ID: 1144565054

View in Genome Browser
Species Human (GRCh38)
Location 17:16353144-16353166
Sequence GTCGCGGGAGTCGGCGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 553
Summary {0: 1, 1: 0, 2: 2, 3: 65, 4: 485}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144565037_1144565054 21 Left 1144565037 17:16353100-16353122 CCCGCTGCTCGCCCAGGTCCAGG 0: 1
1: 0
2: 2
3: 45
4: 373
Right 1144565054 17:16353144-16353166 GTCGCGGGAGTCGGCGGCGGCGG 0: 1
1: 0
2: 2
3: 65
4: 485
1144565035_1144565054 29 Left 1144565035 17:16353092-16353114 CCAGCGCTCCCGCTGCTCGCCCA 0: 1
1: 0
2: 5
3: 22
4: 223
Right 1144565054 17:16353144-16353166 GTCGCGGGAGTCGGCGGCGGCGG 0: 1
1: 0
2: 2
3: 65
4: 485
1144565044_1144565054 3 Left 1144565044 17:16353118-16353140 CCAGGTTGGACGCCGAGGACGTC 0: 1
1: 0
2: 0
3: 2
4: 23
Right 1144565054 17:16353144-16353166 GTCGCGGGAGTCGGCGGCGGCGG 0: 1
1: 0
2: 2
3: 65
4: 485
1144565041_1144565054 10 Left 1144565041 17:16353111-16353133 CCCAGGTCCAGGTTGGACGCCGA 0: 1
1: 0
2: 0
3: 4
4: 35
Right 1144565054 17:16353144-16353166 GTCGCGGGAGTCGGCGGCGGCGG 0: 1
1: 0
2: 2
3: 65
4: 485
1144565042_1144565054 9 Left 1144565042 17:16353112-16353134 CCAGGTCCAGGTTGGACGCCGAG 0: 1
1: 0
2: 2
3: 2
4: 56
Right 1144565054 17:16353144-16353166 GTCGCGGGAGTCGGCGGCGGCGG 0: 1
1: 0
2: 2
3: 65
4: 485
1144565039_1144565054 20 Left 1144565039 17:16353101-16353123 CCGCTGCTCGCCCAGGTCCAGGT 0: 1
1: 0
2: 1
3: 30
4: 242
Right 1144565054 17:16353144-16353166 GTCGCGGGAGTCGGCGGCGGCGG 0: 1
1: 0
2: 2
3: 65
4: 485
1144565050_1144565054 -9 Left 1144565050 17:16353130-16353152 CCGAGGACGTCGGGGTCGCGGGA 0: 1
1: 0
2: 0
3: 7
4: 52
Right 1144565054 17:16353144-16353166 GTCGCGGGAGTCGGCGGCGGCGG 0: 1
1: 0
2: 2
3: 65
4: 485
1144565034_1144565054 30 Left 1144565034 17:16353091-16353113 CCCAGCGCTCCCGCTGCTCGCCC 0: 1
1: 0
2: 3
3: 24
4: 202
Right 1144565054 17:16353144-16353166 GTCGCGGGAGTCGGCGGCGGCGG 0: 1
1: 0
2: 2
3: 65
4: 485

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144565054 Original CRISPR GTCGCGGGAGTCGGCGGCGG CGG Exonic
900116993 1:1033183-1033205 CGCGCGGGAGTCGGGGGCGCCGG + Intronic
900117685 1:1035460-1035482 GTCCTGGGAGTCCGCAGCGGTGG + Intronic
900189984 1:1349227-1349249 CGCGCGGGAGCCGGGGGCGGCGG - Intronic
900349747 1:2228689-2228711 GGCGCGCGGGGCGGCGGCGGGGG + Exonic
901086684 1:6615060-6615082 GTCGCGGGGGGCGGCTGCCGCGG + Intronic
901607749 1:10472493-10472515 GTCGCGGGAGGCCGGAGCGGCGG + Exonic
901811305 1:11768128-11768150 GCAGCGGGAGCCAGCGGCGGCGG + Exonic
902600893 1:17539700-17539722 GTCGCGCACGGCGGCGGCGGCGG + Intergenic
902823238 1:18956232-18956254 GGCGGGGGCGGCGGCGGCGGCGG - Exonic
903115630 1:21176579-21176601 GGCGGCGGAGGCGGCGGCGGCGG - Intronic
903652449 1:24930185-24930207 GGGGCGGGAGGCGGCGGCAGCGG - Intronic
903829118 1:26164412-26164434 CTCGCAGGCGGCGGCGGCGGCGG - Intergenic
904199785 1:28812268-28812290 GGCGCGGCAGCCGGCGGCGTCGG + Exonic
904701656 1:32361768-32361790 GTCCTGGGACTCGGGGGCGGCGG + Exonic
904719958 1:32500485-32500507 GTAGCGGGCGGCGGCGGCGGCGG + Intronic
904756169 1:32770007-32770029 GGCGCTGGAGGCGGAGGCGGAGG + Exonic
905212779 1:36385871-36385893 ATGGAGGGAGGCGGCGGCGGCGG - Exonic
905632136 1:39524781-39524803 GTCGCGGGAGTGGAAGGCAGAGG + Intronic
907197484 1:52698349-52698371 GTCACGTGAGCCGGCGGAGGGGG + Exonic
908473923 1:64470529-64470551 ATCGCGGGGCTCCGCGGCGGTGG - Intergenic
909622500 1:77683477-77683499 CTGGCGGGCGGCGGCGGCGGCGG + Intergenic
909643099 1:77888588-77888610 GCTGCTGGAGACGGCGGCGGCGG + Intronic
910676395 1:89820953-89820975 GTCGCGGCACTCGCCGGCTGCGG + Intronic
912305205 1:108560114-108560136 GGCGGCGGAGGCGGCGGCGGCGG + Exonic
912305239 1:108560254-108560276 GCCGCGAGAGGCGGCGGCAGCGG + Exonic
915912723 1:159924591-159924613 GTCGTGGGGGTGGGGGGCGGCGG - Intronic
916890264 1:169106629-169106651 GGAGGGGGAGGCGGCGGCGGCGG - Exonic
916922681 1:169485724-169485746 GTCTCGGCGGGCGGCGGCGGCGG - Exonic
918365649 1:183805129-183805151 GTCGCGCGCACCGGCGGCGGCGG + Intronic
919362105 1:196608822-196608844 CTGGCGGGAATCGGGGGCGGTGG + Exonic
921432847 1:215083196-215083218 GACGCGGGAGGGGGCGGGGGGGG - Intronic
922705637 1:227788719-227788741 GGCCCGGGACTCCGCGGCGGGGG - Intergenic
923163750 1:231339582-231339604 ATCGCGGGAGGCGCCCGCGGGGG + Intronic
924415164 1:243850287-243850309 GGAGCGGGAGGCGGCGGCGGCGG + Intronic
1064443184 10:15371311-15371333 GGCGCGGGCAGCGGCGGCGGCGG - Intergenic
1065099756 10:22321366-22321388 GGAGCGGGAGGAGGCGGCGGCGG + Exonic
1065520572 10:26567288-26567310 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1065520574 10:26567294-26567316 GGCGCGGGCGCGGGCGGCGGCGG - Exonic
1065660284 10:27998933-27998955 GGAGCGGAAGGCGGCGGCGGCGG - Intronic
1065712871 10:28533651-28533673 GCGGCGGGGGGCGGCGGCGGGGG + Intronic
1066402592 10:35090265-35090287 GTGGGCGGAGGCGGCGGCGGCGG + Exonic
1066464210 10:35639463-35639485 GGCGGGGGACCCGGCGGCGGCGG - Exonic
1067267117 10:44756028-44756050 GTCTCGGGAGACGGGGGCCGAGG - Intergenic
1067972722 10:50991327-50991349 TTCTCGGGCGGCGGCGGCGGCGG - Intergenic
