ID: 1144557417

View in Genome Browser
Species Human (GRCh38)
Location 17:16294466-16294488
Sequence GCTTGGTTATAGAGGGCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 107}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144557417_1144557425 10 Left 1144557417 17:16294466-16294488 CCCGCTGCCCTCTATAACCAAGC 0: 1
1: 0
2: 0
3: 10
4: 107
Right 1144557425 17:16294499-16294521 TTATTGCTTTTCCATAAAGCTGG 0: 1
1: 0
2: 1
3: 24
4: 272

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144557417 Original CRISPR GCTTGGTTATAGAGGGCAGC GGG (reversed) Intronic
900688487 1:3964938-3964960 CCTTGTTTAAAGATGGCAGCAGG - Intergenic
905252900 1:36661071-36661093 GCTTGGTGAAGGAGGGCAGCAGG + Intergenic
905733586 1:40312008-40312030 GCTTGGAGATAGAAGGCAGGAGG + Intronic
910339715 1:86172321-86172343 ACTTGGTAATACAGGGCAGTTGG + Intergenic
913398242 1:118396884-118396906 GCTTGTTGACAGAGTGCAGCAGG - Intergenic
916748626 1:167703851-167703873 GCTGGGTTAAAGTGGGCTGCAGG - Intronic
916826802 1:168449809-168449831 CCTTGGTTTGAGAGTGCAGCAGG + Intergenic
918966732 1:191360317-191360339 TCATGGTTATAGAGGCCAGAAGG + Intergenic
1063568136 10:7190727-7190749 GCTTGATCAGAGAGGGTAGCAGG + Intronic
1066406641 10:35125782-35125804 GCATGGTTATAGAGTACAGTAGG - Intergenic
1066433742 10:35377462-35377484 ACTTGGTTATATAGGACAGCCGG - Intronic
1068911434 10:62382299-62382321 CATTGGATATAGAGGTCAGCGGG + Intronic
1069398270 10:68014113-68014135 GCTTGGTGGTAATGGGCAGCTGG - Exonic
1078730819 11:13972320-13972342 TCTAGGTTAAAGAGGGAAGCAGG - Intronic
1079036652 11:17025987-17026009 GCTAGGATACAGAGGGGAGCTGG - Intergenic
1079172356 11:18108419-18108441 GATTGGTGAGAGATGGCAGCAGG + Intergenic
1080616849 11:33952153-33952175 TCATGGACATAGAGGGCAGCAGG + Intergenic
1084081744 11:66831601-66831623 GAATGATTATAAAGGGCAGCAGG + Intronic
1096238187 12:49943746-49943768 GCTTCCTTATAGGAGGCAGCTGG - Intergenic
1098219470 12:68253286-68253308 GGTTGGTGATATAGGGCTGCTGG + Exonic
1103102261 12:118188540-118188562 GCTTGCTTTTAGACAGCAGCAGG + Intronic
1105738004 13:23292023-23292045 GATTGGTGAGTGAGGGCAGCAGG - Intronic
1107978073 13:45709025-45709047 GGTTGGTAAAAGAGGGCTGCTGG + Intronic
1114705108 14:24717203-24717225 GCATGCTTATAGAGGGAAGTAGG + Intergenic
1115683372 14:35766913-35766935 GCTTGGTTTGAGAGTGCAACAGG - Intronic
1116880386 14:50161756-50161778 GGTTGGTTTGAGAGGGCAGTAGG - Intronic
1119289209 14:73481462-73481484 GCTAGGTGAAAGAAGGCAGCCGG + Intronic
1123986672 15:25652538-25652560 GCTTGGCTATGGAGGGCAGGTGG + Intergenic
1125844677 15:42840942-42840964 GCTGGGGCATAGAGGGGAGCAGG + Intronic
1128998137 15:72311916-72311938 GCTTGGGTAGAGAGGGCAGATGG - Intronic
1129186191 15:73908490-73908512 GCTAGGTTGGAGAGGGCTGCAGG - Intergenic
1129655723 15:77524576-77524598 TCTTGGTGATAGAGGTCAGATGG - Intergenic
1131157792 15:90085448-90085470 ATTGGGTTGTAGAGGGCAGCAGG - Intronic
1131765200 15:95668386-95668408 GTTGGCTTATAAAGGGCAGCCGG - Intergenic
