ID: 1144576619

View in Genome Browser
Species Human (GRCh38)
Location 17:16433747-16433769
Sequence TGCACTGCAGGGGGGCCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 239}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144576619_1144576635 14 Left 1144576619 17:16433747-16433769 CCCTGGGGCCCCCCTGCAGTGCA 0: 1
1: 0
2: 2
3: 17
4: 239
Right 1144576635 17:16433784-16433806 GGAGCCAGGTCTGGTGGGAAGGG 0: 1
1: 1
2: 12
3: 38
4: 428
1144576619_1144576629 0 Left 1144576619 17:16433747-16433769 CCCTGGGGCCCCCCTGCAGTGCA 0: 1
1: 0
2: 2
3: 17
4: 239
Right 1144576629 17:16433770-16433792 GGGCACAGCTGCCAGGAGCCAGG 0: 1
1: 0
2: 6
3: 84
4: 549
1144576619_1144576628 -7 Left 1144576619 17:16433747-16433769 CCCTGGGGCCCCCCTGCAGTGCA 0: 1
1: 0
2: 2
3: 17
4: 239
Right 1144576628 17:16433763-16433785 CAGTGCAGGGCACAGCTGCCAGG 0: 1
1: 0
2: 3
3: 38
4: 387
1144576619_1144576634 13 Left 1144576619 17:16433747-16433769 CCCTGGGGCCCCCCTGCAGTGCA 0: 1
1: 0
2: 2
3: 17
4: 239
Right 1144576634 17:16433783-16433805 AGGAGCCAGGTCTGGTGGGAAGG 0: 1
1: 0
2: 3
3: 67
4: 678
1144576619_1144576630 5 Left 1144576619 17:16433747-16433769 CCCTGGGGCCCCCCTGCAGTGCA 0: 1
1: 0
2: 2
3: 17
4: 239
Right 1144576630 17:16433775-16433797 CAGCTGCCAGGAGCCAGGTCTGG 0: 1
1: 0
2: 3
3: 58
4: 516
1144576619_1144576632 9 Left 1144576619 17:16433747-16433769 CCCTGGGGCCCCCCTGCAGTGCA 0: 1
1: 0
2: 2
3: 17
4: 239
Right 1144576632 17:16433779-16433801 TGCCAGGAGCCAGGTCTGGTGGG 0: 1
1: 1
2: 1
3: 27
4: 283
1144576619_1144576637 18 Left 1144576619 17:16433747-16433769 CCCTGGGGCCCCCCTGCAGTGCA 0: 1
1: 0
2: 2
3: 17
4: 239
Right 1144576637 17:16433788-16433810 CCAGGTCTGGTGGGAAGGGCAGG 0: 1
1: 0
2: 4
3: 63
4: 569
1144576619_1144576631 8 Left 1144576619 17:16433747-16433769 CCCTGGGGCCCCCCTGCAGTGCA 0: 1
1: 0
2: 2
3: 17
4: 239
Right 1144576631 17:16433778-16433800 CTGCCAGGAGCCAGGTCTGGTGG 0: 1
1: 0
2: 6
3: 57
4: 520

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144576619 Original CRISPR TGCACTGCAGGGGGGCCCCA GGG (reversed) Intronic
900130807 1:1086389-1086411 TGCCCTGTGTGGGGGCCCCAGGG - Intronic
901068707 1:6506746-6506768 TGCCCTGCTGGGGGGCCTCTGGG - Intronic
901205577 1:7493889-7493911 TGCAGTGCTGGATGGCCCCATGG + Intronic
901211084 1:7526429-7526451 TCCACTGCAGGGGAGGCCCATGG - Intronic
901526282 1:9824841-9824863 TCCACTGCGGGGGGGTGCCAGGG - Intergenic
901659360 1:10788988-10789010 GCCACTGCAGGGGAGCCCAAGGG + Intronic
902332477 1:15737213-15737235 CACTCTGCAGGGGGGCCTCAGGG + Intronic
