ID: 1144574979

View in Genome Browser
Species Human (GRCh38)
Location 17:16423680-16423702
Sequence CAAGCTGCACGGTAGGGCAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 134}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144574979_1144574987 19 Left 1144574979 17:16423680-16423702 CCTCTGCCCTACCGTGCAGCTTG 0: 1
1: 0
2: 0
3: 11
4: 134
Right 1144574987 17:16423722-16423744 GGATCTCACGCCTCTGAAGCTGG 0: 1
1: 0
2: 0
3: 9
4: 93
1144574979_1144574984 -2 Left 1144574979 17:16423680-16423702 CCTCTGCCCTACCGTGCAGCTTG 0: 1
1: 0
2: 0
3: 11
4: 134
Right 1144574984 17:16423701-16423723 TGAGGACATCCGCAACCTGCAGG 0: 1
1: 0
2: 0
3: 6
4: 75
1144574979_1144574988 28 Left 1144574979 17:16423680-16423702 CCTCTGCCCTACCGTGCAGCTTG 0: 1
1: 0
2: 0
3: 11
4: 134
Right 1144574988 17:16423731-16423753 GCCTCTGAAGCTGGCCGCCAAGG 0: 1
1: 0
2: 1
3: 13
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144574979 Original CRISPR CAAGCTGCACGGTAGGGCAG AGG (reversed) Exonic
900361873 1:2293038-2293060 CAGGGTGCACGGGAGAGCAGGGG + Intronic
900491110 1:2949661-2949683 CGGGCTGCAGGGTACGGCAGGGG + Intergenic
900491149 1:2949808-2949830 CGGGCTGCAGGGTACGGCAGGGG + Intergenic
901820919 1:11828886-11828908 CAAGCTGCTCGGCAGGGCCACGG - Intronic
902727131 1:18344673-18344695 CAAGGGGCAGGGTAGGTCAGTGG + Intronic
903945971 1:26962910-26962932 CAGGCTGGAGGGCAGGGCAGTGG - Intergenic
915473766 1:156140573-156140595 GAAGCTGCAGGAGAGGGCAGAGG + Intergenic
916883929 1:169048689-169048711 CAATCTACAATGTAGGGCAGAGG - Intergenic
920067929 1:203282296-203282318 CAAGCTGGGAGGGAGGGCAGTGG - Intergenic
920254470 1:204644999-204645021 CAAGCCACAGGGCAGGGCAGAGG + Intronic
920312494 1:205056819-205056841 CCTGCTGCAGGGCAGGGCAGGGG - Intronic
922219065 1:223544006-223544028 CAAGGTGCAAGGTGGGGCAGGGG - Intronic
923536413 1:234855531-234855553 CCATCTGCAAGGTTGGGCAGGGG - Intergenic
924909276 1:248492105-248492127 CAAGTTGCACTCTAGGGCAATGG + Intergenic
924914829 1:248555952-248555974 CAAGTTGCACTCTAGGGCAATGG - Intergenic
1063353108 10:5374212-5374234 GAGGCTGGACGGGAGGGCAGCGG + Exonic
1064509697 10:16076625-16076647 GAAGCTGCACTGTAGAGCAAGGG + Intergenic
1065265107 10:23966535-23966557 CAAACTGCAGGGCAGGGCAGGGG - Intronic
1067790132 10:49281604-49281626 CAACCTGCAGGGTCGGCCAGCGG + Intergenic
1070168333 10:73914208-73914230 GAAGCTGCCCGGTGGGGCAGGGG + Intronic
1071080629 10:81805780-81805802 CAAGCTGCAGGATAGGCCAAAGG - Intergenic
1076465794 10:130680850-130680872 CCAGCTTCTCAGTAGGGCAGGGG + Intergenic
1077237474 11:1488603-1488625 CAAGGTGCCCGGTAGGGTGGGGG + Intronic
1077308604 11:1878676-1878698 CAGGCTGCAGGGTCAGGCAGCGG + Intronic
1077466052 11:2734269-2734291 CCAGCTGCAGAGCAGGGCAGGGG + Intronic
1077466764 11:2737103-2737125 CAGCCTTCAGGGTAGGGCAGCGG + Intronic
