
1085480697 11:76820783-76820805 GAGGCAGAGGGAGAGGGAGAGGG - Intergenic
1086326707 11:85708933-85708955 GAGGCAGGAGAATGGCGAGGAGG - Intronic
1087076977 11:94134637-94134659 GGGGGAGAGGAAGAGGGAGGGGG - Intronic
1087241835 11:95789573-95789595 GAGGCAGGGGGAGGGGGAGGAGG - Exonic
1087487172 11:98770781-98770803 GAGGGAGGGGAAGGGGGAGGGGG + Intergenic
1087762140 11:102111819-102111841 GGGGGAGGGGAAACGGGAGGGGG - Intronic
1088087396 11:105997271-105997293 GAGGAAGAGGAAGAGGAAGGAGG + Intronic
1088256936 11:107911781-107911803 GAGGGAGAGGGAGGGGGAGGGGG - Intronic
1088779547 11:113121133-113121155 GAGACAGAGGATTAGGGGGGTGG + Intronic
1089125615 11:116174560-116174582 GAGGCAGAGAATTCTGGAGAGGG + Intergenic
1089355097 11:117844423-117844445 GAGGCAGGGGGATGGGGTGGAGG - Intronic
1089479153 11:118791201-118791223 GAGGCAGGGAAAGAGGGAGGAGG - Intergenic
1089678678 11:120107499-120107521 GAGGCAAAGGAGTGGGGAGGGGG - Intergenic
1089746914 11:120623977-120623999 GAGGAAGAGGGAGAGGGAGGAGG - Intronic
1089964487 11:122644708-122644730 GAGGCAGGGCAATCGCAAGGTGG - Intergenic
1089969792 11:122683516-122683538 GAGGCAGGAGAATCTGGAGGCGG + Intronic
1090430542 11:126642505-126642527 AAGGCAGAGGAAAGGGGATGGGG - Intronic
1091067452 11:132529426-132529448 GAAGCAGAGGAATTGAGAGATGG + Intronic
1091206585 11:133825391-133825413 GAGAAAGAGGAATAGGGAAGGGG - Intergenic
1091558677 12:1594443-1594465 GAGGCGGAGGATGCGGCAGGGGG - Intronic
1091800703 12:3322996-3323018 AAGGCAGAGGAAAAGGGAGAAGG + Intergenic
1091816417 12:3442405-3442427 GAGGCAGAGAAAAGGGGAGCTGG + Intronic
1091883609 12:3999979-4000001 GAGGCAGAGATATGGGGTGGGGG - Intergenic
1091985496 12:4907962-4907984 GAGGAAGAGGAAGAAGGAGGAGG + Intergenic
1092877220 12:12858787-12858809 GAGGCAAAGGGATGGGGAGGAGG - Intergenic
1093653221 12:21667819-21667841 TAGGCAGAGGAATCGGGGTATGG - Intronic
1093755304 12:22845721-22845743 GAGGAAGAGGAAGAGGGAGAAGG - Intergenic
1093772461 12:23033507-23033529 GAGAGAGAGGACTTGGGAGGAGG - Intergenic
1094103060 12:26784301-26784323 GAGGCAGAGGGAGAGGGAGAGGG - Intronic
1094232413 12:28122326-28122348 GAAGCAGAAGAATGAGGAGGGGG + Intergenic
1094442998 12:30500280-30500302 GAGGCACAGGAATCAGGAAAGGG - Intergenic
1094670541 12:32564019-32564041 GAGGGAGAGGGAGGGGGAGGGGG + Intronic
1095085189 12:38052645-38052667 GAGGAAGAGGAAGAGGAAGGGGG + Intergenic
1095512970 12:42973902-42973924 GAGGCAGGAGAATCGGGTGGTGG + Intergenic
1095547315 12:43387595-43387617 GAGACAGAGCAATTGGGAAGGGG - Intronic
1096101109 12:48970957-48970979 TAGGGAGAGGGATAGGGAGGAGG + Intronic
1096530471 12:52239524-52239546 CAGGCTAAGGATTCGGGAGGAGG + Intronic
1096541995 12:52313236-52313258 GAGACTCAGGAATTGGGAGGTGG + Intergenic
1096556833 12:52409024-52409046 GAGGGAGAGGGAGAGGGAGGAGG - Intergenic
1096635868 12:52958942-52958964 GAGGCATGAGAATTGGGAGGTGG - Intergenic
1096758751 12:53822229-53822251 GAGGAAGAAGAAGAGGGAGGAGG - Intergenic
1096783123 12:54002034-54002056 GGGGCAGAGGAGGAGGGAGGTGG + Intronic
1096791440 12:54047544-54047566 GAGGCAGAGGCGTCCCGAGGCGG + Intronic
1096843130 12:54391091-54391113 GAGCCAGATGAAGGGGGAGGGGG + Intronic
1097251098 12:57632705-57632727 GAGGAGGAGGAGGCGGGAGGAGG - Intronic
1097779376 12:63686122-63686144 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
1097790651 12:63811915-63811937 GAGGAAGAGGAAGAGGGAGAAGG + Intergenic
1098412418 12:70201118-70201140 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
1098412422 12:70201124-70201146 GAGGGAGAGGGAGAGGGAGGGGG - Intergenic
1098711417 12:73767477-73767499 GAGGCAGTGGAAAGGGGTGGGGG + Intergenic
1099435700 12:82642640-82642662 GAGGCAGAGCATTAGGTAGGGGG + Intergenic
1100446017 12:94660887-94660909 GAGGCAGGAGAATTGGGAGGCGG - Intergenic
1100581833 12:95946627-95946649 GAGGGAGAGGGAGGGGGAGGGGG - Intronic
1101794148 12:107957332-107957354 GAGGCAGTGGTGTCAGGAGGTGG + Intergenic
1101843069 12:108341831-108341853 GAGGAAGAGGGAAAGGGAGGAGG + Intergenic
1102186547 12:110951903-110951925 GAGACAGAGGGAGAGGGAGGGGG + Intergenic
1102230253 12:111257261-111257283 GAGGAAGAGGAAAAGGGAGGAGG - Intronic
1102230351 12:111257570-111257592 GAGGGAGAGGAAAGAGGAGGAGG - Intronic
1102465255 12:113127130-113127152 GAGGCAGAGGCAGAGGCAGGAGG - Intronic
1102470296 12:113156015-113156037 GAGGCAGGAGAATCGCCAGGAGG - Intronic
1102598740 12:114012874-114012896 GAGGGAGAGGGAGAGGGAGGAGG + Intergenic
1102598751 12:114012906-114012928 GAGGGAGAGGGAGAGGGAGGTGG + Intergenic
1102983732 12:117262467-117262489 GAGGGAGAGAAAGGGGGAGGGGG + Intronic
1103437464 12:120937818-120937840 GAGGGAGAGGAAGCAGGATGGGG - Intergenic
1104366865 12:128185982-128186004 AAGGCAGAGAGAGCGGGAGGAGG - Intergenic
1104658648 12:130592818-130592840 CAGGCAGGGAAATCGGGAGCGGG + Intronic
1104693301 12:130842864-130842886 GAGGCAGAGGAAGAGGAAGAAGG + Intergenic
1104700457 12:130899505-130899527 GAAGCACAAGAACCGGGAGGCGG - Intergenic
1104854047 12:131894146-131894168 GAGGGAGGGGAACAGGGAGGGGG + Intergenic
1105367512 13:19778383-19778405 GAGGGAGAGGGAGGGGGAGGGGG - Intronic
1106134051 13:26961241-26961263 GAGACAGAGGAATGGAGAGATGG + Intergenic
1106363032 13:29050089-29050111 GAGAAAGGGGAATAGGGAGGTGG - Intronic
1106389953 13:29325476-29325498 GAAGAAGAGGAAGAGGGAGGAGG + Intronic
1106415624 13:29543696-29543718 GAGGGAGAGGGGTGGGGAGGAGG + Intronic
1106415639 13:29543743-29543765 GAGGAAGAGGGGTGGGGAGGAGG + Intronic
1106593386 13:31116933-31116955 GGGGCAGAGGGAGAGGGAGGAGG + Intergenic
1106746628 13:32715635-32715657 GAGGGAGAGGGATAGGGAGAGGG - Intronic
1107708203 13:43127610-43127632 GAGACAGAGGGAGAGGGAGGAGG - Intergenic
1107863703 13:44683424-44683446 GAGGGAGAGGGAGAGGGAGGGGG + Intergenic
1107863717 13:44683458-44683480 GAGGGAGAGGGAGAGGGAGGGGG + Intergenic
1108347984 13:49565014-49565036 GAGGGAGAGGGAGCGGGAGTGGG - Intronic
1108392053 13:49956259-49956281 GGGGGAGGGGAATGGGGAGGAGG - Intergenic
1108750131 13:53439885-53439907 GAGGGGGAGGGATGGGGAGGGGG - Intergenic
1108954244 13:56132501-56132523 GAGGCAGAGGCTGAGGGAGGGGG + Intergenic
1109369199 13:61399155-61399177 GAGGAAGAGGAAGGAGGAGGAGG + Intergenic
1109428410 13:62199084-62199106 GAGGCAGAGGCAGAGGCAGGTGG - Intergenic
1110598258 13:77342199-77342221 GAGGCAGAGGAAGAGTGAGTTGG + Intergenic
1111396157 13:87672136-87672158 GAGCCAGAGGAGGCTGGAGGGGG + Intergenic
1111907445 13:94271765-94271787 GAGGGAGAGAAAAAGGGAGGGGG - Intronic
1112052910 13:95662102-95662124 GAGCAGGAGGAATAGGGAGGGGG - Intergenic
1112250433 13:97774445-97774467 GGGGGAGAGGGAGCGGGAGGGGG - Intergenic
1112496771 13:99911463-99911485 GAGGCAGAGTCAGAGGGAGGAGG - Intergenic
1112785957 13:102952166-102952188 GAGGAAGAGGAATCAGCATGTGG + Intergenic
1113200840 13:107866696-107866718 GAGAGAGAAGAAACGGGAGGAGG - Exonic
1113321864 13:109241332-109241354 GAGCCATAGGAATCTGGATGTGG + Intergenic
1113374349 13:109750382-109750404 GAGGCAGAGGCAGCTGGTGGTGG + Intergenic
1113648272 13:112014134-112014156 GAAGCAGAAGAATCAGGTGGTGG - Intergenic
1113665116 13:112136141-112136163 GAGGCAGAGGCCTAGGCAGGAGG - Intergenic
1113733186 13:112657313-112657335 GAGGCAGAAGAATCAGGTGGAGG - Intronic
1114414011 14:22527170-22527192 GAGGCAGAGGAACTTGGACGTGG + Intergenic
1114630410 14:24155876-24155898 GAGGGAAAGGAAAGGGGAGGAGG + Intronic
1114735577 14:25040280-25040302 GAGGCAGAGGACAAGGGAGGTGG + Intronic
1115724493 14:36198471-36198493 GGGGAAGGGGAATGGGGAGGAGG + Intergenic
1117471311 14:56048536-56048558 GAGGAAGAGGAAAGCGGAGGAGG + Intergenic
1117878441 14:60281297-60281319 GAGGCAGAGGAGTAGGCAGATGG + Intronic
1117920670 14:60723171-60723193 GGGGGAGAGGAAGGGGGAGGAGG + Intronic
1118124775 14:62889580-62889602 GAGGCAGAGGAATGGGAACAGGG - Intronic
1118366439 14:65101656-65101678 GCGGCAGAGGAAGCGGAGGGTGG + Intronic
1118538924 14:66801798-66801820 GAGGGAGAGGGAGCGGGAGCGGG - Intronic
1119074401 14:71621430-71621452 GAGGCAGAGGTGTCCTGAGGTGG - Intronic
1119326050 14:73760038-73760060 GAGGCAGAGCGCTCGCGAGGCGG - Exonic
1119718320 14:76874320-76874342 GAGGGAGAGGTATGGGGAGCTGG + Intergenic
1120170713 14:81245243-81245265 GAGGGAGAGGGAGGGGGAGGGGG + Intergenic
1120631989 14:86902814-86902836 TAGGCAGTAGAAGCGGGAGGGGG + Intergenic
1120759710 14:88274462-88274484 GAGGCAGGAGAATTGGGAGGAGG + Intronic
1120842424 14:89097515-89097537 GTGGAAGAGGAATGGGGTGGGGG - Intergenic