1068690155 10:59906294-59906316 GGCGGGGGAGGCGGCGGCGGTGG - Exonic
1069386180 10:67884946-67884968 GTGGCGGGAGGCGGAGGCAGAGG + Exonic
1070112033 10:73495822-73495844 GCCCCGGGAGGGGGCGGCGGGGG + Exonic
1071086825 10:81875239-81875261 GGCGCGGGCTCCGGCGGCGGCGG - Intergenic
1071579506 10:86756614-86756636 CTGGCAAGAGTCGGCGGCGGTGG + Intergenic
1071966594 10:90858110-90858132 GCGGCCGGAGGCGGCGGCGGCGG - Intergenic
1072102211 10:92239833-92239855 GGCGCGGGCGCAGGCGGCGGCGG + Exonic
1072263244 10:93702532-93702554 GTTGCGGGCGGCGGCGGCGGCGG - Exonic
1073035688 10:100562852-100562874 GTGGCGGGAGGAGGCGGCCGGGG + Intergenic
1073503897 10:103967244-103967266 GCCGCGGGAGCGGACGGCGGCGG + Exonic
1073812289 10:107164423-107164445 GCCCCGGGCGTCTGCGGCGGCGG - Exonic
1073959807 10:108912644-108912666 GTCGGGGGGGTGGGGGGCGGGGG + Intergenic
1075697484 10:124447622-124447644 GCGGCGGGGGGCGGCGGCGGCGG - Exonic
1076722035 10:132397012-132397034 CTCCCGGGACGCGGCGGCGGCGG + Intergenic
1076892951 10:133293731-133293753 CTCGCAGGAGTCGGCCGTGGTGG - Exonic
1077058597 11:607960-607982 GGCGCTGGAGTCGGAGCCGGTGG - Exonic
1077214543 11:1389990-1390012 GGCGCGGGCCTCGGCGGCGGCGG + Intronic
1077214582 11:1390113-1390135 GACGCGGGGGGCGGCGGCGCGGG + Intronic
1080503770 11:32893165-32893187 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1081851551 11:46278093-46278115 GTCCCGGGAGCCGGCTGCGATGG + Exonic
1081969147 11:47186309-47186331 GACGCGCGGGTAGGCGGCGGCGG - Intronic
1083171092 11:60924496-60924518 GGGGCGGGCGGCGGCGGCGGCGG + Exonic
1083571374 11:63763752-63763774 GGCGGGGGAGGAGGCGGCGGCGG + Exonic
1083644748 11:64165787-64165809 GGCGTGGGGGGCGGCGGCGGTGG - Exonic
1084083397 11:66843512-66843534 GCCGCCCGAGTCGGCGGCGCTGG + Exonic
1084146156 11:67266438-67266460 CGCGCGGGCGGCGGCGGCGGCGG + Exonic
1084284260 11:68121304-68121326 GGCGCGCGGGGCGGCGGCGGCGG + Intronic
1084310229 11:68312517-68312539 GGCGCGGGTGGCGGCGGCGGGGG + Intergenic
1085165816 11:74398452-74398474 GGGGCGGGCGGCGGCGGCGGCGG - Exonic
1086887743 11:92224599-92224621 CGCGCGGGAGGGGGCGGCGGAGG - Intergenic
1089993426 11:122882896-122882918 GGCCCGGGCGGCGGCGGCGGCGG + Exonic
1090194046 11:124800078-124800100 GCCCCGGCAGGCGGCGGCGGCGG + Exonic
1090537393 11:127658790-127658812 GGAGCAGGAGGCGGCGGCGGTGG - Intergenic
1090788742 11:130070930-130070952 GCCGCGGGAGGGGGCGGGGGCGG + Intronic
1091335599 11:134763237-134763259 GGCCTGGGAGCCGGCGGCGGTGG + Intergenic
1091434231 12:460572-460594 GGCGCGGGGGTGGGCGGCGGCGG + Intronic
1091915659 12:4270658-4270680 GGCGCGGGGGTGGGGGGCGGCGG - Intergenic
1092518435 12:9240403-9240425 GCTGCCGGAGTCCGCGGCGGCGG + Intergenic
1092796048 12:12111069-12111091 GCTGCCGGAGTCCGCGGCGGCGG - Intronic
1093464990 12:19439895-19439917 GGCGGCGGAGGCGGCGGCGGAGG + Exonic
1094375481 12:29784015-29784037 GTCCCGGGATTGGGGGGCGGTGG - Intronic
1094564938 12:31590855-31590877 TTCCCGGGCGGCGGCGGCGGCGG - Exonic
1094625007 12:32115025-32115047 GTGGGGGGTGTGGGCGGCGGGGG + Intronic
1094653432 12:32399393-32399415 GCCGGAGGAGGCGGCGGCGGCGG + Intergenic
1095261663 12:40105624-40105646 GGCGCGGGCGGCGGCGGCGTCGG - Exonic
1096593080 12:52675338-52675360 GGCTCTGGAGGCGGCGGCGGCGG - Exonic
1096700582 12:53380392-53380414 CGGGCGGGAGGCGGCGGCGGCGG + Intronic
1096784415 12:54009057-54009079 GGCGCGGGCGGCGGCGGCGGCGG - Intronic
1096788507 12:54031231-54031253 CTCCCGGGAGTTGGAGGCGGGGG + Intronic
1096848168 12:54419123-54419145 GCAGCGGGGGTCGGCGCCGGGGG + Exonic
1097046263 12:56189558-56189580 GCGGCGGGAGGCGGCGGCCGCGG - Intronic
1097107673 12:56634960-56634982 GCCGCAGGCGGCGGCGGCGGCGG + Intronic
1097164877 12:57078669-57078691 GGCTCGGGAGTCGGGGGCGGTGG - Exonic
1097990000 12:65824563-65824585 GTGGCGGGAGCAGGCAGCGGCGG - Exonic
1099989761 12:89709306-89709328 GGCGCGAGCTTCGGCGGCGGTGG - Intergenic
1100391438 12:94148881-94148903 GACGCGGGCGGCGGCGGCGGCGG - Exonic
1101466802 12:104957977-104957999 GGCTCGGGACCCGGCGGCGGGGG - Intronic
1101592795 12:106138891-106138913 GTCGGGCGAGGTGGCGGCGGTGG + Exonic
1101900460 12:108788120-108788142 GTCCTGGGAGTCAGCGACGGTGG + Exonic
1102003571 12:109573848-109573870 GGCCGGGGAGGCGGCGGCGGCGG + Exonic
1103407455 12:120686353-120686375 CTGGCGGGAGTCGCCGCCGGCGG - Intergenic
1103649617 12:122422575-122422597 GAGGCGGGAGGCGGCGGCCGCGG - Intronic
1104376169 12:128267073-128267095 GTCGCGGGGCTCGGCGGGGGCGG + Intergenic
1106322962 13:28659270-28659292 GTCCCCGGTGGCGGCGGCGGCGG + Intronic
1106478028 13:30114800-30114822 GCTGCGGGAGGCGGCGGCGGCGG + Intergenic
1108747289 13:53408817-53408839 GTCGTGGGAGTGGGTGGAGGGGG + Intergenic
1110219550 13:73059038-73059060 CTCGCGGAGGTCGGCGGTGGCGG + Exonic
1110630151 13:77698100-77698122 GGCGCGGCGGGCGGCGGCGGCGG - Intronic
1110705922 13:78602145-78602167 GGCCCGGGGGGCGGCGGCGGCGG - Exonic
1110705971 13:78602250-78602272 GGCGCGGCGGCCGGCGGCGGCGG - Exonic
1111396250 13:87672489-87672511 GCGGCGGGAGGGGGCGGCGGAGG - Intergenic
1111676810 13:91398651-91398673 GGCGGCGGAGGCGGCGGCGGCGG + Intergenic