1137615925 16:49846925-49846947 GCATGGCTGGAGAGGGCAGCTGG - Intronic
1137765400 16:50973927-50973949 ACTTGGAGATGGAGGGCAGCAGG - Intergenic
1143298374 17:5888669-5888691 TCTTGGTTCTAGAAGGCAGATGG - Intronic
1144557417 17:16294466-16294488 GCTTGGTTATAGAGGGCAGCGGG - Intronic
1145083180 17:19912808-19912830 CCTTCCTTATTGAGGGCAGCTGG - Intronic
1145979078 17:29001219-29001241 GCTTGGTTAGAAAGGGGAGGCGG - Intronic
1146443594 17:32917957-32917979 CCTTGGTAATTGAGGGCAACTGG + Intergenic
1149531512 17:57399319-57399341 GCTTGGTTCTAATGGGCAGAAGG + Intronic
1151274268 17:73022175-73022197 TCTTGGTTTTCTAGGGCAGCTGG - Intronic
1152809725 17:82375725-82375747 GCTTCGTCACAGAGGGCAGCAGG + Intergenic
1156525361 18:37762519-37762541 GCTTGGTTAAATAGGCCAGCTGG + Intergenic
1157443690 18:47729343-47729365 GCTTGTTTCCAGGGGGCAGCCGG + Intergenic
1160070847 18:75626490-75626512 CCTTAGCTATGGAGGGCAGCTGG - Intergenic
1160237730 18:77099238-77099260 GCCTGGCTATAGATGGCAGGGGG + Intronic
1161101321 19:2423499-2423521 GGGTGGTGATAGAGGGCGGCGGG + Intronic
1163625092 19:18384692-18384714 GCTTGGTGAAAGAGTGCAGGAGG + Intronic
1166257744 19:41618581-41618603 GCCTGGGTGAAGAGGGCAGCAGG + Intronic
1168673042 19:58255897-58255919 CCTTGGTAACTGAGGGCAGCTGG - Intronic
927936537 2:27079500-27079522 GCTAGGATACAGAGGGCAGCTGG - Intronic
928135436 2:28684360-28684382 GCCGGGTTACAGAGGGTAGCAGG - Intergenic
929016768 2:37505157-37505179 GCCAGGTTTTAAAGGGCAGCAGG + Intergenic
929526377 2:42706995-42707017 CCTGGGTTACAGAGGGAAGCGGG - Intronic
930291927 2:49505322-49505344 GCTAGGTTATAGAGTACAGGAGG + Intergenic
934063754 2:88320680-88320702 GCTTGGGGAAAGAGTGCAGCTGG - Intergenic
939907795 2:147939455-147939477 GATGGGTTAGAGAGAGCAGCAGG - Intronic
946700580 2:222408849-222408871 GCTTGGTTAGTGAGAGAAGCAGG - Intergenic
1169895536 20:10501610-10501632 ACTTGGTTCTCGAGGGCAGCAGG + Intronic
1170507407 20:17041802-17041824 GTTTGCTTTTAGAAGGCAGCTGG + Intergenic
1170933688 20:20791998-20792020 GGTGGGTTATAGACTGCAGCTGG + Intergenic
1173306320 20:41853840-41853862 GCTTGGATATATACAGCAGCAGG + Intergenic
1173504542 20:43576464-43576486 GCCTGGTTTTAGAAGGCAGCAGG - Intronic
1176663033 21:9658042-9658064 GAATGGTTATAGAGTGCAGAGGG + Intergenic
1179710353 21:43209734-43209756 GCTTGGCTACACAGGGCTGCTGG + Intergenic
1181556450 22:23674398-23674420 GCTTGGTTTTAGTGTGCTGCTGG - Intergenic
1184755350 22:46512734-46512756 TCCTGCTTATAGAGGGTAGCGGG + Intronic
953411638 3:42693564-42693586 GCTGGGTCATAGAGGGCGGGGGG - Intronic
953650169 3:44795365-44795387 GGTTGGTTAGAGAGGCAAGCAGG + Intronic
961956724 3:130811857-130811879 GCTTGGTTAGAGAGTCTAGCAGG + Intergenic
971351224 4:25857935-25857957 GCTTAGTTATACTGGGGAGCTGG - Intronic
978333782 4:107644413-107644435 TCTTTGTTAAAGAGGGGAGCTGG - Intronic
979579877 4:122345182-122345204 GCTAGGTGATTGAGGGGAGCAGG + Intronic
982600470 4:157443230-157443252 CCTTGGTCAGAGACGGCAGCAGG + Intergenic