1121611340 14:95282935-95282957 GACACAGAGGACTGGGGAGGGGG + Intronic
1121667841 14:95686289-95686311 GAGGAGGAGGAAGGGGGAGGAGG - Intergenic
1121678046 14:95770419-95770441 GAGGGAGAGGGAGAGGGAGGGGG - Intergenic
1121735717 14:96216710-96216732 GAGGAAGAGGAAGGAGGAGGAGG + Intronic
1121984901 14:98495774-98495796 GAGGAAGAGGAAGAGGAAGGAGG + Intergenic
1121984903 14:98495780-98495802 GAGGAAGAGGAAGGAGGAGGAGG + Intergenic
1122038176 14:98963397-98963419 GAGGAAGAGGAAGAGGAAGGAGG + Intergenic
1122206016 14:100148425-100148447 GAGGAAGGGGAAGGGGGAGGAGG - Intronic
1122324813 14:100875710-100875732 GAGGAAGGGGAGACGGGAGGTGG - Intergenic
1122447869 14:101782131-101782153 GAGAGAGAGGGATGGGGAGGGGG - Intronic
1122457099 14:101862929-101862951 GAGGCTGAGGCAGGGGGAGGGGG - Intronic
1123064592 14:105611044-105611066 GAGCCAGAGGAACCAGGATGTGG - Intergenic
1123073894 14:105656685-105656707 GAGCCAGAGGAACCAGGATGTGG - Intergenic
1123087894 14:105726268-105726290 GAGCCAGAGGAACCAGGATGTGG - Intergenic
1123093853 14:105755641-105755663 GAGCCAGAGGAACCAGGATGTGG - Intergenic
1123495464 15:20819783-20819805 GAGGGAGAGGAATGGGAAGTTGG + Intergenic
1123551952 15:21388897-21388919 GAGGGAGAGGAATGGGAAGTTGG + Intergenic
1124220537 15:27846758-27846780 CAGGGAAAGGAATGGGGAGGAGG + Intronic
1124395788 15:29300273-29300295 TAGACAGATGAATCGGTAGGTGG + Intronic
1125303638 15:38285097-38285119 GAGGGAGAGGGAGCAGGAGGGGG - Intronic
1126052301 15:44697137-44697159 GGGGAAGAGGAAGAGGGAGGAGG - Intronic
1126244624 15:46490014-46490036 GAGGCAGAAGAATGAGGCGGAGG - Intergenic
1127122056 15:55780319-55780341 GAGGAAGAGGAAAAAGGAGGTGG + Intergenic
1127153920 15:56109035-56109057 GAGGCAGAGGGAGTGGGAGAGGG - Intronic
1127298069 15:57627371-57627393 GAGGGAGAGGGAGGGGGAGGGGG + Intronic
1127383535 15:58449634-58449656 GAGGCAGGAGAAGCTGGAGGCGG - Intronic
1127584078 15:60365854-60365876 GAGGGAGAGGGAGGGGGAGGGGG - Intronic
1127975050 15:63990934-63990956 CAGGCAGAGGAGTAGGGAGGGGG - Intronic
1128353181 15:66905696-66905718 GAGGCAGAGCATTCCCGAGGTGG + Intergenic
1128511274 15:68315494-68315516 GAGGCAGTGGGGTGGGGAGGTGG - Intronic
1128604407 15:69026336-69026358 GAGACTGAGGCATAGGGAGGAGG + Intronic
1128667447 15:69548823-69548845 GAGGCAGAGGGAACGGGAGGGGG - Intergenic
1128826029 15:70718238-70718260 GAGACAGAGGAACGGGGGGGAGG + Intronic
1129054330 15:72808088-72808110 GAGGGAGAGGGAGAGGGAGGGGG + Intergenic
1129054334 15:72808094-72808116 GAGGGAGAGGGAGGGGGAGGGGG + Intergenic
1129075459 15:72991906-72991928 GAGGCCGAGGCAGCGGGCGGTGG + Intergenic
1129165618 15:73775487-73775509 GAGGCTGAGGAGTAGGGAGAGGG + Intergenic
1129518167 15:76169594-76169616 CAGGCAGAGGAACCAGCAGGAGG + Intronic
1129676813 15:77636201-77636223 GAGGCTGAGGAGGCAGGAGGTGG + Intronic
1129770975 15:78203509-78203531 GCGGCAGAGGGAGAGGGAGGCGG - Intronic
1129849515 15:78784392-78784414 GAGGGAGAGGAAGAGGGGGGAGG + Intronic
1129875770 15:78974258-78974280 GCGGCAGAGCACTGGGGAGGAGG - Intronic
1129907968 15:79203029-79203051 GAGGCAGAGGAATAAGGATCAGG + Intergenic
1130226104 15:82059185-82059207 GAGGAAGAGGAGTGGGGAGGAGG - Intergenic
1130404616 15:83587169-83587191 GAGGCAGGGGAAGGGGGAGATGG - Intronic
1130510650 15:84586469-84586491 GAGGAAGAGTAAGGGGGAGGGGG - Intergenic
1130521943 15:84669121-84669143 GAGGCAGAGGAAAGGGCTGGAGG - Intergenic
1130721061 15:86386167-86386189 GAGGAAGAGGGAGGGGGAGGAGG - Intronic
1131076911 15:89501118-89501140 GAGGCAGAGGAAGCCGAAGAGGG - Intergenic
1131264295 15:90906560-90906582 AAGGCACAGGGATCGGCAGGGGG + Intronic
1131467611 15:92668072-92668094 GAGGGAGGGGGAACGGGAGGGGG + Intronic
1131545683 15:93313748-93313770 GAGAGAGAGGAAGCAGGAGGAGG - Intergenic
1131969941 15:97881768-97881790 GAGGCAGAGGCAGCAGGAGAGGG + Intergenic
1131990274 15:98086445-98086467 GAGGGAGAGGAAAAGGGAGGAGG + Intergenic
1132078600 15:98845408-98845430 GAGGAAGAGGGAGGGGGAGGAGG - Intronic
1132385550 15:101397736-101397758 AAGGCTGAGGAAGGGGGAGGAGG - Intronic
1202960298 15_KI270727v1_random:116114-116136 GAGGGAGAGGAATGGGAAGTTGG + Intergenic
1132495424 16:260989-261011 GAGGCAGGGGCTTCGAGAGGTGG + Intronic
1132581093 16:684967-684989 GGGGCAGTGGGGTCGGGAGGTGG - Intronic
1132664656 16:1076023-1076045 GAGGGAGAGGGAGGGGGAGGTGG - Intergenic
1132664702 16:1076133-1076155 GAGGGAGAGGGATGGGGAGGCGG - Intergenic
1132664743 16:1076254-1076276 GAGGGAGAGGGAGAGGGAGGGGG - Intergenic
1132751852 16:1461288-1461310 GAGTCAGAGGAGGAGGGAGGAGG + Intronic
1132819734 16:1858467-1858489 GAGGCCGAGCAGTGGGGAGGAGG - Intronic
1132998738 16:2838565-2838587 AAGGCAGAGGAGTTGGAAGGAGG + Intronic
1133365215 16:5203733-5203755 GAGGGAGAGGGAGAGGGAGGGGG + Intergenic
1133365219 16:5203739-5203761 GAGGGAGAGGGAGGGGGAGGGGG + Intergenic
1133392597 16:5422221-5422243 GAGGGAGAGGGAGAGGGAGGAGG + Intergenic
1133414683 16:5597239-5597261 GGTGCAGAGAAAGCGGGAGGGGG - Intergenic
1133626808 16:7577658-7577680 GAGGCAGAGGCAGAGGCAGGAGG + Intronic
1133883668 16:9806568-9806590 GAGGAAGAGAACTAGGGAGGAGG + Intronic
1133908119 16:10039766-10039788 GAGGGAGAGGGAGGGGGAGGGGG + Intronic
1134111026 16:11515735-11515757 GAGGAGGAGGAAAAGGGAGGAGG + Intronic
1134111037 16:11515773-11515795 GAGGAGGAGGAAAAGGGAGGAGG + Intronic
1134449399 16:14354221-14354243 GAGGAGGAGGAAGGGGGAGGGGG + Intergenic
1134884190 16:17775396-17775418 CAGGAAGATGAATGGGGAGGAGG - Intergenic
1135100657 16:19602513-19602535 GAGGGAGAGGAAGAGAGAGGAGG - Intronic
1135121712 16:19771862-19771884 GAGGCAGAGGTTTATGGAGGAGG + Intronic
1135496733 16:22958412-22958434 CAGACAGAGGAGTGGGGAGGAGG - Intergenic
1135636080 16:24076818-24076840 CAGGCAGAGGCATAGGGTGGGGG + Intronic
1135876928 16:26210647-26210669 GAGGCAGAGGCAGAGGCAGGTGG - Intergenic
1136160363 16:28415804-28415826 GAGGGAGAGGAAGAGGGAGAGGG - Intergenic
1136197962 16:28667019-28667041 GTGGGAGAGGAAGGGGGAGGGGG + Intergenic
1136259029 16:29061041-29061063 GTGGGAGAGGAAGGGGGAGGGGG + Intergenic
1136428595 16:30184606-30184628 GAGGCAGAGGTATGGGGAGGAGG + Intronic
1136451919 16:30358385-30358407 GAGGCTGAGGAGGCTGGAGGAGG + Exonic
1136535478 16:30896713-30896735 GAGTCAGAGGGATTGGGAGCTGG + Intronic
1136919214 16:34246902-34246924 GAGGGAGAGGAAGAGGGAGAGGG + Intergenic
1136919228 16:34246959-34246981 GAGGGAGAGGAAGAGGGAGAGGG + Intergenic
1137240974 16:46654149-46654171 GAGGGAGAGGAAGGGAGAGGGGG + Intergenic
1137249416 16:46731234-46731256 GGGGCACAGGATTGGGGAGGGGG + Intronic
1137260164 16:46820070-46820092 CATGCAGAGAAATAGGGAGGTGG - Intronic
1137486768 16:48897792-48897814 GATGCTGAGGAGTGGGGAGGAGG + Intergenic
1137523201 16:49211222-49211244 GAGGGAGAGGGACGGGGAGGGGG + Intergenic
1137637515 16:49999679-49999701 GAGGCAGGAGCATCGGGTGGGGG + Intergenic
1138025684 16:53520661-53520683 GAGGCAGAGGTTACAGGAGGCGG + Intergenic
1138153926 16:54685713-54685735 GAGGAAGAGGAAGAGGGAAGAGG - Intergenic
1138250760 16:55500009-55500031 GGGGCAGAGTAGTGGGGAGGAGG - Intronic
1138569847 16:57863056-57863078 TAGGCAGAGGAATGGGAGGGAGG - Intergenic
1138595496 16:58027064-58027086 GAGGCAGCGGACTCGGGTTGCGG + Intronic
1139165560 16:64561267-64561289 GAGGAAGAGGAAGAGGAAGGAGG + Intergenic
1139352017 16:66342836-66342858 CAGGAAGAGGAACGGGGAGGTGG - Intergenic
1139425063 16:66874057-66874079 GAGGTAGAGGAGGAGGGAGGAGG - Intergenic
1139744853 16:69066162-69066184 GAGTGAGAGGAAGAGGGAGGTGG - Intronic
1139946282 16:70644735-70644757 GAGGAAGAGGAGGAGGGAGGAGG + Intronic
1140037594 16:71383056-71383078 TAGCCAGAGGAATTTGGAGGTGG - Intronic
1140470543 16:75211758-75211780 AAGGCAGAGGACTTGGGAGCTGG + Intergenic
1140940602 16:79718437-79718459 GAAGAAGAGGAATATGGAGGAGG + Intergenic
1141243170 16:82281971-82281993 GAGGCAGTGGAAATGGGAGCTGG + Intergenic
1141456132 16:84144040-84144062 GAGGGAGAGGGAGGGGGAGGGGG - Intronic
1141456136 16:84144046-84144068 GAGGGAGAGGGAGAGGGAGGGGG - Intronic
1141578932 16:84983903-84983925 GAGGCAGAGCACCCGGGAGGTGG + Intronic
1141992445 16:87618295-87618317 GAGGAAGAGGAGGCAGGAGGAGG + Intronic
1142011628 16:87718344-87718366 GAGGGAGAGGGAGGGGGAGGGGG - Intronic
1142132141 16:88435979-88436001 GAGCCAGAGGCATCAGGAGTGGG - Exonic
1142825148 17:2506250-2506272 GAGGGAGAGGGAGGGGGAGGGGG - Intronic
1142849039 17:2695549-2695571 GAGGCAGAGGAGCTGGGTGGGGG - Intronic
1142949025 17:3463933-3463955 GAGGCAGAGGGAGAGGGAGAGGG - Intronic
