ID: 1144555549

View in Genome Browser
Species Human (GRCh38)
Location 17:16279669-16279691
Sequence CAGACTGATGTGTCTATCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 122}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144555545_1144555549 13 Left 1144555545 17:16279633-16279655 CCCATTGTCCTTCTCTTGCTCCA 0: 1
1: 0
2: 5
3: 38
4: 425
Right 1144555549 17:16279669-16279691 CAGACTGATGTGTCTATCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 122
1144555547_1144555549 5 Left 1144555547 17:16279641-16279663 CCTTCTCTTGCTCCAGATTGTCA 0: 1
1: 0
2: 1
3: 30
4: 312
Right 1144555549 17:16279669-16279691 CAGACTGATGTGTCTATCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 122
1144555546_1144555549 12 Left 1144555546 17:16279634-16279656 CCATTGTCCTTCTCTTGCTCCAG 0: 1
1: 0
2: 4
3: 74
4: 555
Right 1144555549 17:16279669-16279691 CAGACTGATGTGTCTATCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 122
1144555548_1144555549 -7 Left 1144555548 17:16279653-16279675 CCAGATTGTCATATCTCAGACTG 0: 1
1: 0
2: 0
3: 5
4: 130
Right 1144555549 17:16279669-16279691 CAGACTGATGTGTCTATCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 122
1144555544_1144555549 14 Left 1144555544 17:16279632-16279654 CCCCATTGTCCTTCTCTTGCTCC 0: 1
1: 0
2: 6
3: 96
4: 1221
Right 1144555549 17:16279669-16279691 CAGACTGATGTGTCTATCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 122
1144555543_1144555549 26 Left 1144555543 17:16279620-16279642 CCTAAACTCTGTCCCCATTGTCC 0: 1
1: 0
2: 2
3: 29
4: 275
Right 1144555549 17:16279669-16279691 CAGACTGATGTGTCTATCAGAGG 0: 1
1: 0
2: 0
3: 9
4: 122

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144555549 Original CRISPR CAGACTGATGTGTCTATCAG AGG Intronic
901610441 1:10493938-10493960 CAGTCGGATGTGTATCTCAGAGG + Intronic
905602931 1:39269526-39269548 CAGAGTGATTTGTCCATCAGTGG + Intronic
905880686 1:41461440-41461462 CAGAATGATGTGTATAGCATGGG - Intergenic
907747522 1:57228091-57228113 CAGACTGAAGTGCCTATAATAGG + Intronic
909523273 1:76593850-76593872 CATACTGATGTGGCGATCATAGG + Intronic
912886590 1:113480782-113480804 CAAATTGATGTTTCTATGAGGGG + Intronic
915116605 1:153605315-153605337 AAGAATGATGTGTCTATGTGTGG - Intergenic
916535934 1:165703367-165703389 TATACTGATATGTATATCAGTGG + Intergenic
918575485 1:186054203-186054225 CACATTGATGTGTCTGTCATTGG - Intronic
920692941 1:208160405-208160427 TAGACTGATCTGGCAATCAGAGG - Intronic
921233595 1:213099799-213099821 CATACTGTTGTGTTCATCAGAGG + Intronic
922414195 1:225405467-225405489 CAGATTAATGTGGCTATCACAGG + Intronic
924496992 1:244600102-244600124 CAGGATGACGTGTCTATCACGGG - Intronic
1065364046 10:24917665-24917687 AAGAGTTATGTGTCCATCAGGGG + Intronic