985672137 5:1212551-1212573 CCTGGGTTTTAGAGTGCAGCCGG - Intronic
988638700 5:33016985-33017007 GCGTTGTTATAGAGGGATGCAGG + Intergenic
991499644 5:67264180-67264202 GCTGGGTTTAAGAGAGCAGCTGG + Intergenic
998116716 5:139543433-139543455 ACGTGGGTATAGAGGGAAGCTGG - Intronic
999929045 5:156410657-156410679 GCTGGGTTAAAGAGAGCAGGGGG - Intronic
1000751746 5:165103710-165103732 GATGGGTTATACAGGGCAGGAGG - Intergenic
1002029495 5:176417170-176417192 GCCTGTTCACAGAGGGCAGCGGG - Intergenic
1002838122 6:882641-882663 GATTGTTTATGGAGGGGAGCAGG + Intergenic
1003011775 6:2433665-2433687 GCTGAGATACAGAGGGCAGCGGG - Intergenic
1005824444 6:29624323-29624345 GCTTGGTGACAGAGGGAAGGGGG - Intronic
1005999996 6:30956995-30957017 CCTGGGTTCTAGAGGGCAGATGG - Intergenic
1006822946 6:36913149-36913171 GCATGGTAACAGAGGGAAGCTGG + Intronic
1010079930 6:71848916-71848938 GTTTTGTTATAGAAGGCATCTGG + Intergenic
1013807376 6:114010821-114010843 GCTTGGAAATTGAGGGCAACTGG - Intronic
1014769006 6:125440024-125440046 GCTTGGTTTAAGATGCCAGCAGG - Intergenic
1015364100 6:132377627-132377649 ACTTGGTTACATAGGGCAGATGG - Intronic
1017064601 6:150517745-150517767 ACTTGGTGATAGAGGGAAGGGGG - Intergenic
1018685258 6:166299061-166299083 GCTTGCTCAGAGAGGGCAGTGGG + Intergenic
1020801444 7:12737616-12737638 CCTTGGTGATAGGAGGCAGCTGG - Intergenic
1020914498 7:14175523-14175545 GCTTGGGCAAAGATGGCAGCAGG - Intronic
1026979419 7:74517876-74517898 GCTTGGTCGGGGAGGGCAGCAGG + Intronic
1028534396 7:91875741-91875763 GCATGGATATAAAGGGTAGCAGG - Intronic
1028961172 7:96751108-96751130 GCATGGTTTTACATGGCAGCAGG + Intergenic
1034057184 7:148047867-148047889 GATTGGTTATAGATGGCAACTGG + Intronic
1035074361 7:156168753-156168775 GCTTGTCTGCAGAGGGCAGCGGG + Intergenic
1037907907 8:22726271-22726293 GCTTAGGTATGGAGGGCAGATGG + Intronic
1043259626 8:78180307-78180329 CCTTGGTAATTGAGGGCAACTGG - Intergenic
1049323990 8:142012289-142012311 GCTTGGTTCCAAAGGGCTGCTGG + Intergenic
1051610739 9:18959350-18959372 GCATGATTAAAGAGGGCAGATGG + Intronic
1052135819 9:24908618-24908640 CCTTGGATATGGAGGGCAGTGGG + Intergenic
1053413165 9:37928803-37928825 GCTTGGTTCCAGAGGGCTCCAGG + Intronic
1055069926 9:72155611-72155633 GCTATGTTATGGAGGGCATCGGG + Intronic
1060278572 9:122200411-122200433 GCTTGGTCTCAGAGGGCAGTAGG + Intergenic
1060750509 9:126165470-126165492 CCTTGGTGACAGAGGGAAGCGGG + Intergenic
1061152044 9:128834315-128834337 CCCTGGGTATAGAGGGCAGAGGG + Intronic
1187810975 X:23176325-23176347 GCTTGGTTACTGAGAGTAGCTGG - Intergenic
1196202676 X:112903235-112903257 GCTGGGTTATACATGGCAGAGGG - Intergenic
1196750781 X:119115642-119115664 GCCTGGTTGGAGCGGGCAGCAGG + Intronic
1196789358 X:119450100-119450122 GCTTGGTTTTGGAGGTCAGTGGG + Intronic
1197652750 X:129083719-129083741 TCTAGGTAATAGAAGGCAGCGGG + Intergenic
1199896889 X:152135414-152135436 GCTTGGTATTAGAGGATAGCAGG + Exonic
1200362679 X:155627222-155627244 GGTTGGTTACAGGGGGCAGGTGG - Intronic