ID: 1144553273

View in Genome Browser
Species Human (GRCh38)
Location 17:16260090-16260112
Sequence GGGCAGAGATGAGCACAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 279}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144553267_1144553273 1 Left 1144553267 17:16260066-16260088 CCAACTTGGCCCTCTCTGGGCTT 0: 1
1: 0
2: 4
3: 61
4: 301
Right 1144553273 17:16260090-16260112 GGGCAGAGATGAGCACAAGTGGG 0: 1
1: 0
2: 3
3: 33
4: 279
1144553260_1144553273 12 Left 1144553260 17:16260055-16260077 CCAGCCCCCTGCCAACTTGGCCC 0: 2
1: 30
2: 56
3: 158
4: 577
Right 1144553273 17:16260090-16260112 GGGCAGAGATGAGCACAAGTGGG 0: 1
1: 0
2: 3
3: 33
4: 279
1144553264_1144553273 5 Left 1144553264 17:16260062-16260084 CCTGCCAACTTGGCCCTCTCTGG 0: 1
1: 2
2: 23
3: 56
4: 309
Right 1144553273 17:16260090-16260112 GGGCAGAGATGAGCACAAGTGGG 0: 1
1: 0
2: 3
3: 33
4: 279
1144553263_1144553273 6 Left 1144553263 17:16260061-16260083 CCCTGCCAACTTGGCCCTCTCTG 0: 1
1: 1
2: 26
3: 76
4: 325
Right 1144553273 17:16260090-16260112 GGGCAGAGATGAGCACAAGTGGG 0: 1
1: 0
2: 3
3: 33
4: 279
1144553271_1144553273 -9 Left 1144553271 17:16260076-16260098 CCTCTCTGGGCTTTGGGCAGAGA 0: 1
1: 0
2: 4
3: 73
4: 432
Right 1144553273 17:16260090-16260112 GGGCAGAGATGAGCACAAGTGGG 0: 1
1: 0
2: 3
3: 33
4: 279
1144553261_1144553273 8 Left 1144553261 17:16260059-16260081 CCCCCTGCCAACTTGGCCCTCTC 0: 1
1: 3
2: 37
3: 98
4: 417
Right 1144553273 17:16260090-16260112 GGGCAGAGATGAGCACAAGTGGG 0: 1
1: 0
2: 3
3: 33
4: 279
1144553262_1144553273 7 Left 1144553262 17:16260060-16260082 CCCCTGCCAACTTGGCCCTCTCT 0: 1
1: 1
2: 29
3: 76
4: 405
Right 1144553273 17:16260090-16260112 GGGCAGAGATGAGCACAAGTGGG 0: 1
1: 0
2: 3
3: 33
4: 279
1144553270_1144553273 -8 Left 1144553270 17:16260075-16260097 CCCTCTCTGGGCTTTGGGCAGAG 0: 1
1: 0
2: 4
3: 49
4: 445
Right 1144553273 17:16260090-16260112 GGGCAGAGATGAGCACAAGTGGG 0: 1
1: 0
2: 3
3: 33
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144553273 Original CRISPR GGGCAGAGATGAGCACAAGT GGG Intronic
900342963 1:2197341-2197363 GGGCAGAGCCGAGCAGAAGCAGG + Intronic
900385914 1:2410665-2410687 AGCAAGAGATGAGCACAGGTGGG - Intronic
900462042 1:2806196-2806218 GGGCAGGGAGGAGCAGCAGTGGG - Intergenic
901804035 1:11726518-11726540 GTGCAGAGAAGAGCAGAAGCGGG + Intergenic
902233691 1:15044268-15044290 GGGCAGAGCAGAACACAAGCAGG + Intronic
902990946 1:20186498-20186520 GGGCAGAGACGAGAACCAGAGGG + Intronic
904311115 1:29630178-29630200 GGGCAGTGAGGAGCAAAAGGAGG - Intergenic
904808797 1:33150168-33150190 AGACAGAGATGAGGAAAAGTGGG + Intronic
908794446 1:67817233-67817255 GGGGAGAGAAGAGGACAAGAAGG + Intronic
909754894 1:79213177-79213199 GGGCAGAGAAGAGCACAAAGAGG - Intergenic
910094760 1:83508818-83508840 GAGTTGAGATGAGGACAAGTTGG + Intergenic
910684384 1:89901485-89901507 GGGCAGAGGTGAGGACAGCTGGG - Intronic
912722243 1:112030015-112030037 GGGCAGATAGGAGCCCATGTTGG - Intergenic
917985105 1:180308597-180308619 GGGTAGAGATTAGAACAAGTTGG - Intronic