1077500882 11:2909346-2909368 CACGCTGCCAGGTAGGGCCGGGG + Exonic
1079143068 11:17826517-17826539 CAGGCTGCACGGATGGGGAGTGG + Intronic
1081907806 11:46680404-46680426 GAAGCTGCTGGGCAGGGCAGAGG - Intronic
1083996889 11:66277299-66277321 CAAGCTGGAGGGCAGGGCACAGG - Exonic
1088691625 11:112333324-112333346 CAAGCTGCACGGCAAGTCAATGG - Intergenic
1089352280 11:117828480-117828502 CCAGCTGGACTGGAGGGCAGAGG - Intronic
1091285358 11:134405666-134405688 CAATCTGCCCGGGAGGGCACTGG + Intronic
1093676202 12:21942551-21942573 CAAGCTGGACGCGAGGCCAGAGG + Intergenic
1094627056 12:32134231-32134253 CAAGTTCCATGGTAGGGCACAGG - Intronic
1094840111 12:34339302-34339324 CAACCTGCGCAGCAGGGCAGGGG + Intergenic
1096556660 12:52408058-52408080 TGAGCTGCACCGGAGGGCAGGGG + Intergenic
1097098627 12:56570292-56570314 CAAGCTGTCTGGTAGGGAAGTGG - Intronic
1097110149 12:56652094-56652116 CAGGCTGGGCGGCAGGGCAGAGG + Intergenic
1097250277 12:57628678-57628700 CAGGCTGAACGGCAGGCCAGAGG - Intronic
1102027640 12:109722656-109722678 CAGGCAGCAGGGTAGGGGAGTGG - Intronic
1102979604 12:117230952-117230974 CAAGATGCAGGGAAGGGTAGTGG + Intronic
1103193741 12:119024580-119024602 CAAGCTGCCTGTTAGGGGAGGGG - Intronic
1114736679 14:25049866-25049888 CAGGCTGCACGGTAGGACCGGGG - Exonic
1118269875 14:64332914-64332936 CAGGCTGGAGGGTAGGGCAGTGG + Intronic
1118993713 14:70818887-70818909 CAAACTGCATGGTAGTGCAAAGG + Intergenic
1122637460 14:103137023-103137045 CGAGGTGCCCGGCAGGGCAGGGG - Exonic
1123106834 14:105845724-105845746 CAAGGGGCAGGGCAGGGCAGAGG + Intergenic
1129408611 15:75336444-75336466 CAAGCCCCACGGCAGGGCTGGGG - Intronic
1131835025 15:96381744-96381766 CAAGCTGCTGGGTGGAGCAGAGG - Intergenic
1132642379 16:983709-983731 CAAGCTGCAGCACAGGGCAGAGG - Exonic
1132648036 16:1007998-1008020 CAGGCTTCCCGGTTGGGCAGTGG + Intergenic
1140530084 16:75658023-75658045 CAGGATGCACTGTAGGGAAGTGG - Intronic
1141992324 16:87617645-87617667 GGGGCTGCATGGTAGGGCAGAGG + Intronic
1203104483 16_KI270728v1_random:1346247-1346269 CCAGCTGGACGGGCGGGCAGGGG + Intergenic
1203129031 16_KI270728v1_random:1616121-1616143 CCAGCTGGACGGGCGGGCAGGGG - Intergenic
1144574979 17:16423680-16423702 CAAGCTGCACGGTAGGGCAGAGG - Exonic
1146171039 17:30633567-30633589 CAAGATGAACTGTAGGCCAGGGG + Intergenic
1147557432 17:41488457-41488479 GCAGCTGGACAGTAGGGCAGGGG - Intronic
1147915028 17:43880881-43880903 CAGGCTGCACGGTGAGGGAGGGG + Intronic
1148365280 17:47050892-47050914 CAAGATGAACTGTAGGCCAGGGG + Intergenic
1150765398 17:67997953-67997975 CAGGCTGGAGGGCAGGGCAGTGG - Intergenic
1151354530 17:73550589-73550611 GAAGCTGCAGGGTAGGGGTGGGG - Intronic
1152762055 17:82113966-82113988 CAAGCTGCAGGGCAGGCAAGGGG - Intronic
1156479031 18:37424682-37424704 GAACCTGCAGGGAAGGGCAGTGG - Intronic
1157592257 18:48842982-48843004 CAAGCAGAAGGGTAGGGCAGGGG - Intronic