1067680539 10:48434971-48434993 TAGACTGCTGTCTGTATCAGAGG - Exonic
1069124444 10:64612270-64612292 CTGTCTTATGTGTATATCAGCGG - Intergenic
1072036254 10:91565661-91565683 CAGAATCCTGTGTCTAGCAGAGG + Intergenic
1075872806 10:125782936-125782958 CAGCCTGATGGGTCCCTCAGGGG - Intergenic
1077777214 11:5284850-5284872 GTGCCAGATGTGTCTATCAGAGG - Intronic
1079575101 11:21994336-21994358 GTGACTGATGTTCCTATCAGAGG - Intergenic
1080755619 11:35194762-35194784 CAGAATGATTTTTCCATCAGAGG + Intronic
1082098049 11:48147168-48147190 CACACTGTGGCGTCTATCAGTGG - Intronic
1083118507 11:60488641-60488663 GAGACTGATTTCTCTATTAGGGG + Intergenic
1086022356 11:82246968-82246990 CAAATTGATGTTTCTATCAGGGG - Intergenic
1091151892 11:133336694-133336716 CAGATTGCTGTTGCTATCAGAGG + Intronic
1091979133 12:4851374-4851396 CCCACTCGTGTGTCTATCAGAGG - Intronic
1092026301 12:5243593-5243615 CAGGCTGATGTGCCAGTCAGAGG + Intergenic
1093899323 12:24612360-24612382 CAGATTGATGTTTCTGTGAGAGG - Intergenic
1095671087 12:44861016-44861038 CTAATTGATGTTTCTATCAGGGG - Intronic
1099656246 12:85495587-85495609 CAAATTGATGTTTCTGTCAGGGG + Intergenic
1099827026 12:87789395-87789417 CAAATTGATGTTTCTATGAGGGG + Intergenic
1101287120 12:103326341-103326363 TAGACTGAAGAGTCTATGAGTGG - Intronic
1103189232 12:118986648-118986670 CAGACAGATGTCTCTATCTAGGG - Intronic
1107357339 13:39582130-39582152 GAGACTGATGTGTCTACAGGAGG - Intronic
1108733874 13:53262188-53262210 GATACTGATGTATCTATCTGGGG + Intergenic
1110923333 13:81117492-81117514 AAGGCTGATGTGACTATCAAAGG + Intergenic
1112473738 13:99712207-99712229 AACACTGAAGTGTGTATCAGGGG - Intronic
1114400047 14:22401850-22401872 CAGACTGCTGTTTCCCTCAGAGG + Intergenic
1114510696 14:23257689-23257711 TATACTAATGTGTCTATCATGGG - Intronic
1114631645 14:24163170-24163192 CAGTCTGCTGAGTCTAGCAGTGG - Intronic
1117198652 14:53365309-53365331 AAAACTGATGGGTTTATCAGGGG - Intergenic
1117780129 14:59223516-59223538 TTGCCTGAAGTGTCTATCAGTGG - Intronic
1121593874 14:95143694-95143716 CAGACTGCTGTGCCCATCACAGG - Intronic
1122261799 14:100527797-100527819 CAGGCTGATGTGGCCATCAGAGG - Intronic
1122752582 14:103949414-103949436 CAGATTGAAGTGTTTTTCAGGGG + Intronic
1123108955 14:105856374-105856396 CAGACTGTCATGGCTATCAGGGG + Intergenic
1124530061 15:30498041-30498063 CAGACGGAAGTGGCTCTCAGCGG - Intergenic
1124768598 15:32509647-32509669 CAGACGGAAGTGGCTCTCAGCGG + Intergenic
1125392956 15:39214802-39214824 CAGACTGCTGTTTTTAGCAGAGG - Intergenic
1130425522 15:83794490-83794512 CAGATTGTTGTGTTTATCAATGG - Intronic
1130911898 15:88276663-88276685 CAGAATGATGGGTTTATCAAGGG + Intergenic
1139112320 16:63905586-63905608 CAAACTGATGTGTCTGTGAAGGG + Intergenic
1143274623 17:5700968-5700990 CAGCCTGCTGTGGCTAACAGTGG - Intergenic