1143476749 17:7207520-7207542 GAGGCGGAGGTAGGGGGAGGAGG + Intronic
1143483385 17:7239428-7239450 GAGGCAGTGGTAGAGGGAGGTGG - Exonic
1143512985 17:7405972-7405994 AAGGCAGAGGGATAGGGAGAAGG + Intronic
1143669989 17:8390131-8390153 GAGGCAGAGGAATGGTTAGTGGG - Intergenic
1143731638 17:8885582-8885604 GAGGCAGGGCCATGGGGAGGCGG - Intronic
1143731677 17:8885664-8885686 GAGGCAGGGCCATGGGGAGGCGG - Intronic
1143731764 17:8885862-8885884 GAGGCAGGGCCATGGGGAGGCGG - Intronic
1143731791 17:8885927-8885949 GAGGCAGGGCCATGGGGAGGCGG - Intronic
1144439983 17:15272651-15272673 GATGCAGAGGAACCTGGAGATGG + Intergenic
1144552802 17:16256422-16256444 GAGGCAGAGGAATCGGGAGGTGG - Intronic
1144590682 17:16521069-16521091 GAGGCAGAGGGATGGGGTGGAGG + Intergenic
1145268222 17:21390552-21390574 GGGGCACAGGGATGGGGAGGGGG + Intronic
1145775786 17:27527490-27527512 GAGGCAGGAGAATCGCCAGGAGG - Intronic
1145794842 17:27649605-27649627 GAGTCTGTGGAATCGGGCGGGGG + Intergenic
1145809335 17:27755324-27755346 GAGTCTGTGGAATCGGGCGGCGG + Intergenic
1146444684 17:32923811-32923833 GAGGGAGAGGGAGGGGGAGGGGG + Intergenic
1146652522 17:34615327-34615349 TAGGCAGAGGAATCGGGGAGGGG - Intronic
1146736550 17:35243339-35243361 GTGGCAGAGGACCCGGGAGCTGG + Intronic
1146762399 17:35490035-35490057 GAGGGAGAGGGAACAGGAGGTGG - Intronic
1146978258 17:37134999-37135021 GAGAGAGAGGAAAAGGGAGGGGG + Intronic
1147455905 17:40537961-40537983 GAGGCAGGAGAATCGGGAGGCGG + Intergenic
1147864049 17:43541438-43541460 GAGGCAGATGATTAAGGAGGGGG + Intronic
1147926693 17:43951031-43951053 GAGGCAGAGGAGGCAGGTGGAGG - Intergenic
1148071959 17:44913874-44913896 AAGGCTGAGGAATGGGGAGAAGG - Intronic
1148181597 17:45609741-45609763 GAGGCAGGGGGATCGGGAGACGG - Intergenic
1148267254 17:46235952-46235974 GAGGCAGGGGGATCGGGAGACGG + Intergenic
1148778643 17:50109753-50109775 GAGGGAGAGGGAGGGGGAGGAGG - Intronic
1148806392 17:50266185-50266207 CGGGCAGAGGAAGTGGGAGGAGG - Intergenic
1149573377 17:57693413-57693435 GAGGCAGAGGCAGAGGCAGGTGG - Intergenic
1149602635 17:57903206-57903228 GTGGCAGAGGAAGCATGAGGTGG - Intronic
1149612465 17:57967633-57967655 GAGGGAGAAGAATGGGGAGGGGG - Intergenic
1149627329 17:58089007-58089029 GAGGCTGAGGGATGGGGTGGGGG + Intronic
1149632843 17:58141787-58141809 GAGGGAGAGGAAGAGGGAGGGGG - Intergenic
1149674116 17:58443491-58443513 GAGGCAGAGGGCTCGAGAGCAGG - Intronic
1150455160 17:65301306-65301328 GGGGAAGTGGCATCGGGAGGGGG + Intergenic
1150477064 17:65483768-65483790 GAGGGAGAGGGAGAGGGAGGTGG - Intergenic
1150477934 17:65488439-65488461 GAGGCAGAGAGAGGGGGAGGGGG + Intergenic
1150747838 17:67830633-67830655 GAGGGAGAGGGAGCGGGAGCGGG + Intronic
1150816543 17:68396492-68396514 AAGGAAGAGGAAGCAGGAGGAGG + Intronic
1151603595 17:75122237-75122259 GAGGCAGAGAACCCCGGAGGTGG + Intronic
1151887468 17:76931727-76931749 GAGCCACAGGAATGAGGAGGCGG + Intronic
1152000092 17:77639935-77639957 GAGGAAGAGGAAGAAGGAGGAGG - Intergenic
1152019930 17:77775670-77775692 GAGGGAGAGGGAAGGGGAGGGGG - Intergenic
1152023217 17:77792698-77792720 GAGGCAGGGGACCCGTGAGGAGG + Intergenic
1152104623 17:78321828-78321850 GGGGCAGGAGAATTGGGAGGCGG - Intergenic
1152259945 17:79261464-79261486 GAGGCAGAGGATGCAGGTGGAGG + Intronic
1152299000 17:79484606-79484628 GAGGTAGAGGACTCAGGTGGAGG + Intronic
1152668959 17:81590013-81590035 GAGGCAGAGAGATGGGGAAGCGG + Intronic
1152769300 17:82157566-82157588 AAGGCGGAGGAATGGGGAGAGGG + Intronic
1152830236 17:82492739-82492761 GTGGCAGTGGATTTGGGAGGGGG + Intergenic
1153007840 18:513076-513098 GAGGGAGAGGGAGAGGGAGGGGG + Intergenic
1153575537 18:6516541-6516563 GAGGAAGAGGAGGAGGGAGGAGG + Intronic
1153770502 18:8412044-8412066 AAGGCTGAGGAAAAGGGAGGTGG + Intergenic
1154162239 18:11989303-11989325 GAGGAAGAGGAGGCAGGAGGGGG + Intronic
1154207000 18:12346061-12346083 GAGGCACAGGGATGTGGAGGAGG - Intronic
1154440378 18:14383531-14383553 GAGGGAGAGGAAGAGGGAGAGGG + Intergenic
1154452867 18:14492258-14492280 GAGGGAGAGGAATGGGAAGTTGG + Intergenic
1155066623 18:22274010-22274032 GAGGAAGAGGAGGAGGGAGGAGG - Intergenic
1155756261 18:29500408-29500430 GAGGTAGAGGAAATGGAAGGGGG + Intergenic
1156462100 18:37326826-37326848 GTGGCAGAGGGATGGGGAGGGGG - Intronic
1156674528 18:39511856-39511878 GAGGCAGAGGGAGAGGGAGAGGG + Intergenic
1157543670 18:48532125-48532147 GGGGCTGAGCAATGGGGAGGAGG - Intergenic
1157827171 18:50822851-50822873 GAGGCAGAGTGCTCGGCAGGTGG + Intronic
1158332110 18:56374497-56374519 GAGGCAGGGGAAGGAGGAGGAGG - Intergenic
1158446287 18:57524751-57524773 GAGGAAGAGGAAGGAGGAGGAGG + Intergenic
1158529664 18:58247615-58247637 GAGGCATACGAACCAGGAGGCGG - Intronic
1158610358 18:58935086-58935108 GAGGAGGAGGAGTGGGGAGGAGG - Intronic
1158610364 18:58935102-58935124 GAGGAGGAGGAGTGGGGAGGAGG - Intronic
1158610370 18:58935118-58935140 GAGGAGGAGGAGTGGGGAGGAGG - Intronic
1158610376 18:58935134-58935156 GAGGAGGAGGAGTGGGGAGGAGG - Intronic
1158610382 18:58935150-58935172 GAGGAGGAGGAGTGGGGAGGAGG - Intronic
1158610388 18:58935166-58935188 GAGGAGGAGGAGTGGGGAGGAGG - Intronic
1158894368 18:61899150-61899172 GAGAGAGAGAAATCGGGAGGAGG + Intergenic
1159079783 18:63724201-63724223 GAAGAAGAGGAAGAGGGAGGAGG - Intronic
1159615080 18:70570465-70570487 GAGGGAGAGGAAGAGGGAGAGGG + Intergenic
1160228582 18:77029430-77029452 GAGGGAGAGGGAGGGGGAGGGGG + Intronic
1160335073 18:78031531-78031553 GAGGCAGAGAAATGGGCTGGGGG - Intergenic
1160448661 18:78947073-78947095 GAGGAAGAGGAAGGAGGAGGAGG + Intergenic
1160804416 19:985735-985757 CAGGAAGAGGAGTCGGGAGCAGG - Intronic
1161168648 19:2802187-2802209 GAGGTGGAGGTATCGGGAGACGG - Intronic
1161643446 19:5437750-5437772 GAGGCAGTGGACTGGGGAGGGGG - Intergenic
1161684803 19:5697486-5697508 GAGGCTGAGGCAGAGGGAGGAGG + Intronic
1162035636 19:7937180-7937202 GAGGCAGGAGAATCAGGAGCTGG + Intronic
1162076581 19:8191949-8191971 GAGGAAGAGGAAGCAGAAGGAGG + Intronic
1162349020 19:10137699-10137721 AAGGCTGAGGACTCGGGAGGAGG + Intronic
1162728946 19:12706153-12706175 GGGGCACGGGGATCGGGAGGCGG + Intronic
1163097287 19:15068853-15068875 GAGGCAGGAGAATCGGGAGGCGG + Intergenic
1163501699 19:17680118-17680140 GAGGGAGGGGATTCGGGAAGGGG + Intronic
1163528515 19:17835847-17835869 GTGGAAGAGGAATTGGGAGTGGG - Intronic
1163688506 19:18725659-18725681 GAGGCTCAGGAAGAGGGAGGAGG - Intronic
1163690906 19:18737760-18737782 GAGGAGGAGGAAAAGGGAGGAGG - Intronic
1163779711 19:19239926-19239948 GAGGCAGAGGAATGGGAGGGAGG - Intronic
1163912936 19:20213855-20213877 GAGGGAGAGGGAGGGGGAGGCGG - Intergenic
1164897936 19:31893593-31893615 GAGGAAGAAGAAGGGGGAGGAGG + Intergenic
1165058417 19:33193733-33193755 GAGGCTGGGGACTTGGGAGGAGG - Intronic
1165077921 19:33291040-33291062 GAGGCAGAGGAACCCAGAGCAGG + Intergenic
1165170303 19:33887589-33887611 GAGGCAGAGTACTAGGGAGCTGG + Intergenic
1165200227 19:34137555-34137577 GAGGCAGGAGAACCAGGAGGAGG + Intergenic
1165306371 19:35005294-35005316 CAGGGAGGGGGATCGGGAGGCGG + Intronic
1165352308 19:35282446-35282468 GAGACAGAGCAAAGGGGAGGGGG + Intronic
1165361107 19:35337584-35337606 GAAGTAGAGGAAGTGGGAGGGGG + Intronic
1165416042 19:35694121-35694143 GAGGAAGAGGAAGAGGGAGGAGG - Intergenic
1166007329 19:39916522-39916544 GAGGGTGAGGACCCGGGAGGAGG - Intronic
1166075851 19:40413402-40413424 GGGGAAAAGGAATGGGGAGGGGG + Intergenic
1166184214 19:41128837-41128859 GAGGGAGAGGGAGAGGGAGGAGG + Intergenic
1166218763 19:41352656-41352678 GGGGCAGGGGAGCCGGGAGGGGG - Intronic
1166301735 19:41915083-41915105 GAGGCAAAGAGAGCGGGAGGTGG - Intronic
1166390462 19:42406426-42406448 GGGGCAGAGGCCTGGGGAGGAGG + Intronic
1166534378 19:43563111-43563133 GAGGCAGGGGAGTCAGCAGGAGG - Intronic
1166567962 19:43776571-43776593 GAGGCAGAGGAGTAAGAAGGTGG + Exonic
1166581769 19:43906987-43907009 GAGGCAGTGGGGTTGGGAGGGGG - Intergenic
1166591961 19:44007588-44007610 GGGCCAGAGGACTCAGGAGGTGG - Intronic
1166658591 19:44630137-44630159 GAGGAAGAGAAATCTGTAGGTGG + Intronic
1166824735 19:45601760-45601782 GAGGCAGGGGCAGAGGGAGGTGG + Intronic
1167175782 19:47863571-47863593 GCGGCAGAGGAAGCGAGACGCGG - Intergenic
1167248852 19:48390367-48390389 GAGGCAGAGGAGCCGGGTGTGGG - Intronic
1167629909 19:50619538-50619560 GAGGTAGGAGAATCGGGAGGCGG - Intergenic
1167686511 19:50960048-50960070 GAGGGAGAGGAGGGGGGAGGAGG + Intronic
1167726533 19:51217007-51217029 GAGGCAGAGGAGTCAAGCGGTGG + Intergenic