1157610341 18:48951615-48951637 CAAGCTGCTTGCTAGTGCAGGGG + Intergenic
1159882239 18:73869024-73869046 CCAGCTACTCGGGAGGGCAGAGG + Intergenic
1161102204 19:2426774-2426796 CAAGCTGCACTGGCTGGCAGGGG + Exonic
1161130568 19:2586234-2586256 AAAGCTGGAGGGTGGGGCAGTGG - Intronic
1161563899 19:4988891-4988913 CAGGCTGGACGGGAGGGGAGGGG - Intronic
1163775492 19:19215003-19215025 CAGGCTGCACAGCAGGGTAGAGG - Intronic
1164682625 19:30145791-30145813 CAAGGGTCACGGAAGGGCAGGGG - Intergenic
1165792902 19:38502739-38502761 CAGGCTTCAGGGTGGGGCAGGGG + Intronic
1166380073 19:42351120-42351142 CAGTCTGCAGGGTGGGGCAGGGG + Intronic
1166723788 19:45012932-45012954 CTAGCTACATGGTAGGGCTGAGG + Intronic
927730139 2:25463943-25463965 CAGGCTGCACTGGAGTGCAGTGG + Intronic
929414115 2:41730012-41730034 GAGGCTGCAGGGTAGGGCATTGG - Intergenic
931639568 2:64369937-64369959 CACACAGCACGGTGGGGCAGTGG - Intergenic
934963821 2:98702322-98702344 CAAGCAGCACGGAGGGCCAGAGG + Intronic
935121908 2:100190587-100190609 CAAGCAGGCGGGTAGGGCAGAGG - Intergenic
935364899 2:102278903-102278925 TAAGCTGCAGGGTGAGGCAGGGG - Intergenic
936713682 2:115161657-115161679 CAAGCGGCAAGTTAGTGCAGCGG - Exonic
937638113 2:124179684-124179706 CAAGTTGCACGGCATGGAAGGGG + Intronic
942869841 2:180721491-180721513 CAGGCTGCACTGGAGTGCAGTGG - Intergenic
946633412 2:221697173-221697195 CAAGGTGTATGGGAGGGCAGAGG + Intergenic
1168830891 20:844842-844864 CAGGCGGCAAGGTAGGGCGGGGG - Exonic
1168848323 20:959967-959989 AAAGCTGCAGGGGAGGGCACAGG + Exonic
1169276319 20:4235820-4235842 CAGGGTGCACGGTGGGGCTGGGG + Intronic
1169756974 20:9053057-9053079 CAAGGTCCTCGGTGGGGCAGAGG - Intergenic
1173996211 20:47340448-47340470 CAGGCTGCAGTGTAGTGCAGTGG - Intronic
1175290357 20:57871140-57871162 GAGGCTGCTCCGTAGGGCAGAGG - Intergenic
1182082877 22:27541882-27541904 CAAGGTCCAGGGTCGGGCAGGGG - Intergenic
1182340092 22:29613413-29613435 CAAGCTGCTTGGGAGGGCTGAGG + Intronic
1184193161 22:42908567-42908589 CAGGCTTCACGGCAGGGCATGGG - Intronic
953062573 3:39439409-39439431 CAGGCTGCAGGGTAGAGCAAAGG + Intergenic
953431546 3:42844488-42844510 CATGCTGCACTGGTGGGCAGGGG + Intronic
953878036 3:46677378-46677400 CCAGCTGTAAGGGAGGGCAGAGG - Intronic
954931006 3:54281239-54281261 CAAGTGGCAAGGGAGGGCAGGGG - Intronic
958488350 3:94741124-94741146 AAATCTGCAGGGTAGGGCCGTGG + Intergenic
959081062 3:101801594-101801616 CAAGCTGCAGGCTGGGGCTGTGG + Exonic
961795723 3:129407550-129407572 CAAGCTGCACTTGGGGGCAGAGG - Intronic
962231414 3:133668761-133668783 CCACCTGCACAGTAGGCCAGAGG + Intergenic
965963635 3:174458586-174458608 CAAGCTCCAAGGTAGGTCAAGGG + Intronic
970703548 4:18771601-18771623 AAATGTGCATGGTAGGGCAGTGG - Intergenic
971192327 4:24439378-24439400 CTAGCTGCTCAGTAGAGCAGTGG - Intergenic