1112054529 13:95677573-95677595 GCCGCAGGAGTCGGAGGAGGCGG + Intronic
1112216366 13:97434432-97434454 GTCGCGGGCGGCGGCGGCGGCGG + Exonic
1112402081 13:99086371-99086393 GCCGCGGGAGCAGGCGGAGGCGG - Intronic
1112505078 13:99970573-99970595 TGCGCGGGCGCCGGCGGCGGCGG + Exonic
1113020314 13:105877676-105877698 GTGGCAGGAGGCGGCGGTGGGGG + Intergenic
1113200742 13:107866175-107866197 TCCCCGGGAGACGGCGGCGGCGG - Exonic
1113655926 13:112067761-112067783 GGCGGGGGCGGCGGCGGCGGCGG + Exonic
1114037906 14:18646470-18646492 CTTTCGGGAGGCGGCGGCGGCGG - Intergenic
1114270678 14:21098333-21098355 GGAGCGGGCGGCGGCGGCGGCGG + Exonic
1115028400 14:28767499-28767521 GCCGGGGGCGGCGGCGGCGGCGG - Exonic
1115235792 14:31207665-31207687 GCTGCGGGCGACGGCGGCGGCGG + Intronic
1115399147 14:32938838-32938860 GGAGGGGGAGGCGGCGGCGGCGG - Intronic
1115399315 14:32939411-32939433 GGCGGCGGAGGCGGCGGCGGCGG - Intronic
1117307248 14:54488838-54488860 GTTTCCGGAGCCGGCGGCGGCGG - Intronic
1117803105 14:59464974-59464996 AGCGCGGGAGGCGGGGGCGGCGG - Exonic
1117875894 14:60249625-60249647 GTCGGCCGAGGCGGCGGCGGCGG - Intronic
1118748537 14:68790865-68790887 GTCGCGGGCGGTGGCGGGGGCGG - Intronic
1118797016 14:69152986-69153008 GGCGCGAGCGGCGGCGGCGGCGG - Exonic
1119385995 14:74258486-74258508 GTCGAGGGAGTCGGGAGGGGAGG - Intronic
1120167900 14:81220346-81220368 GAGGCGGGAAGCGGCGGCGGCGG + Intronic
1121417508 14:93789096-93789118 GGCGCTGGCGGCGGCGGCGGGGG - Intergenic
1121453726 14:94025608-94025630 GGCGCGGGGGGCGGGGGCGGGGG + Intergenic
1121605673 14:95238133-95238155 GCCGTGGGAGTCGGCAGCGTTGG - Intronic
1122220849 14:100238587-100238609 GAAGCGGGAGGCGGTGGCGGCGG + Intronic
1122523459 14:102363144-102363166 GTCGGGGGCGTCGGGGGCGTCGG - Intronic
1122543397 14:102509807-102509829 GTGGCGGGGGCCGGCGGCGCGGG - Intergenic
1122558293 14:102592963-102592985 GGCGGCGGAGGCGGCGGCGGCGG - Exonic
1122635331 14:103127069-103127091 GGAGCGGGAGCTGGCGGCGGCGG + Exonic
1122889045 14:104724208-104724230 GGCGCGGACGCCGGCGGCGGCGG + Intronic
1122895074 14:104752797-104752819 GTCGCGGCATTCGGCTGCGCGGG - Intergenic
1122993302 14:105248988-105249010 GGCGCGGGCGGCGGCGGCGCTGG - Exonic
1122993303 14:105248994-105249016 GGCGCGGGCGCGGGCGGCGGCGG - Exonic
1123024962 14:105420118-105420140 GGCGGGGGAGGCGGCAGCGGCGG - Intronic
1124640364 15:31392823-31392845 GTCGCGGGCGGGGGCGGGGGCGG - Intronic
1124922317 15:34038922-34038944 GTAGCCAGAGGCGGCGGCGGAGG - Exonic
1127103230 15:55588189-55588211 GTGGGAGGAGGCGGCGGCGGCGG - Intronic
1127103320 15:55588502-55588524 GGAGCGCGAGGCGGCGGCGGTGG - Intronic
1127144110 15:56007288-56007310 GGCGGGGGAGGCGGCGGCGGCGG + Intergenic
1127144118 15:56007306-56007328 GGCGGGGGAGGCGGCGGCGGCGG + Intergenic
1127144126 15:56007324-56007346 GGCGGGGGAGGCGGCGGCGGCGG + Intergenic
1127144134 15:56007342-56007364 GGCGGGGGAGGCGGCGGCGGCGG + Intergenic
1127144142 15:56007360-56007382 GGCGGGGGAGGCGGCGGCGGCGG + Intergenic
1127267988 15:57376543-57376565 GACGCGGGAGGAGGCGGCGGCGG + Exonic
1127515509 15:59689362-59689384 GGCGCGGCAGCCGGCGGTGGAGG + Exonic
1128067879 15:64775643-64775665 GGGGCGGGCGCCGGCGGCGGGGG + Intergenic
1128293566 15:66497791-66497813 TTTCCGGGAGTCGGCGGCGATGG - Exonic
1128374788 15:67066732-67066754 GGGGCGGGAGGCGGCGGCGGAGG - Intronic
1129741643 15:77992399-77992421 GTGGCGGGAGTGGACGGCAGAGG + Intronic
1129780155 15:78264655-78264677 GACGCGCGAGCGGGCGGCGGGGG + Intronic
1129844003 15:78759981-78760003 GTGGCGGGAGTCGGGGGCAGAGG - Intronic
1130257803 15:82333819-82333841 GTGGCGGGAGTCGGGGGCAGAGG + Intergenic
1130597133 15:85256144-85256166 GTGGCGGGAGTCGGGGGCAGAGG - Intergenic
1131215143 15:90530028-90530050 GAAGCGGGAGACGGCGGCCGTGG - Intronic
1131277475 15:90994277-90994299 GTCACGGCAGTCGGCGCCGAGGG - Intronic
1132579816 16:679817-679839 GGGGCGGGAGGCGGCGGCTGGGG + Intronic
1132757508 16:1493305-1493327 GACGCGGGAGCGGGGGGCGGTGG - Intergenic
1132889387 16:2196517-2196539 GGCGGGGGAGGCGGCGGGGGAGG - Exonic
1133156456 16:3880144-3880166 GCCGCGGCCGGCGGCGGCGGCGG - Exonic
1134143579 16:11742654-11742676 GACGAGGGAGGGGGCGGCGGCGG - Exonic
1135023798 16:18983990-18984012 GGCCGGGGAGGCGGCGGCGGCGG + Exonic
1135712495 16:24729674-24729696 GGCGGCGGTGTCGGCGGCGGCGG + Intronic
1135712498 16:24729683-24729705 GTCGGCGGCGGCGGCGGCGGCGG + Intronic
1136281704 16:29217285-29217307 GTCGCGGGCGTTGCTGGCGGGGG + Intergenic
1136365177 16:29806411-29806433 GGCCCGGGCGGCGGCGGCGGCGG - Intronic
1136365678 16:29808043-29808065 GTGGGAGGAGGCGGCGGCGGCGG + Intronic
1136519498 16:30786826-30786848 AGCGCGGGGGTCGGTGGCGGGGG - Intronic
1137280566 16:46973352-46973374 GGGCTGGGAGTCGGCGGCGGCGG - Intronic
1137426575 16:48385388-48385410 GACGCGCGAAACGGCGGCGGCGG - Intronic
1138179793 16:54933382-54933404 ACCGCAGGAGGCGGCGGCGGAGG - Exonic
1140055892 16:71525390-71525412 GTTGCGGGGGTGGGTGGCGGTGG + Intronic
1140223242 16:73058661-73058683 CTGGCGGGGGTCGGCGGCGGCGG + Intronic
1140759373 16:78097468-78097490 GTGGTGGGGGTCGGCGGGGGGGG + Intergenic
1141184737 16:81779295-81779317 GTAGCGAGCGCCGGCGGCGGAGG + Exonic