1143545427 17:7592518-7592540 CGGACTGATGGCTCTATCAGTGG - Exonic
1144555549 17:16279669-16279691 CAGACTGATGTGTCTATCAGAGG + Intronic
1152805101 17:82351983-82352005 CAGACTGAAGTGACCACCAGGGG + Intergenic
1153488169 18:5622781-5622803 CAGAATGCTGTGACTATTAGGGG + Intronic
1154126793 18:11698871-11698893 CAGACTAATGTGTCATTTAGAGG + Intronic
1156749575 18:40435485-40435507 AATACTGATATTTCTATCAGAGG + Intergenic
1160625677 18:80203060-80203082 TCAACTTATGTGTCTATCAGTGG - Intronic
924997576 2:377062-377084 CAAACTGATGTTTCTGTGAGGGG - Intergenic
930304224 2:49658004-49658026 CAGACGGATGAATCTAACAGGGG + Intergenic
935490083 2:103708610-103708632 AAGAATGATGTGTGTAACAGGGG + Intergenic
939703931 2:145428838-145428860 CAGACAGATGTGGTTATAAGGGG + Intergenic
941086507 2:161124335-161124357 CAGACTGGTGTGCTTATAAGAGG + Intergenic
942306784 2:174616331-174616353 GAGAATCATGTGTCTATAAGAGG + Intronic
942648736 2:178144691-178144713 CATGCTGTTGTGTGTATCAGTGG + Intergenic
943874337 2:193043719-193043741 CAGACTGGTGTGCCCTTCAGAGG - Intergenic
944844140 2:203652236-203652258 AAATCTGATGTCTCTATCAGAGG - Intergenic
945204492 2:207317749-207317771 CAGACTAAAGTGTTTTTCAGGGG - Intergenic
946798017 2:223376931-223376953 CACACTCAAGTGTCTGTCAGAGG + Intergenic
1171197891 20:23215543-23215565 CGGACTCATGAGTCAATCAGTGG - Intergenic
1172994254 20:39058311-39058333 CACACTGATGTGTTTATTAAGGG + Intergenic
1173348068 20:42219224-42219246 CAGACTTATCTTTCCATCAGCGG - Intronic
1176362182 21:6006814-6006836 CAGACTGAACAGTCTCTCAGTGG - Intergenic
1179761336 21:43531731-43531753 CAGACTGAACAGTCTCTCAGTGG + Intronic
1181535607 22:23541435-23541457 CAGGCTGATGTTTCTGTCATCGG + Intergenic
1182457546 22:30461515-30461537 CAGCCTGATGGGTCTCTGAGGGG + Intronic
951465814 3:22999579-22999601 CACACTAATGTGAATATCAGAGG - Intergenic
955118432 3:56030708-56030730 CAAATTGATGTTTCTGTCAGAGG - Intronic
955487837 3:59452547-59452569 CAAACTGATGTGGTTGTCAGGGG - Intergenic
957219751 3:77366677-77366699 CAGACTGATGCCCTTATCAGAGG - Intronic
959070288 3:101695424-101695446 CAGGCTGATGTTTCTATCATCGG + Intergenic
961655895 3:128441610-128441632 CAGACAGATGTGACAACCAGGGG - Intergenic
965318785 3:167225601-167225623 AAGACTGATTTGACTATCGGGGG + Intergenic
968352897 3:198076321-198076343 AAAACTGATGTGCCTTTCAGTGG - Intergenic
977756590 4:100678844-100678866 CAGAGTGATGTCACTAGCAGTGG + Intronic
979808711 4:125008366-125008388 CAGACTTATTTATCTATAAGTGG - Intergenic
983743740 4:171168345-171168367 CATTCTGATGTTTCTTTCAGTGG - Intergenic
984851008 4:184152408-184152430 CAGCCTGATGGGTCTGTGAGTGG - Intronic
985970341 5:3373236-3373258 CACACAGATGTGTCTCCCAGTGG + Intergenic
988661521 5:33275240-33275262 CATAATGATGTTTCTGTCAGTGG - Intergenic
994361720 5:98858311-98858333 CTGAGTTAAGTGTCTATCAGAGG + Exonic