918038193 1:180895796-180895818 CTCCAGAAATGAGCACAAGTGGG + Intergenic
918404844 1:184201503-184201525 GAGCAGAGAAGAGGACAAGGTGG - Intergenic
919974469 1:202601863-202601885 GAGCAGAGATGAGGCCAGGTTGG - Intronic
921149234 1:212386476-212386498 GGGCAGGGATGAGGAGAAGCAGG - Intronic
922324699 1:224517214-224517236 GGGCAGTGCTGAGCACACCTTGG + Intronic
924497212 1:244602054-244602076 GGGCAGATGAGAGGACAAGTGGG + Intronic
1065122804 10:22544805-22544827 GGGCAGAGCAGAGCTCAAGTGGG - Intronic
1066290384 10:34008920-34008942 GGGCAGAGATGAGCTCATAGGGG - Intergenic
1069820683 10:71225783-71225805 AGGCAGAGAGAAGCTCAAGTTGG + Intronic
1069911982 10:71765449-71765471 GGACAGAGGTGTGGACAAGTGGG + Intronic
1070479922 10:76871929-76871951 GGGGAGAAATGAGCACAATATGG - Intronic
1072787457 10:98293955-98293977 GGGCAGAGCTCACCGCAAGTGGG - Intergenic
1073119618 10:101113495-101113517 GGGGAGGGATGAGGACAGGTAGG + Intronic
1073712656 10:106062330-106062352 GGGGAGAGATGGGTAGAAGTTGG - Intergenic
1074360412 10:112820917-112820939 GGGCAGTGATGAGCTCAAGGGGG - Intergenic
1077944740 11:6883883-6883905 GGATAGAGACTAGCACAAGTTGG - Intergenic
1079144079 11:17835059-17835081 AGGCAGAGAAGAGCACACATTGG + Intronic
1079184166 11:18221388-18221410 GGGCATTGATGAGCACAGGAGGG - Intronic
1079590275 11:22175212-22175234 GGGGAAAGGGGAGCACAAGTTGG - Intergenic
1080661139 11:34296932-34296954 GGTCAGAGCTGTGCAGAAGTTGG - Intronic
1084642786 11:70435787-70435809 GGGTAGAGATGAGGACAAGCCGG - Intronic
1084647450 11:70466731-70466753 GGGCAGAGATGACTACAGTTGGG + Intergenic
1085514286 11:77103362-77103384 GGGCAGGGGAGAGCACAGGTGGG - Intronic
1089195975 11:116694307-116694329 GGGCATAGATGAGAAGAAGATGG - Intergenic
1089195989 11:116694384-116694406 GGGCATAGATGAGGAGAAGATGG - Intergenic
1089702567 11:120254439-120254461 GGGCAGAGGAGATGACAAGTTGG + Intronic
1089879061 11:121756008-121756030 GGCCAGAGCTGAGCTCTAGTTGG - Intergenic
1090041875 11:123298987-123299009 GGGCACTGATGAGCACAGGAGGG + Intergenic
1090269701 11:125377514-125377536 GGGCAAAGATGGGCACAGGAAGG + Intronic
1090879836 11:130823860-130823882 GGGCAGAGCTGGGCAAAAGCTGG - Intergenic
1091645926 12:2272247-2272269 AGGCAGAGGTGAAAACAAGTAGG - Intronic
1091792315 12:3278932-3278954 GGGCAGGGCTGAGGACAAGGAGG - Intronic
1092289367 12:7149974-7149996 GGGCAGAGATGAGCCGAAGGAGG - Intronic
1096273899 12:50189395-50189417 CGGCAGATATGAGCATGAGTTGG + Intronic
1096536811 12:52280071-52280093 GGAGAGAGATGAACACAATTGGG + Intronic
1096640505 12:52990606-52990628 GGGCGGAGATGAACTCAAGTGGG + Intergenic
1097130872 12:56810024-56810046 GGGAGGAAATGAGCACCAGTTGG + Intergenic
1097492030 12:60282647-60282669 GGGCACCAATGAGCACAAGAGGG - Intergenic
1098356734 12:69619458-69619480 GGGCAAAGTTGAGCCCAAGTGGG + Intergenic
1099163478 12:79274161-79274183 GGCCAGAGCTAAGCACAAGTGGG + Intronic
1100692508 12:97053695-97053717 GGCCAGAGATGAACACCAGGTGG + Intergenic
1101454074 12:104811535-104811557 GGGATGAAATGAGCACAAGAAGG + Intronic
1102570324 12:113823412-113823434 GGGGAGAGATGAGCAGAACAAGG + Intronic