1141608500 16:85169022-85169044 GACGCGGGGGGAGGCGGCGGCGG + Intergenic
1141797928 16:86287095-86287117 AGCGCGGGAGTGAGCGGCGGCGG - Intergenic
1141839981 16:86568072-86568094 GTCGGGGGAGCCGGCGGGCGTGG - Exonic
1141989604 16:87602549-87602571 GGCTCGGGCGGCGGCGGCGGCGG - Intronic
1142086081 16:88183202-88183224 GTCGCGGGCGTTGCTGGCGGGGG + Intergenic
1142240327 16:88941771-88941793 CTCGCAGCAGTCGGCGGCCGCGG + Intronic
1142586662 17:978869-978891 TCCGCGGGGGTCGGCGGCGGAGG + Intronic
1142611012 17:1109240-1109262 GACGCGCGAGGCGGCGGCGGCGG - Intronic
1142697719 17:1643155-1643177 GTCGGGGGAGGGGGCGGAGGCGG - Intronic
1142752769 17:1998428-1998450 CTCGCGGGAGCCGCCGGCCGGGG + Intronic
1142764361 17:2057216-2057238 TCCGCGGCAGGCGGCGGCGGAGG - Exonic
1142836794 17:2593585-2593607 GTCTGGGGCGGCGGCGGCGGCGG + Intronic
1143548493 17:7614540-7614562 GCCGGGGGAGTCGGAGGCGGTGG - Exonic
1143550540 17:7627741-7627763 GTGGCGGGAGTCGGGGGGGACGG + Exonic
1143590781 17:7885056-7885078 GGCGGGGGCGGCGGCGGCGGGGG - Exonic
1144269234 17:13601266-13601288 GTCCCGGGAGGCAGCGGCCGGGG + Exonic
1144565054 17:16353144-16353166 GTCGCGGGAGTCGGCGGCGGCGG + Exonic
1144565057 17:16353153-16353175 GTCGGCGGCGGCGGCGGCGGTGG + Exonic
1146339609 17:32007676-32007698 GACGTGGGCGGCGGCGGCGGCGG - Intergenic
1147285911 17:39402285-39402307 GGCGGGGGAGGCGGCGGCGGCGG - Intronic
1147316272 17:39621906-39621928 GTGGAGGGAGTGGGAGGCGGGGG + Intergenic
1147723954 17:42554945-42554967 GGCGCGGGAGACAGCGGCTGAGG - Exonic
1147943502 17:44066600-44066622 GCCGCGGCCGGCGGCGGCGGCGG + Exonic
1148060099 17:44830241-44830263 GGAGCGGGAGGCGGCGGCGGCGG - Intronic
1148081165 17:44968309-44968331 GAGGCGGGAGGCGGCGGCCGCGG - Intergenic
1148152545 17:45405090-45405112 GTCTCGGGAGTGGGGGGCTGCGG + Exonic
1148437173 17:47693985-47694007 GGCGGAGGAGGCGGCGGCGGCGG + Intergenic
1148759755 17:49993630-49993652 GTCGCAGGAGTCGCAGGCCGAGG - Intronic
1148786836 17:50149732-50149754 GGGGCGGGCGGCGGCGGCGGCGG + Exonic
1148936235 17:51166410-51166432 CACCCGGGAGCCGGCGGCGGAGG - Intronic
1150407973 17:64919164-64919186 GACGTGGGCGGCGGCGGCGGCGG + Intronic
1150675794 17:67245236-67245258 GAGGCGGGAGTCGGGGGCCGGGG - Intronic
1150747248 17:67825800-67825822 GACGTGGGCGGCGGCGGCGGTGG - Exonic
1150791966 17:68205968-68205990 GGCGGGGGCGGCGGCGGCGGCGG + Intergenic
1151755336 17:76072451-76072473 GTCCCAGGCGGCGGCGGCGGCGG - Exonic
1151934632 17:77254440-77254462 GTCTCTGGAGTCCGCGGGGGTGG - Intergenic
1152361244 17:79834132-79834154 GACACCGGCGTCGGCGGCGGTGG - Exonic
1152797281 17:82314598-82314620 GTCGCTGGAGTGGGGGTCGGGGG + Intergenic
1152921369 17:83068173-83068195 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921384 17:83068208-83068230 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921398 17:83068242-83068264 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921409 17:83068276-83068298 GTCCCGGGAGGCGACAGCGGCGG + Intergenic
1152921422 17:83068310-83068332 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921434 17:83068344-83068366 GTCCCGGGAGGCGACAGCGGCGG + Intergenic
1152921445 17:83068378-83068400 GTCCCGGGAGGCGACAGCGGCGG + Intergenic
1152921458 17:83068412-83068434 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921472 17:83068446-83068468 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921483 17:83068480-83068502 GTCCCGGGAGGCGACAGCGGCGG + Intergenic
1152921496 17:83068514-83068536 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921510 17:83068548-83068570 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921521 17:83068582-83068604 GTCCCGGGAGGCGACAGCGGCGG + Intergenic
1152921534 17:83068616-83068638 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921547 17:83068650-83068672 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921561 17:83068684-83068706 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921575 17:83068719-83068741 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921589 17:83068754-83068776 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921603 17:83068789-83068811 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921616 17:83068823-83068845 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152921631 17:83068858-83068880 GTCCCGGGAGGCGACAGCGGGGG + Intergenic
1152970705 18:158668-158690 GCGGCGGGAGGCGGCGGCGCAGG - Exonic
1153781358 18:8497759-8497781 GTCGGGGGAGTGGGGGGCTGGGG - Intergenic
1154216561 18:12420543-12420565 GACGCGGGAGAGGGCGGGGGCGG - Intronic
1154367671 18:13726346-13726368 GCGGCGGGAAGCGGCGGCGGCGG - Exonic
1155392729 18:25352326-25352348 CGCGTGGGAGGCGGCGGCGGCGG - Intergenic
1155654333 18:28177049-28177071 GCCGGAGGAGGCGGCGGCGGCGG + Exonic
1155654572 18:28178002-28178024 GGCGAGGGCGGCGGCGGCGGCGG - Intergenic
1157279102 18:46334188-46334210 GGCGCGGGCGCGGGCGGCGGCGG - Intronic
1157383934 18:47247073-47247095 GGCGGGGGCGGCGGCGGCGGCGG + Intronic
1158150159 18:54358305-54358327 GTCGCGGGACGCGGCGGAGGGGG + Intronic
1158259097 18:55588112-55588134 GGCGCAGGAGCAGGCGGCGGCGG - Intronic
