ID: 1144565983

View in Genome Browser
Species Human (GRCh38)
Location 17:16359738-16359760
Sequence CCTCAGCAGCCCCTGTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144565976_1144565983 9 Left 1144565976 17:16359706-16359728 CCTTGAATTCTTTGGCTCAAGGG No data
Right 1144565983 17:16359738-16359760 CCTCAGCAGCCCCTGTAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144565983 Original CRISPR CCTCAGCAGCCCCTGTAGCT GGG Intergenic
No off target data available for this crispr