1104384472 12:128338548-128338570 GGACAGAGCTGAGCACATGCTGG + Intronic
1104450364 12:128864020-128864042 GGGGAGAGAAGAGCACTAGGGGG + Intronic
1106867045 13:33976427-33976449 GAGCAGAGATGAGGAGAAGTTGG + Intergenic
1109329951 13:60917211-60917233 GGGGAGAGATCACCTCAAGTAGG + Intergenic
1110090161 13:71434765-71434787 GGCAACAGATGACCACAAGTTGG - Intergenic
1110208806 13:72948520-72948542 AGGCAGAGATTAGAACAATTTGG - Intronic
1113021772 13:105895404-105895426 GAGCAGACATGAGAACGAGTTGG - Intergenic
1113414757 13:110119883-110119905 TGGTAGAGATGGGCACAAGCAGG + Intergenic
1113545516 13:111146047-111146069 GAGATGAGATGTGCACAAGTAGG + Intronic
1115467525 14:33731924-33731946 GGGCAGAGCTGGGCGCAACTGGG + Intronic
1117793102 14:59361714-59361736 GGGCAGGGATGAGAACAGGCTGG + Intronic
1121410974 14:93748177-93748199 GGGAAGAGCTGAGCCCAAGGGGG + Intronic
1121501391 14:94441275-94441297 GGGCAGAGATAAGAAGGAGTAGG - Intergenic
1122272041 14:100572615-100572637 GGGCAGAGATGAGCCCTGGGGGG + Intronic
1122442521 14:101741974-101741996 GGGCAGAGGTTAGAACAATTTGG - Intergenic
1123405166 15:20015684-20015706 CGGCAGAGATGACGGCAAGTTGG - Intergenic
1123514495 15:21022332-21022354 CGGCAGAGATGACGGCAAGTTGG - Intergenic
1123830501 15:24131348-24131370 GTGGAGATATGAGGACAAGTTGG + Intergenic
1123850751 15:24353953-24353975 GTGGAGATATGAGGACAAGTTGG + Intergenic
1123855631 15:24408192-24408214 GTGGAGATATGAGGACAAGTTGG + Intergenic
1124516666 15:30372201-30372223 GGGCGGAGATGAGCACACAGGGG + Exonic
1124726253 15:32158530-32158552 GGGCGGAGATGAGCACACAGGGG - Exonic
1125913699 15:43465458-43465480 AGACAGAGATGATCAAAAGTAGG + Intronic
1126340607 15:47636898-47636920 GGGCAGCCATGAGCACACTTTGG - Intronic
1126694263 15:51312964-51312986 TGGCAGAGAGGAGAGCAAGTGGG - Intronic
1129112447 15:73345399-73345421 GGGTAGAGAGGAGCTGAAGTTGG - Intronic
1129185117 15:73901377-73901399 GGGGAGAGAAGAGCAGAGGTGGG - Intergenic
1129707523 15:77803139-77803161 GGACAGAGGTGAGCACAGGGTGG - Intronic
1131018534 15:89078065-89078087 GGTCAGAGATGATCCCAAGGTGG - Intergenic
1131285835 15:91056490-91056512 GGGCAGAGATGTGCCCAGGGAGG - Intergenic
1131530835 15:93190416-93190438 GGGCAGAGAAGAGTAGAAGGAGG - Intergenic
1132571446 16:646124-646146 GGGCAGAGATGGGCCCCAGGAGG - Intronic
1132676181 16:1122260-1122282 GGGCAGGGAGGAGCACAAGGAGG - Intergenic
1132806617 16:1777961-1777983 GGGCAGGGATGAGGACAGCTGGG - Exonic
1132955142 16:2587957-2587979 GGGCAGAGAGGAGCCCAAGGGGG + Intronic
1134450257 16:14358941-14358963 GGGAAGTGATGAGCAGATGTGGG - Intergenic
1134716118 16:16358718-16358740 GTGCAGCGCTGAGCACAGGTCGG - Intergenic
1137246585 16:46711017-46711039 GGAAAGAGGTGAGCACAAGAGGG - Intronic
1137455593 16:48615492-48615514 GTGCAGAGAGGAGCAGAGGTGGG - Intronic
1137934046 16:52616943-52616965 GGACAGACATGGGGACAAGTGGG - Intergenic
1138401502 16:56748649-56748671 AGGGAGAGATGATCACAAGGTGG + Intronic
1140036021 16:71371890-71371912 GGACAGAGGAGAGCAGAAGTTGG - Intronic
1141367295 16:83455573-83455595 AAGCAGAGAAGAGCACAAGAAGG - Intronic