1158954143 18:62523557-62523579 CCCGCGGGCGGCGGCGGCGGCGG - Exonic
1160680318 19:409109-409131 GATGCGGGCGGCGGCGGCGGCGG + Exonic
1160715007 19:572578-572600 GCCGCGGGCGGCGGCGGCAGCGG + Exonic
1160719167 19:590012-590034 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1160719181 19:590051-590073 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1160738808 19:676601-676623 GTCGGGGGGCGCGGCGGCGGCGG + Intronic
1160775205 19:852334-852356 GACACGCGAGTCGGCGGCCGAGG - Exonic
1160875763 19:1295555-1295577 GGCGCGGGGGACGACGGCGGGGG + Exonic
1160909002 19:1466249-1466271 CACGCGGGCGTCGGCGGAGGTGG - Exonic
1160930589 19:1568000-1568022 GGCGGGGGCGGCGGCGGCGGCGG - Exonic
1161080596 19:2308162-2308184 AGCCCGGGAGGCGGCGGCGGCGG - Intronic
1162021159 19:7869235-7869257 GCCGCGGGCGGCAGCGGCGGGGG - Exonic
1162033060 19:7925645-7925667 GTTAAGGGAGGCGGCGGCGGCGG - Intronic
1162315602 19:9936468-9936490 GGCGGGGGAGGCGGCGGCGCAGG - Exonic
1162535844 19:11262483-11262505 GAACCGGGAGGCGGCGGCGGCGG - Intergenic
1162934155 19:13972864-13972886 GGCGGGGGAGGCGGTGGCGGGGG - Exonic
1165493944 19:36141117-36141139 GCCGGGGGCGGCGGCGGCGGCGG + Exonic
1165850859 19:38849701-38849723 GCGGCGGGCGGCGGCGGCGGTGG - Exonic
1166754025 19:45179551-45179573 GCAGCGGGAATCGGCGGAGGAGG + Exonic
1166888233 19:45973903-45973925 GTGGCCGGAGTGGGAGGCGGAGG + Intergenic
1166888256 19:45973956-45973978 GGCGCGGGCGGCGGCGGCGACGG + Intergenic
1166975112 19:46601290-46601312 GGGGCGGGAGGCGGCGGCGGCGG + Exonic
1167220379 19:48195288-48195310 GACGCAGCAGTCGCCGGCGGTGG - Exonic
1167369656 19:49072836-49072858 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1167456152 19:49597465-49597487 GGCGCGGGAGGCGGCGGTGGCGG - Exonic
1167463827 19:49639977-49639999 GTCGTGGGCGGCGGCGGCGTGGG - Exonic
1167578329 19:50328316-50328338 GACGCGGGCGGCGGCGCCGGGGG - Exonic
1167638583 19:50668379-50668401 CCCACGGGAGGCGGCGGCGGCGG - Exonic
1167649081 19:50719734-50719756 GGAGCGGGCGGCGGCGGCGGCGG - Intergenic
1168076322 19:53982535-53982557 CTGGCGGGGGCCGGCGGCGGCGG + Exonic
1168076346 19:53982595-53982617 GGCGCCGGGGGCGGCGGCGGAGG + Exonic
1168332625 19:55579048-55579070 GCCCCGGGAGTCGGAGTCGGAGG - Exonic
1168714587 19:58519462-58519484 GTGGCGGGAGTGTGCGGCGCCGG - Intronic
925927807 2:8682540-8682562 ACCGCGGGAGTGTGCGGCGGCGG - Intronic
925959769 2:9003789-9003811 GGCGCGGGAGGAGGTGGCGGCGG - Exonic
926090027 2:10043623-10043645 GCTGCGGGCGGCGGCGGCGGCGG - Exonic
926133171 2:10318300-10318322 GTTGGGGGAGTCTGGGGCGGGGG - Intronic
926154899 2:10448288-10448310 GCGGCGGGCGGCGGCGGCGGCGG + Exonic
927130005 2:20051201-20051223 GTCGGGGGAGCGGGGGGCGGTGG - Intronic
927472317 2:23385557-23385579 CTGCCGGGAGGCGGCGGCGGCGG + Exonic
929174234 2:38960557-38960579 GCCGCGGGCGGCGACGGCGGCGG - Exonic
929201657 2:39243624-39243646 GCCCAGGGAGTGGGCGGCGGCGG - Intergenic
929778340 2:44942231-44942253 GGCGCGGGAGGCGGCAGCGGCGG + Exonic
930651837 2:53971098-53971120 GTCGGGGGAGGCGGTGGTGGCGG + Intronic
931253166 2:60550925-60550947 GCCGGGGGAGTTGGGGGCGGGGG + Intronic
931253669 2:60553281-60553303 GGGGCGGGCGGCGGCGGCGGCGG + Exonic
931881693 2:66576323-66576345 GTCGCGGGGGGTGGCGGGGGTGG + Intergenic
932036535 2:68252191-68252213 CTCGCAGGAAACGGCGGCGGCGG + Exonic
932231500 2:70087559-70087581 GGGGCGGGCGGCGGCGGCGGAGG - Exonic
932231502 2:70087565-70087587 GTCGCAGGGGCGGGCGGCGGCGG - Exonic
933684713 2:85133700-85133722 GGCGGGGGCGGCGGCGGCGGCGG + Exonic
933772776 2:85754562-85754584 GGCGCAGGAGGCGGCGGCGGCGG - Exonic
933858560 2:86441843-86441865 GTGGCGGGGGAGGGCGGCGGGGG + Intronic
934079050 2:88452276-88452298 GCCCCGGGGGGCGGCGGCGGCGG + Exonic
934296792 2:91748935-91748957 CGCGCTGGAGGCGGCGGCGGCGG - Intergenic
934746149 2:96760962-96760984 GGCGCGGGGAGCGGCGGCGGCGG + Exonic
935149079 2:100417538-100417560 GTCCCGGGATGTGGCGGCGGCGG + Exonic
935592554 2:104855604-104855626 GGCGGGGGTGGCGGCGGCGGCGG + Exonic
936122683 2:109760395-109760417 GGCGGGGGCGGCGGCGGCGGCGG + Intergenic
936122698 2:109760436-109760458 GCCGGGGGCGGCGGCGGCGGCGG + Intergenic
936126711 2:109794606-109794628 GGCGGGGGGGGCGGCGGCGGCGG + Intronic
936222010 2:110611078-110611100 GGCGGGGGCGGCGGCGGCGGCGG - Intergenic
936279132 2:111122594-111122616 GTCGGCGGTGCCGGCGGCGGCGG + Intronic
937221807 2:120346282-120346304 GGCGCGGCAGGCGTCGGCGGGGG - Exonic
937985994 2:127638382-127638404 GTGGCGGGGGTCGGGGGTGGAGG - Intronic
938338999 2:130523055-130523077 GGCGCGGGAGTTGGCGCCGGGGG + Intronic
938350839 2:130597695-130597717 GGCGCGGGAGTTGGCGCCGGGGG - Intronic
938406244 2:131034875-131034897 GGCGGGGGCGGCGGCGGCGGCGG - Intronic
938451546 2:131425335-131425357 GCCTCGGCAGGCGGCGGCGGCGG - Intergenic
939629685 2:144516956-144516978 GGAGCGGGAGGCGGAGGCGGAGG + Intronic
941951321 2:171160226-171160248 GGCGCGGGGGTCCGCGGCGCGGG + Intronic
941951494 2:171160833-171160855 CGCCCGGGAGGCGGCGGCGGCGG + Exonic
942346097 2:175004830-175004852 GTCCCGGGGCTCGGGGGCGGGGG - Intronic
942678307 2:178451127-178451149 GGCGGGGGAGTCGGAGGAGGTGG - Exonic