1167792043 19:51689182-51689204 GAGGAGGAGGGAGCGGGAGGGGG - Intergenic
1167913440 19:52721703-52721725 GAGGCAGAGGCAGAGGGAGAGGG + Intronic
1167913442 19:52721709-52721731 GAGGCAGAGGGAGAGGGAGAGGG + Intronic
1167924330 19:52810889-52810911 GAGGGAGAGGGAGGGGGAGGGGG - Intronic
1167924334 19:52810895-52810917 GAGGGAGAGGGAGAGGGAGGGGG - Intronic
1167937208 19:52918972-52918994 GAGGGAGAGGGAGAGGGAGGGGG - Intergenic
1167971237 19:53188584-53188606 GAGGGAGAGGGAGAGGGAGGGGG + Intronic
1168081126 19:54011342-54011364 GAGGCAGAAGAATCAGGAGGCGG + Intronic
1168096321 19:54117223-54117245 GAGGCAGAGGAAGTGGGGGGTGG + Intronic
1168257997 19:55177657-55177679 GAGGCACTGAAACCGGGAGGTGG - Intronic
1168288357 19:55345494-55345516 GAGGATGAGGATGCGGGAGGTGG + Intronic
1168387836 19:55980663-55980685 GAGGCAGAGGCAGAGGGAGATGG + Intronic
1168418693 19:56186281-56186303 GAGGCAGAGGGGTGGGTAGGTGG + Intergenic
1168561038 19:57383517-57383539 GAGGCAGAAGAATGGGATGGTGG - Intronic
925140604 2:1547394-1547416 GAGGCAGCGGAATTGGAATGGGG - Intergenic
925188767 2:1866739-1866761 GAGGCAGAGAGAGAGGGAGGGGG + Intronic
925927614 2:8681732-8681754 GAGGGAGAGGAGGAGGGAGGAGG - Intronic
926126922 2:10277647-10277669 CAGGCAGAGGCAGAGGGAGGAGG + Intergenic
926220865 2:10934724-10934746 GAGGCAGAGGGAGGGGCAGGTGG - Intergenic
926266821 2:11330824-11330846 GAGGGGGAGGAAGAGGGAGGAGG + Intronic
926266830 2:11330846-11330868 GAGGGGGAGGAAGAGGGAGGAGG + Intronic
926266837 2:11330872-11330894 GAGGAAGAGGAATGAGGAGGAGG + Intronic
926619488 2:15034134-15034156 GAGGGAGAGAAAGAGGGAGGAGG + Intergenic
926726878 2:16005320-16005342 GAGGGAGAGGGAGAGGGAGGGGG - Intergenic
926957752 2:18319980-18320002 GAAGCAGAAGCATGGGGAGGTGG + Intronic
927201984 2:20583618-20583640 GTGGCAAAGGAGTGGGGAGGAGG + Intronic
927509022 2:23632789-23632811 GTGGCAGAGGAATGGGGATTTGG - Intronic
927681835 2:25144870-25144892 AAGGCAGAGGGGTAGGGAGGTGG + Intronic
927809462 2:26173395-26173417 GGGCCAGAGGGATCGTGAGGAGG + Intronic
927847160 2:26477491-26477513 GAGGGAGAGGAAGCGGCTGGGGG + Exonic
927914022 2:26922833-26922855 GCGGCAGAGGAACCGGGAGAAGG - Intronic
928005625 2:27558903-27558925 GAGGGAGAGGGAGAGGGAGGGGG + Intronic
928114093 2:28533973-28533995 GAGACAGAGGATTAGGGAGGTGG - Intronic
929134207 2:38607215-38607237 GAGGCACAAGAATCAGGAGGCGG - Intergenic
929897763 2:45976469-45976491 GCGGCCGAGGAAGCGGCAGGGGG + Exonic
929981447 2:46683928-46683950 GAGTCAGAGGAATTGAGGGGAGG - Intergenic
930325582 2:49913236-49913258 GAGGCAGCGGAACAAGGAGGAGG + Intergenic
930363461 2:50411042-50411064 GAGGGAGAGGGACGGGGAGGGGG - Intronic
931166964 2:59758711-59758733 GAGGCAGAGGCATCAGTAGATGG - Intergenic
931263404 2:60639253-60639275 GAGGCAGGAGAACTGGGAGGCGG - Intergenic
932230291 2:70078068-70078090 GAGGCAGGAGACCCGGGAGGCGG + Intergenic
932330132 2:70894071-70894093 GAGGCAAAGGGAGGGGGAGGTGG + Intergenic
932396488 2:71452504-71452526 GAGGAAGAGGAAGAGGAAGGGGG - Intergenic
932487087 2:72090778-72090800 GAGGCAGAGGAAGGGGCAGGAGG - Intergenic
933399542 2:81776662-81776684 AAGGCAGAGGAAGCTGGAGTTGG + Intergenic
934653268 2:96104234-96104256 GAGGGAGAGGAAGGAGGAGGAGG - Intergenic
935189842 2:100768330-100768352 GTGGCAGAGAAATGGGCAGGCGG + Intergenic
935308414 2:101759670-101759692 GGGGGAGGGGAATGGGGAGGGGG - Intronic
935543207 2:104373839-104373861 GAGGAAGAGGAATGAGCAGGAGG - Intergenic
935598324 2:104897095-104897117 GAAGTAGAGGAATTGGGAAGGGG + Intergenic
935714778 2:105930330-105930352 GAGGGAGAGGACCTGGGAGGTGG + Intergenic
936025680 2:109029403-109029425 AAGGCATGGGAATCTGGAGGTGG + Intergenic
936650570 2:114421880-114421902 GAAGCAGAGGCATCTGGAGTGGG + Intergenic
936889413 2:117351461-117351483 GATGCAGAAGAAGCGGGAGAAGG + Intergenic
937298959 2:120826856-120826878 GAGACAGAGGAAGCGGGAGCCGG - Intronic
937422797 2:121772561-121772583 GTGGCAGAGGAAGCTGAAGGGGG - Intergenic
937623561 2:124017978-124018000 GAGGCAGAGGTTGCAGGAGGTGG - Intergenic
938157248 2:128952119-128952141 GAGGCAGAGGCAGTGAGAGGGGG - Intergenic
938380059 2:130831585-130831607 GAGGCAGGGGAAGAGGCAGGAGG - Intergenic
938680597 2:133685919-133685941 GAGGCAGAGGAAGAAGCAGGGGG + Intergenic
938750991 2:134329938-134329960 AAAGTAGAGGAATCGGGAGTTGG + Intronic
938805265 2:134801470-134801492 GAGGCAGGAGAATGGGGAGGCGG - Intergenic
939075407 2:137596709-137596731 GAGGAAGAGGAGGGGGGAGGAGG - Intronic
940261173 2:151780983-151781005 GAGGGAGAGGTAGGGGGAGGGGG + Intergenic
940346920 2:152637853-152637875 GAGGCAGAGGACTGGCTAGGTGG - Intronic
940453730 2:153871860-153871882 GAGGAGGAGGGACCGGGAGGCGG + Intergenic
940945634 2:159615322-159615344 GAAGCAGAGGAGTTGGGAGCTGG + Intronic
941038209 2:160590555-160590577 GGGGAAGAGGAAGGGGGAGGGGG - Intergenic
941128052 2:161610748-161610770 GAGGCATAGGAATCTGGCGTAGG + Intronic
941223501 2:162814995-162815017 GAGGCAGAAAAAAGGGGAGGAGG - Intronic
941265660 2:163358407-163358429 GCTGCAGAGGAGTGGGGAGGGGG + Intergenic
941751687 2:169141311-169141333 AAGGCAGAGGAAGAGGGATGAGG - Intronic
941814994 2:169787355-169787377 GAGGGAGAGGGAGGGGGAGGGGG + Intergenic
942199449 2:173556362-173556384 GAGGAGGAGGAAGGGGGAGGAGG - Intergenic
942312714 2:174670291-174670313 CAGGGAGAGGAAAAGGGAGGAGG - Intronic
942418812 2:175786487-175786509 GAGGCAGAGGATGGAGGAGGAGG + Intergenic
942531762 2:176917625-176917647 GGGGCAGGGGACTGGGGAGGTGG + Intergenic
942580813 2:177414056-177414078 GAGGCACAGGAAAGGGGCGGGGG - Intronic
943100151 2:183478495-183478517 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
944205444 2:197153273-197153295 GAGGAAGAGGAAGAAGGAGGAGG + Intronic
944675522 2:202032498-202032520 GAGACAGAGGAAAGAGGAGGAGG + Intergenic
944815764 2:203373495-203373517 GAGGGAGAGGGAGCGGGAGAGGG + Intronic
945232768 2:207609791-207609813 GAGGGAGAGGGAGAGGGAGGGGG - Exonic
945530634 2:210950112-210950134 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
945530638 2:210950118-210950140 GAGACAGAGGGAGAGGGAGGGGG - Intergenic
945925195 2:215796259-215796281 GAGGGAGAGGGAGTGGGAGGAGG - Intergenic
946001490 2:216486151-216486173 GAGGCAGAAGAATCGCCTGGAGG - Intergenic
946313891 2:218897290-218897312 GAGGCAGCAGAAAGGGGAGGGGG + Intronic
946408958 2:219507131-219507153 GAGGCTGAGGCAGTGGGAGGGGG - Intergenic
946677532 2:222177737-222177759 GATGAAGAGGAATAGGGAGAGGG + Intergenic
947181811 2:227418004-227418026 GACTCAGAGGAATGGGTAGGAGG - Intergenic
948404405 2:237706384-237706406 GGGGCAGAGGAACAGAGAGGAGG - Intronic
948430163 2:237913635-237913657 GAGGGCGAGGAGACGGGAGGTGG + Intergenic
948795984 2:240402302-240402324 GGGGCAGAGGAAGGTGGAGGCGG - Intergenic
948995816 2:241577676-241577698 GAGACAGAGGAAAGGGGAGGAGG + Intergenic
1168975421 20:1962240-1962262 GAGGCAGAGGAATGGGCATGTGG + Intergenic
1169026983 20:2379936-2379958 GAGGAAGGGGAAGTGGGAGGGGG - Intergenic
1169211673 20:3769159-3769181 GAGGCGGAGGAGGCAGGAGGGGG - Intergenic
1169449702 20:5701334-5701356 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
1169564717 20:6841397-6841419 GAGGCAGAGAGATTTGGAGGAGG + Intergenic
1170696963 20:18667795-18667817 GAGGCAGAGGCGTGGGGAGAAGG - Intronic
1171023052 20:21603861-21603883 TCGGTAGAGGAATAGGGAGGTGG - Intergenic
1171213881 20:23337671-23337693 GAGACAGAGGTATGGGGAGTTGG + Intergenic
1171848662 20:30292671-30292693 GAGGGAGAGGGAGGGGGAGGGGG + Intergenic
1172058871 20:32175344-32175366 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
1172292144 20:33784157-33784179 GAGGGAGAGGAGTAGGGAGAGGG - Intronic
1172329183 20:34062852-34062874 AAGGCATAGGAATGGGGCGGGGG + Intronic
1172651513 20:36505881-36505903 GAGGAAGAGGAATGGGGAAGAGG + Intronic
1172941722 20:38658991-38659013 GAGGTGGAGGACTTGGGAGGTGG - Intergenic
1172957270 20:38769831-38769853 GAGGAAGAGGAGTGGGGAGCAGG + Intronic
1173869525 20:46332666-46332688 GGGGCAGGGGAATAAGGAGGGGG + Intergenic
1174114596 20:48218272-48218294 GTGGCAGAGGAAGGGCGAGGAGG - Intergenic
1174146389 20:48455393-48455415 GGGGCAGGGGCATCGGGAGGGGG + Intergenic
1174151441 20:48489073-48489095 GGAGCAGAGGAATCAGAAGGGGG + Intergenic
1174174689 20:48637369-48637391 GGGGAAGAGGAAGGGGGAGGAGG - Intronic
1174394533 20:50238622-50238644 GAGACAGAGGAAGCGGGCGGTGG - Intergenic
1174960538 20:55151814-55151836 GAGGGAGAAGAAGAGGGAGGAGG - Intergenic
1175010112 20:55726308-55726330 GAGGGTGAGCAATGGGGAGGTGG + Intergenic