1141829416 16:86501379-86501401 GGCCAGGCATGAGCAGAAGTGGG - Intergenic
1142198097 16:88748088-88748110 GGGCAGAGAGGAGGCCAAGCAGG - Intronic
1143391052 17:6559460-6559482 GTGCAGAGATGTGGACAGGTTGG + Intergenic
1143658354 17:8310564-8310586 GGGTAGGGATGAGGACAAGACGG - Intronic
1143814643 17:9502307-9502329 GGGGAGAGATGAGGAGATGTGGG + Intronic
1143848436 17:9791092-9791114 GGGCAGAAATGGGCACAGGTGGG + Intronic
1144553273 17:16260090-16260112 GGGCAGAGATGAGCACAAGTGGG + Intronic
1144788999 17:17847252-17847274 AGGCAGAGGTGAGCACAGGGCGG + Exonic
1144837017 17:18161847-18161869 GGGCAGAGGTGGGCCCAAGCTGG + Intronic
1147818713 17:43228919-43228941 GGGGAGAGATGAGCAGAGGAAGG - Intergenic
1147831996 17:43303621-43303643 GGGGAGAGATGAGCAGAGGAAGG - Intergenic
1148637023 17:49156705-49156727 GGTCAGACATGAGCCCAAGGAGG + Intronic
1149459103 17:56812784-56812806 GGGAGGTGATGACCACAAGTGGG + Intronic
1149796898 17:59529146-59529168 GGACAGCGATGGGCACAGGTGGG - Intergenic
1151914251 17:77105786-77105808 GGGCCCAGAGGAGCACAGGTGGG + Intronic
1152336163 17:79701174-79701196 GGGAGGAGAGGAGCACAGGTGGG + Intergenic
1152336198 17:79701264-79701286 GGGAGGAGAGGAGCACAGGTGGG + Intergenic
1152336217 17:79701318-79701340 GGGAGGAGAGGAGCACAGGTGGG + Intergenic
1152336228 17:79701348-79701370 GGGAGGAGAGGAGCACAGGTGGG + Intergenic
1152336307 17:79701550-79701572 GGGAGGAGAGGAGCACAGGTGGG + Intergenic
1152336340 17:79701640-79701662 GGGAGGAGAGGAGCACAGGTGGG + Intergenic
1152568395 17:81110570-81110592 TGGCAGAGGTGGGCACAAGGCGG - Intronic
1152996324 18:409854-409876 AGGCACAGATAAGCACAAGAAGG + Intronic
1153368781 18:4289355-4289377 GGCCAGAGATGAGCATGTGTTGG + Intronic
1154164609 18:12005208-12005230 GGGCAGAGGTGTACACAAGGTGG + Intronic
1154167056 18:12023580-12023602 GGGCAGAGATGAGCACAGGGCGG - Intronic
1159763111 18:72453414-72453436 GGGAAGAGATGAGAACAACTGGG - Intergenic
1160980948 19:1816356-1816378 CGGCAGAGATCAGCGCACGTGGG + Intronic
1161138971 19:2636943-2636965 GGGCGCAGGTGGGCACAAGTGGG - Intronic
1161245554 19:3249720-3249742 GGTCTGAGAGGACCACAAGTTGG - Intronic
1161246647 19:3256276-3256298 GGTCAGGGATGAGCAGAAGGAGG - Intronic
1161342401 19:3750464-3750486 GGGCAGAGATAAGCACATCTGGG - Intronic
1161500171 19:4610161-4610183 GGGCAGAGAGAAGGACAAGTAGG + Intergenic
1162532262 19:11242795-11242817 GGGCAGAGTTGATCAAATGTAGG - Intronic
1162953940 19:14088274-14088296 GGGCAAAGATAAGGACAAGAGGG + Exonic
1163536207 19:17878063-17878085 GGGCAGAGATGCGCCCCAGGAGG - Exonic
1163699980 19:18782107-18782129 GGGCACAGAGGAGCACAGGCAGG - Exonic
1164999336 19:32748211-32748233 GTGCAGTGGTGAGCACAGGTTGG + Intronic
1165060889 19:33204749-33204771 GGGCAGAGATGAAGGCAGGTGGG - Exonic
1165382386 19:35490382-35490404 GGGCAGAGTGGAGCACCAGGAGG + Exonic
1165422304 19:35728248-35728270 GAGAAGAGATGAGCAGAGGTAGG + Intronic
1166061426 19:40328070-40328092 GCACAGAGCTGTGCACAAGTAGG + Intronic
1202653039 1_KI270707v1_random:23907-23929 CGGCAGTGACGAGCACAAGAGGG + Intergenic