942748647 2:179264407-179264429 GCCGGTGCAGTCGGCGGCGGCGG - Intronic
943669861 2:190649078-190649100 CGCGCGGGCGGCGGCGGCGGCGG - Intronic
944221765 2:197310555-197310577 GTAGCGGGCGGCGGCGCCGGCGG - Intronic
944933634 2:204545562-204545584 GGGGCTGGAGTGGGCGGCGGCGG - Intergenic
945191703 2:207195510-207195532 GGAGAGGGAGTCGGAGGCGGAGG - Intergenic
945431660 2:209771994-209772016 GCAGCGGGAGGAGGCGGCGGCGG + Exonic
946019855 2:216633599-216633621 GGCGCGAGTGGCGGCGGCGGCGG + Exonic
946306578 2:218859899-218859921 GGCGAGGGATCCGGCGGCGGCGG - Exonic
946322126 2:218960283-218960305 GCTGGGGGAGGCGGCGGCGGAGG - Exonic
946921434 2:224585171-224585193 GGCGGGGGCGGCGGCGGCGGCGG + Exonic
947549784 2:231037838-231037860 GGCGGGGGCGGCGGCGGCGGCGG + Exonic
947641166 2:231708613-231708635 GCTGCCGGAGTCCGCGGCGGCGG - Exonic
948207006 2:236167778-236167800 AGCGCGGGCGGCGGCGGCGGCGG + Exonic
1169065661 20:2693104-2693126 GGCGCGGAGCTCGGCGGCGGCGG - Exonic
1169367246 20:5001470-5001492 GTCGCGGGGACCGGAGGCGGAGG - Intronic
1170150506 20:13221726-13221748 GGCGCGGCGGCCGGCGGCGGCGG - Intergenic
1171972481 20:31573022-31573044 GGCGCGGGAGGCGGAGGCCGAGG + Intronic
1172331162 20:34077054-34077076 GGCGCCGGCGGCGGCGGCGGTGG + Exonic
1172474529 20:35226885-35226907 CGCGCGGGCGGCGGCGGCGGCGG + Exonic
1173681537 20:44885724-44885746 GGCTCCGGAATCGGCGGCGGCGG - Exonic
1174804674 20:53594441-53594463 GGAGGCGGAGTCGGCGGCGGGGG - Intronic
1175873682 20:62219901-62219923 GGCGGGCGAGGCGGCGGCGGCGG - Exonic
1176952665 21:15064957-15064979 AACTCGGGAGGCGGCGGCGGAGG - Exonic
1177834085 21:26170695-26170717 GCCCCGGGAGACGGCGGCGGTGG - Intronic
1178797206 21:35755953-35755975 GGCGGGGGTGTTGGCGGCGGGGG - Intronic
1179603397 21:42496244-42496266 GACGCGGGACGCGGCGGTGGAGG - Exonic
1179796839 21:43789809-43789831 GGTGCGGGTGTGGGCGGCGGCGG + Intronic
1180462033 22:15573512-15573534 CTTTCGGGAGGCGGCGGCGGCGG - Intergenic
1180908355 22:19431547-19431569 GGCGCGGGAGGAAGCGGCGGCGG - Exonic
1180949413 22:19714464-19714486 GGAGCGGGCGGCGGCGGCGGCGG + Exonic
1181007531 22:20021104-20021126 CACCCGGAAGTCGGCGGCGGTGG + Exonic
1181085142 22:20436424-20436446 GGCCCGGGAGTCCGCGGCGGCGG + Intronic
1181478021 22:23180562-23180584 GTCCGAGGAGGCGGCGGCGGCGG + Exonic
1181725146 22:24806281-24806303 GTCCCAGGAGGCGGTGGCGGCGG - Intronic
1181831671 22:25564960-25564982 GGCGCGGCGGGCGGCGGCGGCGG + Exonic
1181934618 22:26429606-26429628 GGCGGGGGCGGCGGCGGCGGCGG - Intronic
1182237000 22:28883805-28883827 GGCGCAGGCGGCGGCGGCGGCGG - Exonic
1182374724 22:29838208-29838230 GTCGGCGGCGGCGGCGGCGGCGG - Exonic
1182374728 22:29838217-29838239 GTCACCGTGGTCGGCGGCGGCGG - Exonic
1182532288 22:30969585-30969607 GTCCGGGTGGTCGGCGGCGGCGG + Intergenic
1183408030 22:37639909-37639931 GTCGGGGGAGACGGGGGTGGGGG + Intronic
1183524955 22:38317362-38317384 GAGGAGGGAGGCGGCGGCGGCGG - Exonic
1183524975 22:38317408-38317430 AGCGCGCGAGCCGGCGGCGGGGG - Exonic
1183671958 22:39278242-39278264 ATCCCGGGAGGCGGCGGCCGAGG - Intergenic
1183752213 22:39728039-39728061 GTGGCGGGGGGTGGCGGCGGGGG - Intergenic
1184523808 22:45009883-45009905 CGCGCGGGAGGAGGCGGCGGCGG - Intronic
1184767036 22:46577400-46577422 GGCCCGGGCGGCGGCGGCGGCGG - Intronic
1184809970 22:46824671-46824693 GTGGCTGGAGTCGGTGGAGGTGG + Intronic
1184891018 22:47379231-47379253 GGCGAAGGAGGCGGCGGCGGAGG + Intergenic
1184891044 22:47379312-47379334 GGCGGAGGAGGCGGCGGCGGAGG + Intergenic
1184891049 22:47379327-47379349 GGCGGAGGAGGCGGCGGCGGAGG + Intergenic
1184891054 22:47379342-47379364 GGCGGAGGAGGCGGCGGCGGCGG + Intergenic
1184891059 22:47379357-47379379 GGCGGCGGAGGCGGCGGCGGCGG + Intergenic
1185055291 22:48575933-48575955 GGCGGAGGAGGCGGCGGCGGCGG + Intronic
1185278855 22:49961378-49961400 GGCACGGGCGGCGGCGGCGGCGG + Intronic
1185325309 22:50222698-50222720 GTAGGGGGAGACGGGGGCGGGGG - Intronic
1185335792 22:50270378-50270400 GGCGGCGGAGGCGGCGGCGGCGG + Exonic
1185413378 22:50697398-50697420 CTCCCGGGGGTCGGCGGCGAGGG + Intergenic
949329509 3:2906173-2906195 GTCGGGGGAATCGGCGGGGGAGG + Intronic
950168054 3:10816316-10816338 GGCGCGGGAGTCCGAGGCGCCGG + Exonic
950618081 3:14178421-14178443 TTCGCGGGAGACGCCGCCGGTGG - Exonic
950729786 3:14947607-14947629 CGCGCGGGCGGCGGCGGCGGCGG + Intronic
951717387 3:25664254-25664276 GGCGCGGGAGCCGGCGTGGGCGG - Exonic
955768561 3:62369041-62369063 GACCCAGGAGGCGGCGGCGGCGG + Intergenic
955769243 3:62372540-62372562 GGCGGCGGAGGCGGCGGCGGCGG - Exonic
959359011 3:105366979-105367001 CTCGCAGGAGGCGGCGACGGGGG - Exonic
960664216 3:120094379-120094401 GGCCCGGGCGGCGGCGGCGGCGG + Intronic
961012937 3:123448189-123448211 GTCGCGGCAGCCGCCGGCAGCGG - Exonic
961377436 3:126476063-126476085 GGCGCCGGAGGCGGAGGCGGGGG + Intergenic
962803570 3:138910640-138910662 GTCAGGCGAGTCGGGGGCGGAGG + Intergenic
963038377 3:141051391-141051413 GGAGCGGGCGGCGGCGGCGGAGG + Exonic
963289934 3:143477355-143477377 GTGGCGGGAGGGGGCGGCGGGGG - Intronic
963827500 3:149970921-149970943 GTAGCGGGCGGCGGCGGCGCGGG + Exonic