1175225534 20:57441870-57441892 TGGGCAGAGGAATGGGCAGGGGG + Intergenic
1175335861 20:58195941-58195963 GATTCAGAGGAGTCGAGAGGAGG - Intergenic
1175370341 20:58483944-58483966 GAGGCAGAGGCCAGGGGAGGGGG + Intronic
1175668690 20:60882560-60882582 GAGACAGAGGATTCTGGATGGGG - Intergenic
1175921324 20:62451762-62451784 GAGGGAGAGGAAGAGAGAGGGGG + Intergenic
1176227170 20:64007372-64007394 GAGGCAGAGGGGAGGGGAGGCGG - Intronic
1176443172 21:6796023-6796045 GAGGGAGAGGAATGGGAAGTTGG - Intergenic
1176821339 21:13661066-13661088 GAGGGAGAGGAATGGGAAGTTGG - Intergenic
1178077198 21:29023167-29023189 GAGGTGGGAGAATCGGGAGGTGG + Intergenic
1178824666 21:36005030-36005052 GAGGGAGAGGCAGGGGGAGGGGG + Intergenic
1178974712 21:37210886-37210908 GAGGGAGAGGGAGAGGGAGGGGG + Intergenic
1178974716 21:37210892-37210914 GAGGGAGAGGGAGGGGGAGGGGG + Intergenic
1179034922 21:37751410-37751432 CAGGGAGAGCAAACGGGAGGTGG + Intronic
1179129199 21:38619337-38619359 GAGCAAGAGGAATAGAGAGGAGG - Intronic
1179129208 21:38619374-38619396 GAGTAAGAGGAATAGAGAGGAGG - Intronic
1179133681 21:38661028-38661050 GAGGAAGAGGAGGAGGGAGGCGG + Intronic
1179366656 21:40765170-40765192 GAGGCAGAGGAAGTAGGAGAGGG + Intronic
1179417660 21:41211164-41211186 GGGGGAGAGGGATGGGGAGGGGG - Intronic
1179474983 21:41637298-41637320 GAGGCAGATGAAAGGGGAGAGGG - Intergenic
1179636889 21:42718004-42718026 GAGGCAGGAGAATCAGGAGGCGG - Intronic
1179714475 21:43280282-43280304 GAGGTAGAGGGAAGGGGAGGTGG + Intergenic
1179714572 21:43280510-43280532 GAGGAAGAGGGAAGGGGAGGTGG + Intergenic
1180162857 21:46006019-46006041 GGGGCAGAGGCAGCGGGTGGTGG + Intergenic
1180835716 22:18928557-18928579 GAGGCAGAGGGTTGGGGAGCTGG - Intronic
1180963703 22:19774815-19774837 GGGGGAGAGGAATGGGGAGTTGG + Intronic
1181165022 22:20978631-20978653 AAGGCAGAGGAAAGGGGAGATGG - Intronic
1181431228 22:22882964-22882986 GAGGGAGAGGGAGGGGGAGGGGG - Intronic
1181585927 22:23853802-23853824 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
1181585931 22:23853808-23853830 GAGGGAGAGGGAGAGGGAGGGGG - Intergenic
1181711851 22:24696155-24696177 GAGGAGGAGGAATGGGAAGGAGG - Intergenic
1181886085 22:26023508-26023530 GAGGAAGAGGAGGAGGGAGGAGG - Intronic
1181961155 22:26622637-26622659 TAGGAAGAGGCATGGGGAGGGGG + Intronic
1182275641 22:29186870-29186892 GAGGCTGAGGAGTGGGGTGGGGG + Intergenic
1182395912 22:30035819-30035841 GAGGCAGAAGAACTGGCAGGAGG - Intergenic
1182886393 22:33777632-33777654 GAGGGAGGGGAAGGGGGAGGGGG + Intronic
1183305109 22:37078691-37078713 GAGGAAGAGGAAGAGGAAGGAGG + Intronic
1183305111 22:37078697-37078719 GAGGAAGAGGAAGGAGGAGGCGG + Intronic
1183501090 22:38179684-38179706 GAGGCAGGAGAATCAGGAGGTGG + Intronic
1183595035 22:38806307-38806329 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
1184327183 22:43797820-43797842 GAGGCAGAGGGAGCCGGGGGAGG - Intronic
1184409315 22:44317507-44317529 GAGGCAGATGAGGTGGGAGGAGG - Intergenic
1184449795 22:44576083-44576105 GAGGAAGAGGAGGAGGGAGGAGG + Intergenic
1184449801 22:44576102-44576124 GAGGTAGAGGAGGAGGGAGGAGG + Intergenic
1203285805 22_KI270734v1_random:153856-153878 GAGGCAGAGGGTTGGGGAGCTGG - Intergenic
949250090 3:1973161-1973183 GAGGGAGAGGAGGAGGGAGGGGG + Intergenic
949597727 3:5565511-5565533 GAGGAAGAGGAATCAGGGGGAGG - Intergenic
950061938 3:10078860-10078882 GAGGCTGAGGCATGGGGAGGAGG + Intronic
951158360 3:19383466-19383488 GAGGCAGAAGAATCGCTTGGAGG - Intronic
951208314 3:19947220-19947242 GAGGCAGAGGGAGGAGGAGGAGG + Exonic
951793695 3:26515433-26515455 GAGGGAGAGGGAGAGGGAGGGGG - Intergenic
952635342 3:35522626-35522648 GAGGCAGAGGAGGCAGGAGACGG - Intergenic
952646658 3:35667895-35667917 GAGGAAGAGGAAGAGGAAGGAGG + Intronic
952646660 3:35667901-35667923 GAGGAAGAGGAAGGAGGAGGAGG + Intronic
952878839 3:37970540-37970562 AAGACAGAGGAAGTGGGAGGAGG - Intronic
953005284 3:38971958-38971980 GAGGCAGAGAGGTAGGGAGGGGG + Intergenic
953139461 3:40214032-40214054 GTGGCAGAGGAGTGGGGAAGTGG - Intronic
953565452 3:44028311-44028333 GAGACAGAGGGATCAGAAGGAGG - Intergenic
953626530 3:44576860-44576882 GAGGCAGAGAACTTGGAAGGAGG - Intronic
954076845 3:48187972-48187994 GAGGCAGAGGAAGAGGGAGCGGG - Exonic
954216387 3:49126788-49126810 GGGTCAGAGGAAGCGTGAGGTGG - Intronic
954290770 3:49648870-49648892 CAGGCAGAGGAATGGGGCAGTGG - Intronic
954397330 3:50299638-50299660 GAGGCAGAGCCAGCTGGAGGCGG - Intergenic
954567246 3:51608860-51608882 GAGGCAGAGGGAGGGGCAGGGGG + Intronic
954629713 3:52041232-52041254 GAGGCAGTGGGACCCGGAGGAGG - Intergenic
954634332 3:52063414-52063436 GAGGCAGAGGCCTGGAGAGGAGG - Intergenic
954876534 3:53806212-53806234 AAGGGAGAGGAAGGGGGAGGAGG - Intronic
955940984 3:64146955-64146977 GAGGAAGAGGAAGAGGAAGGGGG - Exonic
956061201 3:65349791-65349813 CAGGGAGAGGAATCTGTAGGTGG + Intergenic
956822417 3:72965787-72965809 GGGGTAGAGGAGTAGGGAGGGGG + Intronic
957762638 3:84578162-84578184 GAGGAAGAGGAAGGAGGAGGAGG + Intergenic
958644755 3:96855488-96855510 GAAACAGAGAAATCAGGAGGTGG + Intronic
958877739 3:99635050-99635072 GAGGCTGAGAAATGGAGAGGAGG - Intergenic
959674987 3:109024676-109024698 GAGGAAGAGAAAACAGGAGGTGG + Intronic
960344726 3:116518631-116518653 GAGGGAGAGGGAGGGGGAGGGGG - Intronic
960344730 3:116518637-116518659 GAGGGAGAGGGAGAGGGAGGGGG - Intronic
960697894 3:120413791-120413813 GAGGGAGAGGGAGGGGGAGGGGG - Intronic
962120662 3:132556956-132556978 GGAGCAGAGGAAAGGGGAGGGGG - Intergenic
962385381 3:134928551-134928573 GAGTCAGAGGACACAGGAGGAGG + Intronic
962872461 3:139509590-139509612 AAGGCAGTGGAATGGAGAGGAGG - Intergenic
963796474 3:149635596-149635618 GAGGAAGCGGAAGAGGGAGGAGG + Intronic
963938871 3:151081443-151081465 AAGGCAGGGGAAGTGGGAGGGGG - Intergenic
964374434 3:156035595-156035617 GAGGAGGAGGAAGCAGGAGGGGG - Intergenic
964606487 3:158565628-158565650 GAGGCAGGGAACCCGGGAGGCGG + Intergenic
964835091 3:160929484-160929506 GAGGGAGAGGAAAAGAGAGGGGG + Intronic
964943961 3:162195607-162195629 GCAGCAGAGGAATCAGGATGAGG - Intergenic
965369802 3:167847722-167847744 GAGGCAGAGGCAGAGGCAGGAGG + Intergenic
966022458 3:175232147-175232169 GAGGAAGAAGAAGGGGGAGGAGG + Intronic
966686262 3:182698921-182698943 GAGGCTGAGGACCCAGGAGGTGG + Intergenic
966913408 3:184571617-184571639 GAGGGAGAGGGAGCGGGAGCTGG - Intronic
966981348 3:185139109-185139131 GAGGGAGAGGGAGCAGGAGGGGG + Intronic
967332836 3:188309089-188309111 GAGGCAGAGGATGCAGGAGCAGG - Intronic
967578684 3:191125779-191125801 GAGGGAGAGGGAGGGGGAGGGGG + Intergenic
967815073 3:193791554-193791576 GAGTCAGAAGAAACGGGAGTAGG - Intergenic
967879758 3:194293176-194293198 GTGGCAGAGGAAACGGCAGAGGG + Intergenic
968042595 3:195600502-195600524 GAGGGAGAGGAAGAGGGAGAGGG + Intergenic
968309683 3:197673243-197673265 GAGGCAGAGGAATCAAGGGCAGG + Intronic
968339313 3:197941471-197941493 GAGGGAGGGGAAGGGGGAGGGGG - Intronic
968448619 4:664717-664739 GAGGCACAAGAATCGGGAGGCGG + Intronic
968647801 4:1749003-1749025 GAGGGAGAGCAGTGGGGAGGGGG - Intergenic
968653008 4:1767425-1767447 GAGGGAGAGGGAGGGGGAGGAGG - Intergenic
968952044 4:3700306-3700328 GAGGGGGAGGAAGTGGGAGGAGG + Intergenic
969223102 4:5774114-5774136 GAGGCACAGGACTAGTGAGGGGG - Intronic
969454697 4:7294649-7294671 GAGGGAGAGGAAGAGGGAGAGGG - Intronic
969454843 4:7295027-7295049 GAGGGAGAGGAGGGGGGAGGAGG - Intronic
969511393 4:7620040-7620062 GAGGAAGAGGAAGGAGGAGGAGG - Intronic
970306528 4:14738217-14738239 GAGGCAAAGAAATGGGGAGGTGG - Intergenic
970386540 4:15562542-15562564 GAGGAGGAGGTATAGGGAGGAGG - Intronic
970409057 4:15790169-15790191 GAGGGAGAGGGAGGGGGAGGGGG - Intronic
970495076 4:16616995-16617017 GGGGGAGAGGAAAGGGGAGGAGG - Intronic
970805442 4:20025034-20025056 GAGGCAGGGAAATCATGAGGTGG - Intergenic
970982144 4:22111433-22111455 AAAGCAGAGGAATGGGGAGATGG + Intergenic
971852841 4:32005865-32005887 GAGGAAGAGGAAGAAGGAGGAGG - Intergenic
972080948 4:35148104-35148126 TAGGGAGAGGAATATGGAGGGGG + Intergenic
972205351 4:36765479-36765501 GAGACAGAGTACTAGGGAGGAGG + Intergenic
972270890 4:37509981-37510003 GAGGGAGAGGGAGGGGGAGGGGG + Intronic
972518419 4:39831193-39831215 GAGGCAGAAGAATTGCCAGGAGG - Intronic
972653967 4:41048643-41048665 GAGGGAGAGGGAGGGGGAGGGGG - Intronic
973289314 4:48454670-48454692 GAGGTAGATGAAGCGGGTGGGGG - Intergenic
973343881 4:49033277-49033299 TAGGCAGAGGAATCTGGAAGAGG + Intronic