925146643 2:1587123-1587145 GGGCAGAGATGACCACAGGGAGG - Intergenic
925746906 2:7051289-7051311 GTGCAGAGCTGAGCTCCAGTAGG + Intronic
926249456 2:11145750-11145772 GGGAAGAGAGGGGCACAAGATGG + Exonic
926319467 2:11738766-11738788 GGGCAGAGATCTGCAGAAGAAGG + Intronic
926694970 2:15764756-15764778 GGGCAGAGAGGAGGACAGGGTGG + Intergenic
927988541 2:27430318-27430340 GGGCAGAGATGGGCACAAATGGG + Intronic
930024041 2:47019548-47019570 GGTCAGAGTGGATCACAAGTTGG + Intronic
933284756 2:80373906-80373928 GAGCTGAGATGAGGACAGGTAGG - Intronic
934511297 2:94946568-94946590 GGGGAGAGAAGAGGACGAGTGGG - Intergenic
935071411 2:99697318-99697340 GGACAGTGATGGGCAGAAGTTGG - Intronic
935180781 2:100689463-100689485 GGGCTGAGAGGAGCTCAAGAGGG + Intergenic
936224983 2:110640625-110640647 AGGCAGAGTTGAGCACATGTTGG - Intronic
936530053 2:113269850-113269872 GAGCAAAAATGAGCTCAAGTGGG - Intronic
936560319 2:113532768-113532790 GGACAGAGAGAAGCACAAGGCGG - Intergenic
937113685 2:119387753-119387775 GGGCAGAAATGAGGATAAGGGGG - Intergenic
937487072 2:122326330-122326352 GGGGAGAGGAGGGCACAAGTGGG + Intergenic
938287625 2:130130426-130130448 GGGCAAAGAAGAGGACGAGTGGG + Intergenic
938427968 2:131208433-131208455 GGGCAAAGAAGAGGACGAGTGGG - Intronic
938734435 2:134173494-134173516 GTGCAGAGCTGAGAACAAGGGGG - Intronic
942605391 2:177685081-177685103 GGGCAGAAGTGAACAAAAGTGGG - Intronic
943884647 2:193200260-193200282 TGACAGAGATGGGCACAACTAGG + Intergenic
945720718 2:213415501-213415523 GGTGAGAGATGGGCACAGGTTGG + Intronic
947952025 2:234156358-234156380 GAGCAGAGATGAGAACTGGTGGG - Intergenic
948150069 2:235738016-235738038 GGGCACAGAGGAGCACATGTGGG + Intronic
948382242 2:237558926-237558948 GGGAAGAGAAGGGCACAAGGGGG - Intergenic
1169231013 20:3889059-3889081 GGGCAGAGGCATGCACAAGTGGG + Intronic
1169730896 20:8784576-8784598 AGGCTGAGATGAGCAGAGGTGGG + Intronic
1170010403 20:11716370-11716392 GGGCAGAGAAGAGCAGAGGAAGG - Intergenic
1170019168 20:11816709-11816731 GGGTAGAGATGAAAACAAATGGG - Intergenic
1170974762 20:21151806-21151828 GGGCACAGATTACCAAAAGTGGG - Intronic
1171935817 20:31274187-31274209 GGGCAGAGAGGAGCAGCAGCAGG - Intergenic
1172849116 20:37947842-37947864 GGGCAAAGATGGGCAGAAGCAGG - Intergenic
1173257570 20:41405628-41405650 GGCCAGAGAGCTGCACAAGTAGG - Intronic
1173820304 20:46015164-46015186 GGGAAGAGATGAGAACACGGGGG - Intronic
1173917086 20:46715614-46715636 GGAGAGGGATGAGCAGAAGTGGG + Intronic
1175319935 20:58078481-58078503 GGGAAGTGATGAGAACAAGCAGG + Intergenic
1176599114 21:8775744-8775766 GGGCAGTGACGAGCACAAGAGGG - Intergenic
1178860983 21:36289511-36289533 AGGCAGTGAGGAGCACCAGTGGG - Intronic
1179785430 21:43727388-43727410 GGGAATAGATGGGCACAAGGCGG - Intronic
1180419316 22:12799157-12799179 GGGCAGTGACGAGCACAAGAGGG + Intergenic
1182050975 22:27312309-27312331 GGGCAGAGAGGGGAACAAGGAGG + Intergenic
1182053366 22:27330390-27330412 GGGAAGACATGGGCACAGGTGGG - Intergenic
1183520857 22:38295343-38295365 GGCCAGAGAAGAGCATATGTGGG + Intronic
1183522384 22:38303071-38303093 GGGCAGCCATGAGCACAGGGTGG - Intronic