975557891 4:75682298-75682320 CCAGCTGCTCGGGAGGGCTGAGG + Intronic
976429800 4:84949141-84949163 CAAGTTGTAGAGTAGGGCAGAGG - Intronic
984557217 4:181228798-181228820 CAAGCTGCATGGCAGGCTAGCGG + Intergenic
991569194 5:68036511-68036533 CAAGCAGCATGGTAGCCCAGTGG - Intergenic
997448982 5:133966752-133966774 CAAGCTACACTGTAGTGCAGTGG + Intronic
999841352 5:155430994-155431016 CCAGCTCAACAGTAGGGCAGAGG - Intergenic
999877337 5:155822326-155822348 TCAGCTGCACGGTAGGGTACAGG + Intergenic
1000022315 5:157328601-157328623 CAAGCTGCATGCTAAGGCTGGGG + Intronic
1001574199 5:172751349-172751371 CAAGCTGCAAGGCTGGGCTGAGG - Intergenic
1003184792 6:3821345-3821367 CCGGCTTCACGGCAGGGCAGCGG - Intergenic
1003854518 6:10259382-10259404 GAGGCTGCAGGGAAGGGCAGAGG + Intergenic
1004563899 6:16777684-16777706 CAAACCCCATGGTAGGGCAGTGG + Intergenic
1007816787 6:44530608-44530630 CAAGCTGCAGGGCAGGCCAGTGG + Intergenic
1009542779 6:64984721-64984743 CTGGCTGCACTGTAAGGCAGAGG - Intronic
1013286925 6:108689760-108689782 CAACCTGCACAGTGGGGCAGTGG - Intergenic
1016443751 6:144111312-144111334 AAAGGTGCACTGCAGGGCAGCGG + Intergenic
1018242261 6:161789360-161789382 CAGGATGGACGGTAGGGGAGGGG - Intronic
1019005064 6:168789945-168789967 CAGGCTGCAAGCAAGGGCAGTGG - Intergenic
1023818991 7:43969914-43969936 CAAGGTGCCTGGTAGGGCTGAGG - Intergenic
1023968540 7:44975994-44976016 CCAGCTGCAGGGGTGGGCAGTGG + Intronic
1026902901 7:74046757-74046779 CAAGCTGCCTGGTAAGTCAGAGG + Exonic
1029471977 7:100760372-100760394 CAACCTGGAAGGCAGGGCAGAGG - Exonic
1030311067 7:108069708-108069730 CAAGCTGCATGATGGGGCTGTGG - Exonic
1031914721 7:127552245-127552267 CTAGCTGCACGGTTGAGGAGGGG + Intergenic
1032574886 7:133042980-133043002 CCAGCTGCTCGGTGGGGCTGAGG - Intronic
1034726284 7:153339166-153339188 CAAGGTGCATGGTAGATCAGAGG + Intergenic
1035814722 8:2527085-2527107 AGAGCTCCACTGTAGGGCAGGGG + Intergenic
1038248465 8:25881266-25881288 CAAGCTGCAAAGGTGGGCAGGGG - Intronic
1048057456 8:130881581-130881603 CAAGAAGAAAGGTAGGGCAGTGG + Intronic
1048799728 8:138184681-138184703 CCAGCTTCACGGCATGGCAGAGG + Intronic
1051608707 9:18941192-18941214 CAAACTGCAAGCTAAGGCAGGGG + Intronic
1053379206 9:37635612-37635634 CAAGCTGGAGGGCAGGGCACAGG + Intronic
1056655130 9:88502839-88502861 CAAGATGGACAGGAGGGCAGCGG + Intergenic
1061079959 9:128364012-128364034 GAAGCTGCAGGGTTGGGGAGAGG + Intergenic
1061491333 9:130946268-130946290 CAGGCTGGAGGGCAGGGCAGTGG - Intergenic
1061817419 9:133205441-133205463 GAGGCTGCAGGGTAGGGCAGAGG + Exonic
1062242984 9:135549785-135549807 GAGGCTGCAGGGTAGGGCAGAGG - Exonic
1062426110 9:136507014-136507036 CACGCGGCACGGCAGGGCCGGGG - Intronic
1190414271 X:50166102-50166124 CAGGCAGAAAGGTAGGGCAGCGG - Intergenic
1190520472 X:51274199-51274221 AAATCTGCAGGGCAGGGCAGCGG - Intergenic