973711336 4:53632899-53632921 GAGGAAGTGTAATCAGGAGGAGG - Intronic
973752166 4:54032271-54032293 GAGGGAGAGGGAGGGGGAGGGGG - Intronic
973830631 4:54755694-54755716 GAGATAGAGGAAAGGGGAGGAGG - Intergenic
973960089 4:56101037-56101059 GAGGCAGTAGAATAGGGAAGTGG + Intergenic
975344744 4:73281411-73281433 AAGGCAGAGGATTCTGGAGCAGG + Intergenic
975471394 4:74773006-74773028 GAGGCAGAGTACTGGGGCGGAGG + Intronic
975769765 4:77708523-77708545 GGGGCACAGGAAGAGGGAGGAGG - Intergenic
975818498 4:78244886-78244908 GAGGCAGAAGACTCAGGTGGGGG - Intronic
976398440 4:84582724-84582746 GAGGCTGAGGAGCTGGGAGGCGG - Intergenic
976595242 4:86889670-86889692 GAGGCAGAGGCAGAGGCAGGAGG + Intronic
976674494 4:87689474-87689496 GAGGCAGGTGAATCACGAGGTGG - Intergenic
977135838 4:93303084-93303106 GAGGAAGAGGAAACAGGGGGAGG + Intronic
977704815 4:100059537-100059559 GAGGCCAAGAAATCGAGAGGTGG - Intergenic
978420829 4:108531129-108531151 GAGGCAGAGGAATGAGGGAGGGG + Intergenic
978888553 4:113795851-113795873 GAGGGAGAGGGAGCGGGAGAGGG - Intergenic
979482687 4:121237904-121237926 GAGGGAGAGGAAGCGGGAGAGGG - Intergenic
980731961 4:136835389-136835411 GATGCAGAGGAATTGTGATGTGG - Intergenic
980829727 4:138115320-138115342 GAGGGAGAGGAATAGAGAAGAGG + Intergenic
981616091 4:146646489-146646511 GAGGGAGAGGAAGAGAGAGGAGG - Intergenic
981970200 4:150658611-150658633 GAGGCAGAGGGAGAGGGAGAGGG - Intronic
982334235 4:154215513-154215535 GAGGCAGTGGGATGGGGAGGAGG + Intergenic
983835425 4:172377902-172377924 GAGGAAGAGGCATGGGGGGGGGG - Intronic
983906209 4:173184622-173184644 GAGGGAGAGGGAGGGGGAGGGGG + Intronic
984525053 4:180848780-180848802 GAGGCAGGAGAATCGGGAGGCGG - Intergenic
984786656 4:183573488-183573510 GAGGAAGAGGGAGAGGGAGGAGG + Intergenic
985117389 4:186605405-186605427 GAGGAAGTGGAGTAGGGAGGAGG + Intronic
985763364 5:1763321-1763343 AAGGACGAGGAAACGGGAGGAGG - Intergenic
986009653 5:3700723-3700745 GAGGAAGAGGAAGAGGGAGGAGG - Intergenic
986043156 5:4012380-4012402 GAGGCAGAGGGTTCTGGAGGAGG + Intergenic
986063681 5:4215365-4215387 GAAGAAGAGGAAGCAGGAGGAGG - Intergenic
986085252 5:4438334-4438356 GAGGAAGAGGAAGAGGAAGGAGG + Intergenic
986085254 5:4438340-4438362 GAGGAAGAGGAAGGAGGAGGAGG + Intergenic
986391068 5:7288827-7288849 GAGGCAGAGGGAGAGGGAGAGGG - Intergenic
986391070 5:7288833-7288855 GAGGCAGAGGCAGAGGGAGAGGG - Intergenic
986572874 5:9183134-9183156 GAGGGAAAGGAATAGGGAGCAGG + Intronic
987013050 5:13787121-13787143 GAGGCAGGAGAATCGTCAGGAGG + Intronic
987185101 5:15409219-15409241 GAGGCAGGAGAATCGGCAGGAGG + Intergenic
987325218 5:16806251-16806273 GAGGTAGAAGAATCGGGAGGTGG + Intronic
987557171 5:19468028-19468050 GAGGCAGGGGAAACTGCAGGAGG - Intergenic
987910169 5:24132488-24132510 GTGGGAGAGGGATGGGGAGGGGG + Intronic
988255775 5:28818409-28818431 GAGGAAGAGGAAGAAGGAGGAGG + Intergenic
988501844 5:31790192-31790214 GAGGCAGGAGACTCAGGAGGTGG - Intronic
988526975 5:31995737-31995759 GAGGCAGAGGGATGGGGGAGAGG - Intronic
988538695 5:32090226-32090248 GAGGCAAAGGCATCCAGAGGTGG + Exonic
988608781 5:32705548-32705570 GAGGAAGAGGGATGGGGAGGGGG + Intronic
988888648 5:35589146-35589168 GAGGAAGAGGAAGGGTGAGGAGG - Intergenic
988895203 5:35664798-35664820 GAGGGAGAGGAAGAGGGAGAGGG + Intronic
988917117 5:35905667-35905689 GAGGCTGAGGAATCCAAAGGAGG - Intronic
989173777 5:38500076-38500098 GAGGCTGAGGGATAAGGAGGGGG - Intronic
989556819 5:42806599-42806621 GAGGAAGAAAAATCAGGAGGTGG + Intronic
990235900 5:53766840-53766862 CAGCCAGAGGAATCACGAGGTGG + Intergenic
990501261 5:56398645-56398667 GAGGGAGAGGGAGAGGGAGGGGG + Intergenic
990501265 5:56398651-56398673 GAGGGAGAGGGAGGGGGAGGGGG + Intergenic
991687351 5:69193746-69193768 GAGGCAGTGAATCCGGGAGGCGG - Intronic
991718854 5:69477098-69477120 GGGGCAGAGGAATCAGATGGAGG - Intergenic
991930547 5:71749427-71749449 GATGCAGAGGAAGCAGCAGGAGG - Intergenic
991944206 5:71883783-71883805 GAGGCAGAGTAAGAGGGAAGGGG + Intergenic
992522835 5:77573787-77573809 GAGGCAGAGGTATTGGAAAGGGG - Intronic
995055022 5:107749476-107749498 GAGGAAGAAGAAGAGGGAGGAGG + Intergenic
995347568 5:111138037-111138059 AAAGCAGAAGAATCGGGAGGCGG + Intergenic
995675995 5:114663237-114663259 GAGGGAGAGGAAGAGTGAGGAGG + Intergenic
996398063 5:123032942-123032964 GAGGTAGAGGAAGAGGGAGGAGG + Intronic
997125668 5:131224585-131224607 GAGGAAGAGAGATAGGGAGGAGG - Intergenic
997429128 5:133825416-133825438 GAGGCAGAGGAATTGCAATGAGG - Intergenic
997455920 5:134017367-134017389 GAGGCAGGAGAACCTGGAGGTGG + Intergenic
997554761 5:134786373-134786395 CAGGCAGGGGAAGAGGGAGGAGG - Intronic
997718904 5:136062532-136062554 GAGGAAGAGGAAGGGGAAGGTGG - Intronic
998153730 5:139772120-139772142 GAGGCAGAGGGAGTGGGAGTGGG + Intergenic
998205501 5:140154339-140154361 GAGGCAGAGCAAGCAGGAGTGGG - Intergenic
998367076 5:141638451-141638473 GAGGCAGAGGTGTGGGGAGAAGG - Intronic
998522903 5:142816885-142816907 GAGGCAGGAGCAGCGGGAGGGGG + Intronic
998527169 5:142853291-142853313 GAGGCAGAGGTAGGGGTAGGGGG - Intronic
998549445 5:143063320-143063342 CAGCCAGAGCAATAGGGAGGAGG - Intronic
998773591 5:145573487-145573509 CGGGCAGAGGAAAGGGGAGGGGG - Intronic
998790152 5:145757722-145757744 GAGGCAGAGGCAGAGGCAGGAGG + Intronic
999200208 5:149810800-149810822 GAGGCTGAGAAAGCGGGAAGAGG - Intronic
999336035 5:150717579-150717601 AAGGTAGAGGAATCTAGAGGAGG + Intronic
999408091 5:151324952-151324974 CAGAGAGAGGAGTCGGGAGGTGG - Intronic
1000385224 5:160669035-160669057 GAGTCAGAGGATTTGGGAGAAGG - Intronic
1001654394 5:173338493-173338515 GAGGCAGAAGAAAAGCGAGGCGG + Intergenic
1001684459 5:173583057-173583079 GAGGCAGAGGGAATTGGAGGAGG - Intergenic
1002594312 5:180312175-180312197 GAGGCTGAGGACCAGGGAGGCGG + Intronic
1002765593 6:235998-236020 GAGGGAGAGGAAGAGGGAGAGGG - Intergenic
1003125953 6:3356077-3356099 GAGGGGGAGGAGGCGGGAGGAGG + Intronic
1003406755 6:5832554-5832576 GAGGAAGAGGAGGGGGGAGGGGG + Intergenic
1003593443 6:7454888-7454910 GAGGGAGGGAAAACGGGAGGAGG - Intergenic
1003863593 6:10343790-10343812 GAGGCAGGGGAACAGGTAGGGGG - Intergenic
1005063776 6:21798390-21798412 GAGGGAGAGGGAGAGGGAGGGGG + Intergenic
1005865170 6:29932029-29932051 GAGGCAGAGGGAGAGGGAGAGGG - Intergenic
1005922891 6:30416915-30416937 GAGACAGAGGGATGGGGATGAGG - Intergenic
1005929649 6:30474458-30474480 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
1005986756 6:30880784-30880806 GAGGCAGAGGAAACAGAAAGCGG - Intronic
1006014355 6:31068095-31068117 GAGGGAGAGGGAGAGGGAGGGGG + Intergenic
1006014782 6:31071509-31071531 GAGGCCGAGGAGGCGGGCGGAGG + Intergenic
1006389173 6:33748528-33748550 GAGGCAGAGGCAGAGGCAGGAGG + Intergenic
1006593916 6:35179013-35179035 AAGGCAGAGGAGCCTGGAGGAGG + Intergenic
1006883979 6:37364838-37364860 GAGGCAGAGGTTTGGGGAGCCGG - Intronic
1006984589 6:38168274-38168296 AAGGCAGAGGAAGCGAGCGGGGG + Intergenic
1007116400 6:39346103-39346125 GAGGGAGAGGGAGAGGGAGGGGG - Intronic
1007236291 6:40393118-40393140 GAGACAGAGGAGAGGGGAGGAGG + Intronic
1007258563 6:40545739-40545761 GAGGCAGAGGCACTTGGAGGAGG + Intronic
1007651332 6:43424613-43424635 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
1007697044 6:43740566-43740588 AAGGCAGTGGAGTGGGGAGGAGG + Intergenic
1007817637 6:44535671-44535693 GAGGCAGGGGGATCTGTAGGTGG + Intergenic
1009869338 6:69434065-69434087 GAGGGAGAGGGAGAGGGAGGGGG + Intergenic
1009869342 6:69434071-69434093 GAGGGAGAGGGAGGGGGAGGGGG + Intergenic
1010456653 6:76064020-76064042 GAGGCACAGGAATGGAGAGGGGG + Intronic
1010887399 6:81261813-81261835 GAAGCAGAGGAAGGAGGAGGAGG + Intergenic
1010887423 6:81261882-81261904 GGGGAAGAGGAAGGGGGAGGGGG + Intergenic
1011547851 6:88500445-88500467 AAGGCAGATGAACCTGGAGGTGG - Intergenic
1011651569 6:89511150-89511172 GAGGAAGAGGAATCGGGCTGTGG - Intronic
1011883132 6:92057426-92057448 AAGGCAGAGGTGTTGGGAGGTGG - Intergenic
1011936151 6:92780593-92780615 GAGGGAGAGGAAGAGGGAGAAGG - Intergenic
1012422425 6:99079411-99079433 GAGGGAGAGGGATGGGGAGAGGG - Intergenic
1012998363 6:105995111-105995133 AAGGCAAGGGAATGGGGAGGAGG - Intergenic
1013056572 6:106589139-106589161 GAGGAAGAGGAAGAGGAAGGAGG + Intronic
1013056574 6:106589145-106589167 GAGGAAGAGGAAGGAGGAGGAGG + Intronic
1013200772 6:107893300-107893322 GAGGTAGAGGGATGGGGAGATGG + Intronic
1013449516 6:110265868-110265890 GAGGAAGAGGAAGAAGGAGGAGG - Intronic