1183953806 22:41367582-41367604 GGCCAGAGAAGAGAACAGGTAGG + Intronic
1184423393 22:44395056-44395078 GGTCAGAGCTGAGCTCAAGACGG + Intergenic
949940663 3:9151850-9151872 GGTCAGAGATAAGCAGAAGCAGG + Intronic
952408490 3:33026369-33026391 GGGCACCGATGAGCACAGGAGGG + Intronic
953669027 3:44947141-44947163 GGGAGGAGATGAGCCCCAGTAGG + Intronic
953867231 3:46595039-46595061 ACACAGAGATGAGCACATGTAGG + Intronic
954002117 3:47566010-47566032 GGGCAGAGAGGAGCAGAGGAGGG + Intronic
955509392 3:59664331-59664353 GGGCTTTGATGAGGACAAGTAGG + Intergenic
957417818 3:79929210-79929232 GGGCACTGATGAGCACAGGAAGG + Intergenic
958033103 3:88137642-88137664 GGGCAGAGACCAGGATAAGTGGG + Intronic
960119112 3:113928148-113928170 GGGCAGAGAGGAGCAAAGCTGGG - Intronic
961312663 3:126013599-126013621 GGACAGAGATGATCACAGGCAGG + Intronic
961771715 3:129254891-129254913 GGGCAGAGATGAGTATGAGGAGG - Intronic
963008820 3:140750560-140750582 GGGCAGAGCTGAGCTCAGGAAGG + Intergenic
963831722 3:150016028-150016050 GTGAAGAGCTGAGCAGAAGTGGG + Intronic
963991555 3:151661960-151661982 GGACAGAGTTGAGTACAATTTGG + Intergenic
967887517 3:194343165-194343187 GGGCAGAGATGGGCAGAGGTGGG - Intronic
968976089 4:3822757-3822779 GGGCGGAGAAGAGCACGTGTTGG - Intergenic
971177118 4:24292579-24292601 GGGTAGGGATGAGCACAGGAAGG - Intergenic
971360810 4:25936775-25936797 GGCCAGGGATGAGCAAAAGTGGG - Intergenic
971769398 4:30877228-30877250 GGCCAGAGCTAAGCAAAAGTTGG + Intronic
972951711 4:44333481-44333503 AGGCAGAGCTGAGCACAAGCTGG + Intronic
973362472 4:49178116-49178138 GGGCAGTGACGAGCACAAGAGGG - Intergenic
973398628 4:49618745-49618767 GGGCAGTGACGAGCACAAGACGG + Intergenic
974374660 4:61060994-61061016 GGGCATATATGATCAGAAGTTGG - Intergenic
978199913 4:106013739-106013761 GGGAAAGCATGAGCACAAGTAGG - Intergenic
978715764 4:111840769-111840791 GGGCAGGGATGGGCACAGGCTGG - Intergenic
979764492 4:124447607-124447629 AGGCAGAGATTAGAACAATTTGG - Intergenic
982802476 4:159722235-159722257 GGGTAGTGATGAGCAAATGTGGG + Intergenic
982869034 4:160552678-160552700 GGGCAGAGAAAAGCACTATTTGG - Intergenic
983125918 4:163950269-163950291 GGGCACTGATAAGCACAAGAGGG - Intronic
983674548 4:170277630-170277652 GAGCAGATACTAGCACAAGTGGG - Intergenic
983783085 4:171697557-171697579 TGGCAGAGATGAATAGAAGTGGG - Intergenic
984596306 4:181672190-181672212 GGGCAAAGATCTGCACAAGATGG - Intergenic
988675503 5:33428681-33428703 GAGCAGAGAGGAGCAAAGGTGGG - Intergenic
989610713 5:43287899-43287921 GGGCAGAGAAGATCTGAAGTGGG + Intergenic
991234781 5:64380858-64380880 GGGCAGAGAAGATCACAAGAAGG + Intergenic
992358271 5:76008597-76008619 GGGAGGAGATGAGCAATAGTTGG - Intergenic
993450006 5:88061714-88061736 GGACAGTGATGAACATAAGTGGG - Intergenic
995307046 5:110664815-110664837 GGGCATAGATGAGGTCACGTTGG - Intronic
997428563 5:133821629-133821651 GTGGAGAGTTGAGCACATGTGGG + Intergenic
998723504 5:144981028-144981050 GGGGAGAGATGAGGAGAGGTAGG + Intergenic
999068235 5:148715230-148715252 GGGCAGAGATTGGAACAATTTGG + Intergenic