964570786 3:158105828-158105850 GCCGGCGGAGGCGGCGGCGGAGG - Exonic
966866544 3:184261519-184261541 GGCGGGGGTGGCGGCGGCGGCGG + Intronic
967859680 3:194141536-194141558 GGAGCGGGCGGCGGCGGCGGCGG + Intergenic
967916733 3:194583941-194583963 CTCGCGGGAGGCGGTGGCTGCGG + Intergenic
967924186 3:194633381-194633403 GGCGCGGGCGGCGGCGGCGAAGG + Exonic
970202896 4:13627532-13627554 GGCGGGGGAGGCGGCGGCGCCGG + Exonic
970456225 4:16226561-16226583 GCCGCGGATGGCGGCGGCGGCGG - Intronic
970779921 4:19724530-19724552 GTCGGGGGAGTGGGGGGCTGAGG - Intergenic
971457870 4:26861053-26861075 GCCGGAGGAGTCGCCGGCGGCGG + Exonic
972396621 4:38663990-38664012 GGCGCGGGAGGCGGGGGTGGCGG + Intergenic
973279216 4:48341707-48341729 GGCGGCGGAGGCGGCGGCGGCGG + Exonic
975778980 4:77819664-77819686 GGCGGGGGAGGCGGCGGCGGCGG + Intergenic
979349664 4:119628962-119628984 TTCCCAGGAGGCGGCGGCGGCGG + Exonic
981093361 4:140755924-140755946 GGCGATGGAGGCGGCGGCGGCGG - Exonic
982745809 4:159103385-159103407 ATGGGGGGAGGCGGCGGCGGCGG + Intergenic
984668011 4:182448860-182448882 CTGGCGGGAGGCGGCGGTGGCGG + Intronic
985532685 5:443224-443246 GGCGGGGGCGGCGGCGGCGGCGG + Exonic
987050403 5:14143567-14143589 GCGGCGGGGGGCGGCGGCGGCGG - Intergenic
987108705 5:14664888-14664910 GGCGCGGGAGGCGGCGGCCACGG + Exonic
987258265 5:16179469-16179491 GGCGGCGGCGTCGGCGGCGGCGG + Exonic
990210765 5:53480139-53480161 GGCGCTGGAGGCGGTGGCGGGGG - Intergenic
990825460 5:59893429-59893451 GGCGAGGGTGGCGGCGGCGGGGG + Exonic
990955122 5:61332708-61332730 GGCGCGGGCGGCGGCGGCGGCGG + Exonic
991570793 5:68051317-68051339 GTGTCGGGAGTAGGCGGCAGAGG - Intergenic
992597571 5:78361093-78361115 GGGCCGGGAGTCGGCGGAGGGGG + Intronic
995518530 5:112977298-112977320 GGAGAGGGAGGCGGCGGCGGCGG - Intronic
996055072 5:118973702-118973724 GCTGCCGGAGTCCGCGGCGGCGG - Intronic
996290995 5:121852112-121852134 GTCCCGGGAGGAGGCGGCTGCGG - Exonic
1001652809 5:173327726-173327748 GACCCGGGATTCGGGGGCGGGGG + Intronic
1002352039 5:178590124-178590146 GCGGCGGGCGGCGGCGGCGGAGG - Exonic
1002455901 5:179345222-179345244 TTCGCGGGCGGCGGCGGCGGCGG + Exonic
1002632445 5:180590767-180590789 TGCGCTGGAGTCGGCGGCGGAGG - Exonic
1003645532 6:7910644-7910666 GGCCCAGGAGGCGGCGGCGGCGG - Exonic
1004216790 6:13711270-13711292 GTGGCCGGGGGCGGCGGCGGCGG + Exonic
1004216791 6:13711273-13711295 GCCGGGGGCGGCGGCGGCGGAGG + Exonic
1005267356 6:24126144-24126166 GGAGGGGGAGGCGGCGGCGGCGG + Intronic
1006472700 6:34237446-34237468 GCGGCGCGAGCCGGCGGCGGGGG + Intronic
1006491606 6:34392605-34392627 GTCGGGGGTGGCGGCGGCAGAGG - Exonic
1006535667 6:34696846-34696868 GGCGCGGGAGGAGGCGGAGGCGG - Exonic
1007737696 6:43991805-43991827 GTCGGGGGCGGCGGGGGCGGGGG + Intergenic
1007784200 6:44270776-44270798 GCCGCCGGCGGCGGCGGCGGCGG + Exonic
1007902217 6:45422741-45422763 GCAGCAGGAGGCGGCGGCGGCGG + Exonic
1008013380 6:46491416-46491438 GTCCCGGGTGACGGCGGCGGAGG - Intronic
1010703129 6:79077106-79077128 CGCGCGAGAGTCGGCGGCGGCGG - Intronic
1010703306 6:79077780-79077802 GGGGAGGGAGGCGGCGGCGGCGG - Intronic
1011128764 6:84033788-84033810 GCGGTGGGAGGCGGCGGCGGCGG + Exonic
1011418914 6:87152046-87152068 TTCGCGGGCGGCGGCGGCGGCGG + Intergenic
1012399930 6:98834671-98834693 CGGGCGGGAGGCGGCGGCGGCGG + Exonic
1013170830 6:107635080-107635102 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1014137542 6:117907194-117907216 GGCGCCGGCGGCGGCGGCGGCGG - Intergenic
1014137544 6:117907200-117907222 GGCGGGGGCGCCGGCGGCGGCGG - Intergenic
1014137624 6:117907479-117907501 GGGGCGGGCGGCGGCGGCGGCGG + Intergenic
1014272315 6:119348989-119349011 GGCGGGGGGCTCGGCGGCGGCGG - Exonic
1014947535 6:127515881-127515903 GTTGCGGGGGGCGGCAGCGGTGG - Exonic
1015149264 6:130019968-130019990 GTGTCGGGAGGCGGCGGCGGCGG + Intronic
1017103156 6:150865925-150865947 GGCGGCGGAGGCGGCGGCGGTGG + Exonic
1017672282 6:156778842-156778864 GGCGCGGGCGGCGGCGGCGGCGG + Exonic
1017672318 6:156778974-156778996 GCAGCAGGAGGCGGCGGCGGCGG + Exonic
1017672415 6:156779291-156779313 GTCCCAGGCGGCGGCGGCGGGGG + Exonic
1017842350 6:158232209-158232231 GACGCGGGGGGAGGCGGCGGCGG + Intergenic
1017842351 6:158232212-158232234 GCGGGGGGAGGCGGCGGCGGCGG + Intergenic
1018613397 6:165663270-165663292 GGCGCGGAAGGCGGCGGCGGCGG - Intronic
1019711823 7:2521328-2521350 CTGGCGGGAGGGGGCGGCGGGGG + Intronic
1019828226 7:3301272-3301294 GGCGGGGGCGGCGGCGGCGGCGG + Intergenic
1020278308 7:6637515-6637537 CTCGGGGGCGGCGGCGGCGGCGG + Intronic
1021452783 7:20798075-20798097 GGCGCGGGAGGCGGAGGCGCAGG + Intergenic
1022101955 7:27174143-27174165 GGCGCGGGGGGCGGCGGCGGTGG - Exonic
1022107996 7:27210461-27210483 GTCGCTGTGGGCGGCGGCGGAGG + Intergenic
1022375281 7:29806603-29806625 GGAGCCGGAGGCGGCGGCGGCGG + Exonic
1023955597 7:44884720-44884742 GGCCCGGGAGGCGGCGCCGGGGG - Exonic
1025069714 7:55887705-55887727 GAGGCGGGAGGCGGAGGCGGGGG + Intronic
1025069777 7:55887834-55887856 GCGGCGGGCGGCGGCGGCGGCGG + Intronic
1025069786 7:55887857-55887879 GCGGCGGGCGGCGGCGGCGGCGG + Intronic
1025069795 7:55887882-55887904 GCGGCGGGCGGCGGCGGCGGCGG + Intronic