1013677562 6:112482623-112482645 GAGGAAGAAGAAACTGGAGGTGG + Intergenic
1014242411 6:119032514-119032536 GAGGAAGAGGAAGAGGGAGAGGG + Intronic
1014405339 6:121043785-121043807 GAGGCAGAGGAAAAGAGAGAAGG - Intergenic
1014561915 6:122901184-122901206 GAGGAAGAGGAAGAAGGAGGAGG - Intergenic
1015101697 6:129489302-129489324 GAGGCAGAGGACAAGGGAGAAGG - Intronic
1015366467 6:132401823-132401845 GAGGCAGAGGGAAAAGGAGGAGG + Intergenic
1015452000 6:133380843-133380865 GAGGAAGAGGAACAAGGAGGAGG - Intronic
1015522337 6:134144044-134144066 GAGGCAGGAGAATCGGGAGGTGG + Intergenic
1015643867 6:135364911-135364933 GAGGAAGAGGAAGAGGGAGAGGG + Intronic
1016361098 6:143268267-143268289 GAGGCAGAGCAACGGGGAAGGGG - Intronic
1016599608 6:145843031-145843053 CAGGCAGGGGCAGCGGGAGGAGG - Intergenic
1016973784 6:149787314-149787336 GAGGGAGAGGGAGCGGGAGCGGG + Intronic
1017557181 6:155583888-155583910 TAGGCAGAGGAGTCTGGAAGTGG + Intergenic
1017665258 6:156713752-156713774 GAGGCAAAGGAGGAGGGAGGAGG + Intergenic
1018038070 6:159898636-159898658 GAGGAGGAGGAAGAGGGAGGAGG - Intergenic
1018038090 6:159898704-159898726 GAGGAGGAGGAAGAGGGAGGAGG - Intergenic
1018038095 6:159898720-159898742 GAGGAGGAGGAAGAGGGAGGAGG - Intergenic
1019079733 6:169422164-169422186 CATGCAGAGGAATAGGTAGGAGG - Intergenic
1019419068 7:942350-942372 GAGGAAGAGGAAGAGAGAGGAGG + Intronic
1019459316 7:1147964-1147986 GAGGGAGAGGGAGAGGGAGGGGG + Intergenic
1019517426 7:1446191-1446213 GAGGGAGAGGAGGGGGGAGGAGG + Intronic
1019517435 7:1446210-1446232 GAGGGAGAGGAGGGGGGAGGAGG + Intronic
1019517444 7:1446229-1446251 GAGGGAGAGGAGGGGGGAGGAGG + Intronic
1019517453 7:1446248-1446270 GAGGGAGAGGAGGGGGGAGGAGG + Intronic
1019517483 7:1446335-1446357 GAGGGAGAGGAGGGGGGAGGAGG + Intronic
1019517492 7:1446354-1446376 GAGGGAGAGGAGGGGGGAGGAGG + Intronic
1019517522 7:1446441-1446463 GAGGGAGAGGAGGGGGGAGGAGG + Intronic
1019535374 7:1526484-1526506 GAGGAAGAGGAAGAAGGAGGGGG + Intergenic
1019535387 7:1526540-1526562 GAAGAAGAGGAAGAGGGAGGAGG + Intergenic
1019812542 7:3175202-3175224 GAGGCAGGGGCCCCGGGAGGTGG - Intergenic
1019827616 7:3297713-3297735 GAGGAAGAGGAAGAAGGAGGAGG + Intergenic
1019989743 7:4682948-4682970 GAGGCCGAGGAAGCTGGAGGGGG - Intronic
1020080155 7:5282608-5282630 GAAGAGGAGGAATGGGGAGGAGG + Intronic
1020080179 7:5282677-5282699 GAGGAGGAGGAATGGGGAGGAGG + Intronic
1020092327 7:5348675-5348697 GAGCCAGAGGGAGAGGGAGGAGG + Intronic
1020514132 7:9094763-9094785 AAGGTAGAGGAAGTGGGAGGAGG + Intergenic
1020794926 7:12667618-12667640 GAGGAAGAGGACGAGGGAGGAGG + Intergenic
1022175484 7:27868418-27868440 GGGGCGGAGGAATCTGGAGAGGG - Intronic
1022501975 7:30887492-30887514 GAGGAGGAGGAATCAGGTGGTGG + Intronic
1022657262 7:32330947-32330969 GAGACAGAGGAGGAGGGAGGAGG - Intergenic
1022728030 7:32998323-32998345 GAGGCTGAGGAAAGGGGAAGTGG + Intronic
1023160399 7:37291924-37291946 GAGGGAGAGGGAGGGGGAGGGGG - Intronic
1023224626 7:37956230-37956252 GAGGAAGAGGAAGAGGGAGAAGG + Intronic
1023743727 7:43303102-43303124 TGGGCAGAGGAATGGGCAGGGGG - Intronic
1023769380 7:43541127-43541149 AAGGCAGAGAAATCGGTAAGTGG - Intronic
1023984819 7:45088462-45088484 GAGGCAGCGGGTTCTGGAGGCGG - Intronic
1024028353 7:45433335-45433357 GAGGGAGAGGAAGGAGGAGGGGG - Intergenic
1024084107 7:45879550-45879572 GTGGCAGAGTGATGGGGAGGAGG + Intergenic
1024186093 7:46949482-46949504 GAGGCAGAGGACTCACGAGGTGG - Intergenic
1024268264 7:47622856-47622878 GTGGTAGAGGAAGGGGGAGGAGG - Intergenic
1024880116 7:54075191-54075213 GAGGCAGAGGAACAGAGAGGAGG - Intergenic
1025045623 7:55689696-55689718 GAGGCTGAGGAAAGGGGAAGTGG - Intergenic
1025198715 7:56949448-56949470 GAGGAGGAGGAATAGGGAGAAGG - Intergenic
1025198758 7:56949599-56949621 GAAGAGGAGGAATGGGGAGGAGG - Intergenic
1025230956 7:57203172-57203194 GAGGCGGAGGAGGCGGGAGGAGG - Intergenic
1025673188 7:63627334-63627356 GAAGAGGAGGAATGGGGAGGAGG + Intergenic
1025673233 7:63627483-63627505 GAGGAGGAGGAATAGGGAGAAGG + Intergenic
1025800655 7:64784106-64784128 GAGGGAGAGGAAGAGGGAGAGGG - Intergenic
1025979698 7:66395062-66395084 GAGGGAGAGGGAGGGGGAGGGGG + Intronic
1026148637 7:67769869-67769891 GAAGGAGAGGAAGAGGGAGGAGG - Intergenic
1026684920 7:72501444-72501466 GAGGAAGAGGAAAAAGGAGGAGG + Intergenic
1026789763 7:73324074-73324096 GAGGGAGAGGAAGAGGGAAGAGG + Intronic
1026806154 7:73430506-73430528 GAGGCAGGGGGAGGGGGAGGGGG - Intergenic
1026808128 7:73440590-73440612 GAGGCAGGGGAAGCTGGCGGTGG + Exonic
1026942346 7:74294505-74294527 GAGGGAAATGAATCGGGAGCGGG - Intronic
1027136664 7:75629357-75629379 GGGCCAGAGGAATGGAGAGGAGG - Intronic
1027155794 7:75766786-75766808 GAGGCAGAGGTCCTGGGAGGCGG + Intergenic
1027589921 7:80105693-80105715 GAGGAAGAGGAAGAGGAAGGTGG + Intergenic
1027621560 7:80493607-80493629 GAGGAAGAGGAAAGAGGAGGAGG - Intronic
1028636694 7:92997513-92997535 GAGGCAGAGCAATGGGGACTTGG + Intergenic
1029414361 7:100433711-100433733 GTGCCAGAGGCATAGGGAGGAGG - Exonic
1029469156 7:100742871-100742893 GAGGGAGAGGGAGGGGGAGGGGG + Intronic
1030036496 7:105411764-105411786 GAGGGAGAGGGAGAGGGAGGGGG + Intergenic
1030036500 7:105411770-105411792 GAGGGAGAGGGAGGGGGAGGGGG + Intergenic
1030379933 7:108800626-108800648 GAGGTAGAGGCAAGGGGAGGAGG - Intergenic
1030380005 7:108800843-108800865 GAGGAGGAGGAAAGGGGAGGGGG - Intergenic
1030706508 7:112698047-112698069 GAGGGAGAGGGAGGGGGAGGAGG + Intergenic
1031162562 7:118185366-118185388 GAGGCAGAGGCAGAGGCAGGAGG - Intronic
1031854622 7:126907273-126907295 GAGGAAGAAGAAAGGGGAGGAGG + Intronic
1032122721 7:129168721-129168743 GATGCAGGGGAATGGGGTGGGGG - Exonic
1032224498 7:130020357-130020379 GAGGCAGGAGAATTGGGAGGTGG - Intronic
1032262324 7:130347438-130347460 AAGGGAAAGGAATGGGGAGGGGG - Intronic
1032326565 7:130934627-130934649 GAGGAAGAGGAAGAGGGAGAGGG + Intergenic
1032492396 7:132333388-132333410 CAGGAAGAGGAAGAGGGAGGTGG + Intronic
1032563122 7:132913160-132913182 GAAGCAGAGGAAATGGAAGGTGG - Intronic
1032724780 7:134580710-134580732 GAGTCAGGGGAATGGGGATGGGG - Intergenic
1033219923 7:139521049-139521071 GAGGGAGAGGGAGGGGGAGGGGG + Intergenic
1033367568 7:140683400-140683422 GAGGCAGGGGAGTCAGAAGGTGG + Intronic
1033565520 7:142574897-142574919 GAGGCAGGGGGAGGGGGAGGGGG - Intergenic
1033565524 7:142574903-142574925 GAGGCAGAGGCAGGGGGAGGGGG - Intergenic
1033565528 7:142574909-142574931 GAGGCAGAGGCAGAGGCAGGGGG - Intergenic
1034034313 7:147802775-147802797 GAGGGAGAGGGAGGGGGAGGGGG + Intronic
1034427955 7:151024324-151024346 GTGGCAGTGGCATGGGGAGGAGG + Exonic
1034695959 7:153053944-153053966 GAGGGTGAGGAATGGGGAGTTGG - Intergenic
1034855755 7:154545025-154545047 GAGGCAGAGGCATCCAGAGCTGG + Intronic
1035280747 7:157776572-157776594 GAGGGAGAAGAAGAGGGAGGAGG - Intronic
1035354662 7:158269825-158269847 GAGACAGAGGGATAGGGAGTCGG + Intronic
1035880129 8:3237368-3237390 GAGGCAGGAGACTCAGGAGGTGG + Intronic
1036135638 8:6158725-6158747 GAGGCACAGGGATGGGAAGGTGG - Intergenic
1036507914 8:9372521-9372543 GAGGAAGAGGGCTCGGGAGCTGG - Intergenic
1036711959 8:11085551-11085573 GAGGCAGGAGAATGGGGAGTGGG + Intronic
1037497047 8:19450213-19450235 GAGGAAGAGGGAGGGGGAGGGGG + Intronic
1037708671 8:21337833-21337855 GAGGCAGGAGAATCAGGAGGTGG + Intergenic
1037786058 8:21903988-21904010 GAGCCAGAGGAGCTGGGAGGGGG - Intergenic
1037961584 8:23102276-23102298 GAGGCTGAGGAGTAGGTAGGAGG - Intronic
1037969940 8:23164645-23164667 GAGGCTGAGGAGTAGGTAGGAGG + Intergenic
1038315651 8:26482399-26482421 GAGGCAGATGACTCAGCAGGAGG - Intronic
1038423795 8:27451679-27451701 CAGGGAGAGGAATGGGGTGGAGG - Intronic
1038506377 8:28088559-28088581 GAGGCAGGAGAATTGGGAGGTGG - Intergenic
1039025719 8:33255743-33255765 CAGGCAGAGAAATCAGGAAGAGG + Intergenic
1039443143 8:37609538-37609560 AGGGGAGAGGAATCGGGAGATGG - Intergenic
1039567786 8:38563858-38563880 GAGAAAGGGGAATGGGGAGGAGG - Intergenic
1040818469 8:51533493-51533515 GAGGGAGAGGGAGGGGGAGGGGG - Intronic
1040818473 8:51533499-51533521 GAGGGAGAGGGAGAGGGAGGGGG - Intronic
1041167189 8:55102053-55102075 GGAGGAGAGGAAGCGGGAGGAGG + Intergenic
1041170884 8:55141253-55141275 GAGGCAGAGGAGGAGGGAGGCGG - Intronic
1041270658 8:56105625-56105647 GAGGCAGAGGGAGAGGGAGAGGG + Intergenic
1041513755 8:58677250-58677272 GAGGGAGAGGGAGCGGGAGAGGG + Intergenic
1041513765 8:58677268-58677290 GAGGGAGAGGGAGGGGGAGGGGG + Intergenic