999928592 5:156406402-156406424 GGGCACAGGAGAGCAGAAGTAGG - Intronic
1001170736 5:169416779-169416801 GGGCGGAGATGAGAATAAGAAGG + Intergenic
1001265192 5:170269083-170269105 GGGAAGAGATGAGCAAAATGAGG - Intronic
1001754320 5:174156581-174156603 GCGAAGAGATGAGCAAAAGAGGG - Intronic
1002600500 5:180351983-180352005 GGGCAGAGATGAGGCAAAGGTGG - Intronic
1005064372 6:21804142-21804164 GCCCAGAGATGTGGACAAGTTGG + Intergenic
1006616639 6:35332510-35332532 GGGCATAGCTGAACAAAAGTAGG + Intergenic
1006717134 6:36127822-36127844 GGGCAGAGGTGAGCCCAGGAAGG - Intronic
1006815101 6:36844782-36844804 GGGCACAGAAGAGCAGAAGCGGG + Intergenic
1006884209 6:37366971-37366993 GGGCACAAATGAGCAAATGTGGG - Intronic
1007341784 6:41195225-41195247 GTCCAGAGATGAGGACAAGGAGG + Intronic
1008381107 6:50840687-50840709 GGGTAGAGATGGGTACACGTGGG - Intronic
1011349769 6:86409589-86409611 CCACAGAGATGAGAACAAGTTGG - Intergenic
1013420942 6:109966225-109966247 GGGCAGAGATGAGTGAAACTTGG + Intergenic
1013797322 6:113902185-113902207 AGGCCGAGAAGGGCACAAGTGGG - Intergenic
1014959294 6:127662709-127662731 TGGCAGAGATTAGGATAAGTAGG - Intergenic
1015476081 6:133660147-133660169 GGGCATAGCTGAGCAAAAGAGGG - Intergenic
1015732612 6:136363706-136363728 TGGCAGAGGTGAGAACCAGTGGG + Intronic
1016034696 6:139374014-139374036 GGGCAGAGGCGAGCAAAAGTGGG - Intronic
1016076800 6:139805329-139805351 GGGCACCGATGAGCACAGGAAGG - Intergenic
1016384539 6:143517421-143517443 TGGCAAAGGTGAGCACAAGCAGG + Intergenic
1018235598 6:161720497-161720519 GGGCACTGATGGGCACAGGTGGG + Intronic
1018857906 6:167688641-167688663 GGGATGAGATGAGGACAAATGGG + Intergenic
1019469621 7:1211771-1211793 GGGCACAGATGAGGACCGGTGGG + Intergenic
1020282856 7:6659143-6659165 GGGCAGGGAGGAGGACAAGGGGG - Intergenic
1021929427 7:25564794-25564816 GGGCAGAGAAGAGCAGATGAAGG - Intergenic
1022416499 7:30182335-30182357 GGGCAGAGCTGGGCACGAGTAGG - Intergenic
1022528197 7:31051876-31051898 GGGCAAAGAAGAGCCCAAGGAGG + Intergenic
1024924377 7:54597893-54597915 AGGCAGTGAAGAGGACAAGTTGG + Intergenic
1026392076 7:69912051-69912073 GGGCACCCATGAGCACAAGAGGG - Intronic
1029457950 7:100680402-100680424 GGGCGGAGACGAACCCAAGTAGG + Exonic
1029598603 7:101550755-101550777 GGGCTGACATCAGCACACGTGGG + Intronic
1031360010 7:120837815-120837837 GGGGACAGATGAGTACAAATTGG - Intronic
1032269167 7:130388028-130388050 GGCCAGAGAGGAGGACAAGAAGG - Exonic
1032411346 7:131695233-131695255 GTGCATAGATGAGGACAAGCTGG - Intergenic
1035666166 8:1381456-1381478 GTGCAGTGATGACCACAACTGGG + Intergenic
1036085909 8:5612604-5612626 GGGCAGAGATGCACACAAGCGGG + Intergenic
1037563118 8:20092549-20092571 GGTCAGAGAGGAGAACAAGAGGG - Intergenic
1037590597 8:20308849-20308871 GGGCAGTGTTGACCACAAGCAGG + Intergenic
1039100498 8:33936656-33936678 GGGCAGAGAGGATCACATGTGGG + Intergenic
1041398762 8:57419270-57419292 GGATAGAGATGAGCATAAGCGGG + Intergenic
1045363066 8:101450614-101450636 GTGCAGAGAAGAGATCAAGTAGG + Intergenic
1045503717 8:102763031-102763053 GCACAGAGATGAGCACAGATAGG + Intergenic