1025780385 7:64596436-64596458 GTCGGGGGAGTCGGGGGCAATGG - Intergenic
1025916924 7:65873339-65873361 GCGGAGGGAGGCGGCGGCGGCGG + Intronic
1026360534 7:69598380-69598402 GAGGCGGGCGGCGGCGGCGGCGG + Intergenic
1027061897 7:75092778-75092800 GTCGGCGGCGTCGGCGGCGGGGG - Intronic
1027774008 7:82443302-82443324 GCCGCGGGAGTTGGGGGTGGGGG - Intronic
1029123191 7:98281722-98281744 GGCGGGGGACGCGGCGGCGGCGG - Exonic
1029238795 7:99144026-99144048 GGCGGCGGAGGCGGCGGCGGAGG - Exonic
1029348723 7:99997672-99997694 GTGGCGGGTGCCGGCGGCCGAGG - Intergenic
1029390719 7:100272147-100272169 GTCGAGGGAGGCAGCGCCGGCGG + Exonic
1029461137 7:100694370-100694392 GCGGAGGGAGGCGGCGGCGGCGG - Intergenic
1029655125 7:101919118-101919140 GTGGTGGGAGTCGGGGGCTGTGG + Intronic
1030138734 7:106284667-106284689 GGCGCGGGCGGCGGCGGCTGGGG - Intronic
1030138859 7:106285066-106285088 GGCGCGGGTGACGGCTGCGGCGG + Exonic
1030262481 7:107580246-107580268 GTCCCGCGCGTCGGCGGCCGCGG + Intronic
1034306252 7:150047572-150047594 GGGGCGGGGGACGGCGGCGGGGG - Intergenic
1034911664 7:155002978-155003000 GCCGCGGGGGCCGGGGGCGGGGG - Exonic
1035169565 7:157010037-157010059 GGCGCGGGCGGCGGCGGCGGCGG - Exonic
1036950160 8:13132889-13132911 GCCGCGGGAGCGGGCTGCGGAGG - Intronic
1037788895 8:21919678-21919700 GGCGACGGCGTCGGCGGCGGCGG + Exonic
1039454608 8:37698430-37698452 ATGGCAGGAGGCGGCGGCGGCGG - Exonic
1039542299 8:38382229-38382251 GGCGGGAGAGGCGGCGGCGGCGG - Exonic
1041280996 8:56211308-56211330 GTCGGCGGCGGCGGCGGCGGCGG - Intronic
1041355118 8:56992690-56992712 CTCGCGGGAGTCGGGGTGGGGGG - Intronic
1041690391 8:60680394-60680416 GTCGCGGGGGGGGGGGGCGGGGG + Intronic
1041690396 8:60680409-60680431 GGCGGGGGCGGCGGCGGCGGCGG + Intronic
1043428453 8:80171539-80171561 TTCGCGGGAGTCGCCGGCGGAGG - Intronic
1043472688 8:80578321-80578343 GTCGCGGGAGCCGGAGAGGGCGG - Intergenic
1043502958 8:80874325-80874347 CTCCCGGGCGGCGGCGGCGGCGG - Intronic
1044761156 8:95519042-95519064 GTGGCGGGGGGCGGCGGTGGGGG + Intergenic
1046547433 8:115669111-115669133 GTCCCGGCGGGCGGCGGCGGCGG - Intronic
1048244142 8:132775398-132775420 GGCGGCGGAGGCGGCGGCGGCGG + Exonic
1048345594 8:133572261-133572283 GACGCCGGAGGCGGCGGCTGCGG + Intergenic
1049522601 8:143101921-143101943 GTGCCGGGAGTCGGTGGCGATGG + Intergenic
1049670045 8:143865349-143865371 GCGGCGGGCGGCGGCGGCGGCGG + Exonic
1049682454 8:143925701-143925723 GCGGCGGGAGGAGGCGGCGGTGG - Exonic
1049708253 8:144052523-144052545 GTCGCCCGAGGCGGCGGTGGTGG - Exonic
1050744120 9:8857661-8857683 GGCGCGGGAGGCGGTGGCGGCGG - Intronic
1052495164 9:29214806-29214828 CTCGATGGAGACGGCGGCGGTGG - Intergenic
1053435141 9:38069223-38069245 GGCTCGGGAGGCGGCGGCAGTGG - Intergenic
1054781938 9:69174014-69174036 GGGGCGGGAGGCGGCGGCGGCGG - Intronic
1055266309 9:74498812-74498834 GTCGCAGGCGGTGGCGGCGGCGG + Intronic
1055514160 9:77020147-77020169 GGCGGGGGCGGCGGCGGCGGCGG - Exonic
1055611781 9:78031593-78031615 CTCGCAGGCGGCGGCGGCGGCGG - Intergenic
1055945716 9:81689507-81689529 GGCGCGGGCGGCGGCGGCGGTGG - Intergenic
1056799530 9:89681465-89681487 GCGGCGGGGGGCGGCGGCGGTGG - Intergenic
1058467546 9:105244587-105244609 GGGGCGGGCGGCGGCGGCGGCGG - Intergenic
1059769885 9:117414957-117414979 GCTGCGGGCGGCGGCGGCGGTGG + Exonic
1060554350 9:124500553-124500575 GGTGCGGGAGGGGGCGGCGGGGG + Exonic
1060811707 9:126614160-126614182 GTCCCGGAACCCGGCGGCGGCGG - Intergenic
1060814071 9:126625708-126625730 GACGAGGGTGGCGGCGGCGGCGG - Intronic
1061149141 9:128819064-128819086 GCCGCGGTAGTCGGCGTTGGTGG - Exonic
1061261085 9:129481536-129481558 GTCGGGGGAGGCAGCGGAGGTGG + Intergenic
1061438147 9:130579638-130579660 GTCGGCGGCGTCGGCGGCGGCGG + Exonic
1062162468 9:135087826-135087848 GGCGCGCGGGGCGGCGGCGGCGG + Exonic
1062403717 9:136383636-136383658 GTCTCCGGAGGCGGCGGCGGAGG - Exonic
1062491865 9:136808591-136808613 GTGGAGCGGGTCGGCGGCGGCGG + Intronic
1062574562 9:137200215-137200237 GGCGCGGGCGGCGGCGGCGGCGG + Exonic
1203780702 EBV:99260-99282 GGCGCGGGAGCCGGCGGCCTCGG - Intergenic
1186699920 X:12079287-12079309 GTGGGGGGAGGGGGCGGCGGTGG - Intergenic
1187547362 X:20266946-20266968 GGCGCGGGAACCGGCGGGGGGGG - Intronic
1187873446 X:23783377-23783399 GTCACTGCAGTCGGCGGCAGTGG - Exonic
1188242675 X:27809525-27809547 GGGGCGGGGGCCGGCGGCGGGGG - Intronic
1189002875 X:36963969-36963991 GCCGCGGGAGCCGCGGGCGGGGG - Intergenic
1190285376 X:48957720-48957742 GGCGGAGGAGGCGGCGGCGGCGG + Intronic
1190713058 X:53083052-53083074 GCAGCAGGAGGCGGCGGCGGCGG + Exonic
1191830015 X:65406698-65406720 GGCGCGGGCGGCGGCGGCGGCGG + Intronic
1194325876 X:92515511-92515533 GTCATGGGAGCCCGCGGCGGCGG - Intronic
1195112255 X:101659683-101659705 GATGCGGGAGTCGGAGGCCGCGG - Intronic
1196393453 X:115233914-115233936 GGAGGGGGAGGCGGCGGCGGCGG - Exonic
1196828490 X:119758804-119758826 CTCCCGGGAGGCGGCGGCTGCGG - Exonic
1197446008 X:126552757-126552779 CGCGCGGGAGAGGGCGGCGGTGG + Exonic
1199445114 X:147912073-147912095 GGCGGCGGAGGCGGCGGCGGCGG + Exonic
1200227808 X:154428782-154428804 GTCGTTGGCGGCGGCGGCGGCGG + Exonic