998824286 5:146085113-146085135 CAGACTGATGTATTTTTAAGTGG - Intronic
1001146509 5:169189157-169189179 CCGACTCATGTGTGTATTAGTGG - Intronic
1001188129 5:169597848-169597870 CAGCCTTATGTTTCCATCAGTGG + Intronic
1001525081 5:172423170-172423192 CAAACTGAGGTGACTATTAGAGG + Intronic
1002859552 6:1068452-1068474 CAGAATTGTGTGTGTATCAGTGG - Intergenic
1003077944 6:2999417-2999439 CAAGCTGATGAGTGTATCAGTGG + Intronic
1003504118 6:6725679-6725701 CAGATTGAAGCGTCTAGCAGAGG + Intergenic
1008230270 6:48978703-48978725 CAGCCTGATGTTTCTTTCAAAGG - Intergenic
1009302994 6:62050949-62050971 CAGGTTGTTGTGTCAATCAGTGG - Intronic
1010248725 6:73686243-73686265 CAAATTGATGTGTCTCTGAGGGG + Intergenic
1010913301 6:81585871-81585893 GAGACTGATGGCTTTATCAGTGG - Intronic
1011242235 6:85285329-85285351 CAGACTGATGTGTACATCACAGG - Intergenic
1011403821 6:86994777-86994799 CAGTCTGATGTGGTTCTCAGTGG + Intronic
1016692199 6:146950891-146950913 CAGACTGGTGTCTTTATAAGAGG - Intergenic
1023342645 7:39238048-39238070 CAGACATCTGTGTCTTTCAGGGG - Intronic
1027423788 7:78041948-78041970 CAGACCCCTGTGTCTATCACAGG - Intronic
1031872930 7:127107310-127107332 TAGAATGATGTTTCTATGAGAGG - Intronic
1035926240 8:3730754-3730776 CAGAGTTATGTGTCACTCAGAGG + Intronic
1040552459 8:48449095-48449117 CAGGCTGATGAGGCTGTCAGTGG - Intergenic
1040824520 8:51607169-51607191 CAGACTGATCTGTATAGCAGTGG + Intronic
1041208807 8:55525393-55525415 CAAAGTGATGTGTCTTTTAGAGG + Exonic
1042014668 8:64294997-64295019 CAGAAGGTTATGTCTATCAGAGG - Intergenic
1047812786 8:128428688-128428710 CAGTCTGAGGTGTCAGTCAGGGG - Intergenic
1050088353 9:1990645-1990667 CAGACTTATTTGTATATCAGGGG - Intergenic
1051348031 9:16170328-16170350 CAGGTTGATGTGTCTTTCAATGG - Intergenic
1055200168 9:73649338-73649360 CAGGCAGATGTGGCTAGCAGTGG - Intergenic
1056125010 9:83527376-83527398 CATCCTGGTGTGTCTATCACAGG - Intronic
1056571122 9:87816031-87816053 CAGACTGCTTTGTCTATTTGGGG - Intergenic
1058556783 9:106177236-106177258 ATGACTGATGTTTCTATCTGTGG - Intergenic
1060031488 9:120218341-120218363 CAGACTGAGGTGCCCCTCAGAGG - Intergenic
1061947016 9:133914164-133914186 GAGACAGATGTGTCTCACAGCGG + Intronic
1062695820 9:137875875-137875897 CAGGCTGATGTGGCTTTCAAAGG + Intergenic
1186706121 X:12140343-12140365 AAGACTGATGTGTTAAGCAGTGG + Intronic
1187350129 X:18506113-18506135 CAGACTGATGTGACTCCCACTGG - Intronic
1188875475 X:35425401-35425423 CAGGCTGCTGTGTGTATCAGTGG - Intergenic
1190144988 X:47882437-47882459 CAGGTTGTTGTGTCTATCCGTGG + Intronic
1191956808 X:66651184-66651206 CAAACTGATGTTTCTACAAGAGG - Intergenic
1192084972 X:68087083-68087105 CAGACTGATTTGGCTTTCTGTGG + Intronic
1196302654 X:114064515-114064537 AAATCTGATGTGTTTATCAGGGG + Intergenic