1046634029 8:116652097-116652119 GGACAGAGATGAGCACAAGAGGG + Intronic
1046702462 8:117417064-117417086 GGACAAAGATCAGCAGAAGTGGG - Intergenic
1049022715 8:139968741-139968763 AGGCCGGGATGAGGACAAGTTGG - Intronic
1049363320 8:142224674-142224696 TGGCAGAGCTGAGCCCAAGCTGG + Intronic
1049892359 9:82579-82601 GGACAGAGAAAAGCACAAGGCGG + Intergenic
1050096733 9:2075028-2075050 GGGCAGAGATAAGATGAAGTAGG + Intronic
1052466853 9:28839926-28839948 GGGCACTGATGAGCACAGGAGGG - Intergenic
1053654076 9:40197699-40197721 GGGGAGAGAAGAGGACGAGTGGG + Intergenic
1053733778 9:41083656-41083678 GGACAGAGAGAAGCACAAGGCGG + Intergenic
1053904463 9:42826875-42826897 GGGGAGAGAAGAGGACGAGTGGG + Intergenic
1054366191 9:64343915-64343937 GGGGAGAGAAGAGGACGAGTGGG + Intergenic
1054530522 9:66178639-66178661 GGGGAGAGAAGAGGACGAGTGGG - Intergenic
1054673821 9:67833645-67833667 GGGGAGAGAAGAGGACGAGTGGG + Intergenic
1054694631 9:68347896-68347918 GGACAGAGAGAAGCACAAGGCGG - Intronic
1056462127 9:86818384-86818406 GGGCACTGATGAGCACAGGATGG + Intergenic
1056586520 9:87931032-87931054 GGGTAGTGATGAGCACAACATGG - Intergenic
1056610358 9:88121910-88121932 GGGTAGTGATGAGCACAACATGG + Intergenic
1056936643 9:90919800-90919822 CGGGAGAAATGAGCACAAGCAGG - Intergenic
1056940925 9:90955639-90955661 GGGCAGAGCTGAGCACAGGACGG + Intergenic
1057379625 9:94555932-94555954 GGGGAGAGAAGAGAACGAGTGGG + Intergenic
1057722814 9:97546448-97546470 AGGCAGGGATGAGGACAAGGAGG - Intronic
1058313227 9:103532809-103532831 GGGCAGAGAGGAGCAAAGTTGGG + Intergenic
1059746603 9:117207204-117207226 GGGCAGATATGCCCACAGGTTGG + Intronic
1061391210 9:130318190-130318212 AGGCAGATATAAACACAAGTTGG - Intronic
1061555615 9:131366732-131366754 GGGCTGAGATGAGAAAGAGTGGG + Intergenic
1062028371 9:134350872-134350894 GGGTACAGATGAGGACAAGGCGG - Intronic
1203691600 Un_GL000214v1:47804-47826 GGGCACTGACGAGCACAAGAGGG - Intergenic
1203644695 Un_KI270751v1:56387-56409 GGGCACTGACGAGCACAAGAGGG + Intergenic
1185996449 X:4955429-4955451 GAGCAGAGGTGAGCAGAATTTGG - Intergenic
1189128044 X:38468745-38468767 GGGCAGAGAGAGGCACACGTTGG - Intronic
1189973684 X:46442052-46442074 GGGCAGAGATGATAACAGGCTGG + Intergenic
1190340717 X:49293115-49293137 GGGCAGAGATGAGGACCAACAGG - Intronic
1194726207 X:97400664-97400686 GGGAAGAGATGGGCAGATGTTGG - Intronic
1195263486 X:103157323-103157345 GGACAGAGATTATCACAGGTGGG + Intergenic
1195940730 X:110165734-110165756 GAGAAGAGATGAGCTCAGGTTGG - Intronic
1196503239 X:116410501-116410523 GGGCAGAGATTGGAACAATTTGG + Intergenic
1198117623 X:133559355-133559377 GGGCAGCGATGAACATAAATTGG + Intronic
1199420966 X:147644164-147644186 GGGCAGAGGTTAGAACAGGTTGG + Intergenic
1199710199 X:150463628-150463650 AGGCAGAGATGAGCAAACCTGGG - Intronic
1199867779 X:151869610-151869632 GGGCAGGGCTGAGCAAAACTGGG - Intergenic
1200749195 Y:6929317-6929339 GGGCACTGATGAGCACAAGAAGG - Intronic
1200796229 Y:7343526-7343548 CGGCAGAGATAAGCACATGGGGG - Intergenic
1201368511 Y:13235048-13235070 GGGCACTGATGAGCATAAGAGGG - Intergenic