1041606504 8:59788197-59788219 GAGGCAGGAGAATTGGGAGATGG - Intergenic
1041697477 8:60751404-60751426 GAGGAAGAAGAATTGGGAAGTGG + Intronic
1041708166 8:60868592-60868614 GAGGCAGAGGCAGAGGCAGGTGG - Intergenic
1041892103 8:62880652-62880674 AAAACAGAGGAATCTGGAGGAGG - Intronic
1043314927 8:78908728-78908750 GAGAGAGAGGAAAAGGGAGGGGG + Intergenic
1044024097 8:87146813-87146835 GAAGCAGAGAAATCAGTAGGAGG - Intronic
1044289289 8:90448511-90448533 AAGGGAGAGGAATCTGGAGGAGG - Intergenic
1044520391 8:93192844-93192866 AAGGAAGAGGAATTGGCAGGGGG - Intergenic
1044969267 8:97604352-97604374 GAGGGAGAGGGAGCGGGAGCGGG - Intergenic
1045195480 8:99926586-99926608 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
1045231990 8:100314678-100314700 CAGGCAGAGGAGAGGGGAGGGGG - Intronic
1045412080 8:101929530-101929552 GAGGGAAAGGAAAGGGGAGGGGG + Intronic
1046057678 8:109098104-109098126 GAGGCAGGGGGATTGGAAGGAGG - Intronic
1046208020 8:111028937-111028959 GAGGCAGGAGAATCAGGAGTTGG - Intergenic
1047389702 8:124440224-124440246 GAGGCAGAAGAATCGGGAAGCGG - Intergenic
1047432551 8:124805408-124805430 GAAGCAGAGGAAGCAGGAGAGGG + Intergenic
1048064405 8:130952720-130952742 GAGGCAGAGGGACCAGGTGGGGG + Intronic
1048240008 8:132731954-132731976 AAGCCAGAGGAATTGGGAGGTGG + Intronic
1048451228 8:134535489-134535511 GAGGGAGAGGGAGGGGGAGGGGG - Intronic
1048517828 8:135126426-135126448 GAGGGAGGGGAATTGGGTGGGGG - Intergenic
1048996376 8:139796103-139796125 GAGGAAGAGGAGGAGGGAGGAGG + Intronic
1049125554 8:140784058-140784080 GAGGCAGAGGCAGAGGCAGGAGG + Intronic
1049395567 8:142398569-142398591 GAGGCAGTGGAGTGAGGAGGTGG - Intronic
1049431396 8:142566979-142567001 GAGGCAGATGAAGGGGGCGGGGG - Intergenic
1049698543 8:143995496-143995518 CAGGCAGATGAATCGGCACGGGG + Intronic
1051276679 9:15405813-15405835 GAGGGAGAGGGAGAGGGAGGGGG - Intergenic
1052055212 9:23898263-23898285 GAGGCAGGAGAACAGGGAGGTGG + Intergenic
1052493021 9:29190033-29190055 GAGGGAGAGGGAGAGGGAGGGGG + Intergenic
1052493025 9:29190039-29190061 GAGGGAGAGGGAGGGGGAGGGGG + Intergenic
1052680136 9:31680566-31680588 AAGGAAGGGGAATAGGGAGGAGG + Intergenic
1053240146 9:36488090-36488112 GAGGCAGAGGAGGGGAGAGGAGG - Intergenic
1053504505 9:38630000-38630022 GAGGCAAATGCATGGGGAGGTGG - Intergenic
1055297822 9:74852447-74852469 GAGGGAGAGGGAGAGGGAGGAGG - Intronic
1055301464 9:74887439-74887461 GAGGGAGAGGAGTTCGGAGGTGG - Intronic
1055948083 9:81709510-81709532 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
1056053976 9:82801308-82801330 GAGGCAGAGGCAGAGGCAGGCGG + Intergenic
1056144024 9:83711456-83711478 GAGGCAGAGGAATCTGTAGGAGG - Intergenic
1057120073 9:92563769-92563791 GAGGAAGAGGGGTAGGGAGGGGG - Intronic
1057151914 9:92803681-92803703 GAGGCAAATGCATGGGGAGGTGG + Intergenic
1057303241 9:93898458-93898480 GAGGCAGAGGGAAGGGGAGAGGG + Intergenic
1057552099 9:96058985-96059007 GAGGCAAGGGAAACGGGAAGGGG + Intergenic
1057567866 9:96180861-96180883 GAGGCAGGGGAGTCAGGAGAAGG + Intergenic
1057743611 9:97733971-97733993 GTGGCAGAGGCAGAGGGAGGAGG + Intergenic
1057884745 9:98821802-98821824 AAAGCAGAGGAGTGGGGAGGGGG - Intronic
1058049457 9:100392212-100392234 GAGGGAGAGGGAGAGGGAGGGGG - Intergenic
1058578112 9:106425313-106425335 GAGGCAGAGCAATTGGAGGGTGG - Intergenic
1058795695 9:108496297-108496319 GAGGCAGAGAAAGAGGGAGAGGG + Intergenic
1059072417 9:111152799-111152821 GAGGCAGAGGAGGAGGAAGGAGG + Intergenic
1059072424 9:111152818-111152840 GAGGCGGAGGAGGAGGGAGGAGG + Intergenic
1059072430 9:111152840-111152862 GAGGAAGAGGAAGGAGGAGGAGG + Intergenic
1059172432 9:112138543-112138565 GAGGCAGGAGAATTGGGAGGTGG - Intronic
1059400739 9:114069589-114069611 GAGGCAGAGTCATGGGGAGGGGG - Intronic
1059443902 9:114326324-114326346 GAAGGAGAGGAAACAGGAGGAGG + Exonic
1059445109 9:114333101-114333123 GAAGGAGAGGAAACAGGAGGAGG + Exonic
1059534933 9:115071692-115071714 GGGGCAGAGGAAGGAGGAGGAGG + Intronic
1059651889 9:116322869-116322891 TAGGAAAAGGAATGGGGAGGAGG - Intronic
1059680411 9:116580258-116580280 GAGGCAGAGGTATGGGGCAGGGG + Intronic
1060041332 9:120304264-120304286 GAGGGAGAGGGAGAGGGAGGGGG - Intergenic
1060141509 9:121214279-121214301 GAGGAAGAGGAAGAAGGAGGAGG - Intronic
1060698616 9:125731390-125731412 GAGGAAAAGGAAGCAGGAGGGGG - Intergenic
1060756772 9:126219553-126219575 GAGGCAGAGAGATAGGTAGGAGG - Intergenic
1060797175 9:126520592-126520614 GAGGCAGAAGAATCAAGAGATGG - Intergenic
1061196323 9:129109041-129109063 GAAGTAGAGGAATGGGGAGCAGG + Intronic
1061722562 9:132561807-132561829 GTGGCAGAGGCGTCGGGTGGAGG + Intronic
1062123627 9:134847877-134847899 GAGGAAGGGGAAGTGGGAGGGGG + Intergenic
1062287046 9:135777951-135777973 GAGACAGAGGAACTGGGAGTGGG - Intronic
1062361449 9:136190212-136190234 GAGGCAGGGGGAGGGGGAGGGGG - Intergenic
1062445994 9:136595111-136595133 GAGGAAGAGGAAGAAGGAGGAGG + Intergenic
1203526030 Un_GL000213v1:88508-88530 GAGGGAGAGGAATGGGAAGTTGG + Intergenic
1203653815 Un_KI270752v1:4587-4609 GAGGCAGAGGCAGAGGCAGGTGG - Intergenic
1185504232 X:619754-619776 GAGGCAGGAGGATGGGGAGGAGG + Intergenic
1185610905 X:1393011-1393033 AAGGGAGAGGAGGCGGGAGGAGG - Intergenic
1185631039 X:1515934-1515956 GAGGCCGAGGGGTCGGGGGGTGG + Intronic
1185640652 X:1588147-1588169 GGAGCAGAGGAAAGGGGAGGGGG - Intergenic
1185702430 X:2241379-2241401 GACACAGAGGAAGCAGGAGGGGG - Intronic
1185791511 X:2930994-2931016 GAGGCAGAATAATGGTGAGGAGG - Intergenic
1186047299 X:5550384-5550406 AAGGCAGAGGGAAAGGGAGGCGG - Intergenic
1186124720 X:6400931-6400953 GAGGAAGAGGAAGAAGGAGGAGG - Intergenic
1187018298 X:15352173-15352195 GAGGCAGAAGAATGGAGAGTAGG + Intronic
1188007205 X:25023274-25023296 GAGGCAGAAGGAGTGGGAGGAGG + Intergenic
1188214138 X:27457837-27457859 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
1188673661 X:32912082-32912104 GAGGAGAAGGAATGGGGAGGAGG + Intronic
1188916682 X:35919973-35919995 TATGCACAGTAATCGGGAGGCGG - Exonic
1189161834 X:38817188-38817210 GAGGCAGAGTAAACAGGAAGTGG + Intergenic
1189235029 X:39480200-39480222 GAGGCAGAGGAATTGAAAGCAGG + Intergenic
1189320870 X:40086451-40086473 GAGGCAGAGGTGGCGGGAGAAGG - Intronic
1189363297 X:40369633-40369655 GGGGCAGGGGAGTGGGGAGGGGG + Intergenic
1189511420 X:41665878-41665900 GAGGCAGGGGAAAGGAGAGGAGG + Intronic
1190109911 X:47582965-47582987 GAGGTTGAGGAATTTGGAGGAGG - Intronic
1190174569 X:48138560-48138582 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
1190174573 X:48138566-48138588 GAGGGAGAGGGAGAGGGAGGGGG - Intergenic
1190758884 X:53423451-53423473 GAGGCAGAGGTAGGTGGAGGTGG - Intronic
1191576833 X:62715448-62715470 GAGGCAGAGGAAAAGAGAGGAGG + Intergenic
1192180274 X:68911978-68912000 GTGGCAGAGGTCTGGGGAGGAGG - Intergenic
1192191725 X:68995288-68995310 GAAGCAGGGGAATAGGGAGGAGG - Intergenic
1192663463 X:73067298-73067320 GAGGGAGCGGGAGCGGGAGGGGG - Intergenic
1192663467 X:73067304-73067326 GAGGGAGAGGGAGCGGGAGCGGG - Intergenic
1192847994 X:74925484-74925506 GAGGAGGAGGAAGGGGGAGGAGG - Intronic
1193743430 X:85244811-85244833 GGGGCAGAGGAAGCTGGAGGAGG + Intronic
1194267257 X:91770166-91770188 GAGGCAAAAGAAAAGGGAGGTGG - Intergenic
1194932018 X:99900522-99900544 GAGGCAGAAGAATCAGGAGGTGG - Intergenic
1195119764 X:101738445-101738467 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
1195294588 X:103463491-103463513 GAGGAAGAGGAAGAAGGAGGAGG + Intergenic
1196657335 X:118232208-118232230 GAGGAAGAGGAAGGAGGAGGGGG + Intergenic
1197452765 X:126640742-126640764 GAGGGAGAGGGAGGGGGAGGGGG - Intergenic
1197452769 X:126640748-126640770 GAGGGAGAGGGAGAGGGAGGGGG - Intergenic
1197484039 X:127024824-127024846 GAGGCAGAGGAATAAGGGGAGGG + Intergenic
1198979653 X:142380355-142380377 GAGGGAGAGGGAGAGGGAGGGGG + Intergenic
1199474488 X:148230918-148230940 GAGGGAGGGGGATGGGGAGGGGG - Intergenic
1199600061 X:149536572-149536594 GAGGCAAAGGAAGAGGAAGGCGG + Intergenic
1199650521 X:149943368-149943390 GAGGCAAAGGAAGAGGAAGGCGG - Intergenic
1200085425 X:153601987-153602009 GAGGCAGAGAAAGAGGGAAGAGG + Intergenic
1200584464 Y:4991103-4991125 GAGGCAAAAGAAAAGGGAGGTGG - Intergenic
1201521039 Y:14873886-14873908 GAGGCTGAGGAATAAGGAGGAGG + Intergenic
1202081918 Y:21092451-21092473 GGGGCTGAGGAATAAGGAGGTGG + Intergenic
1202147662 Y:21816922-21816944 GAAGCAGAGGAGACGGCAGGTGG - Intergenic