902587282 1:17447816-17447838 GGCACTGCAGGGACTCCCCACGG - Intergenic
902916177 1:19640982-19641004 TGCACTGAAGATGGACCCCAGGG - Intronic
903573739 1:24324985-24325007 GGCACGACAGGGGCGCCCCAGGG - Intronic
903755514 1:25657858-25657880 TGCTCTGCATTGAGGCCCCAGGG + Intronic
904037661 1:27567527-27567549 TGGAATGCTGGGAGGCCCCAGGG - Intronic
904376001 1:30082883-30082905 GTCACTGCAGGGCGGCCCCAGGG + Intergenic
904581542 1:31547716-31547738 TGGACTGCAGTGGGGCCCGGTGG + Intergenic
906501283 1:46343093-46343115 GGTATTGCAGGGGGGCCCTATGG - Intronic
907286933 1:53386699-53386721 TGCAGGGCAGGAGGGCACCAAGG + Intergenic
907524239 1:55044817-55044839 TGCACTGCACTGCTGCCCCATGG + Intronic
909539254 1:76772388-76772410 TGCAGTGCAGTGGGGCCTCCTGG - Intergenic
917001651 1:170367551-170367573 TGCACTGCAGGCTGCCTCCAGGG + Intergenic
919981560 1:202645183-202645205 TGCTCAGCAGGAGGGCACCAGGG + Intronic
920089302 1:203441030-203441052 TGAAGTGCACGGGTGCCCCACGG + Intergenic
920210057 1:204321435-204321457 TGCACTGCAGGGGGGCAGTAGGG - Intronic
921081083 1:211738792-211738814 TGTACCCCAGGGGGGCCTCATGG - Intergenic
921837665 1:219794722-219794744 TTCACAGCAGGGTGGCCTCATGG + Intronic
1062961550 10:1576537-1576559 TGAACTGCAGGTGGGACCCCAGG + Intronic
1063311686 10:4958283-4958305 AGCTCTGCAGGGGGTCTCCATGG + Intronic
1063316107 10:5008187-5008209 AGCTCTGCAGGGGGTCTCCATGG - Intronic
1065558716 10:26941464-26941486 AGAAGTGCAGGGGTGCCCCATGG - Intergenic
1066654280 10:37684334-37684356 AGCACTGCCTGGAGGCCCCAGGG - Intergenic
1067279112 10:44857954-44857976 TGCACTGCAGGGGGACCGCAGGG + Intergenic
1067700186 10:48565964-48565986 GGCCCTGCAGGAGGTCCCCATGG - Intronic
1070491136 10:76977671-76977693 TGCACTTCAGGTGGGCTCCACGG - Intronic
1071493914 10:86154847-86154869 TGCACTGCTGGGGTGTCCCCTGG - Intronic
1071876751 10:89850996-89851018 TGCACTCCAGGGGCCTCCCAGGG + Intergenic
1073098761 10:100996489-100996511 TGTATTGCAGGGAGGCCCCAAGG - Intergenic
1074299039 10:112216533-112216555 AGCCCTGCAGGGGGTCCCCTTGG - Intergenic
1074527784 10:114276905-114276927 TGCAGGGCTGGGGGGCTCCAGGG + Intronic
1075191267 10:120311186-120311208 GGCTCTGCAGGGGTGCCACAGGG + Intergenic
1075587809 10:123670000-123670022 GGCAGAGCAGGTGGGCCCCAGGG + Intronic
1075712406 10:124537728-124537750 GGCACTGCAGTGGGGCCCACAGG - Intronic
1075893449 10:125974310-125974332 TGCACTGCAGGAAGACCCCTGGG + Intronic
1077888177 11:6401483-6401505 AGTGCTGTAGGGGGGCCCCAGGG - Intronic
1081850262 11:46270807-46270829 TGCACAGAAAGGGGGCCCCGTGG - Intergenic
1081869027 11:46374953-46374975 TGCTCCCCAGGGTGGCCCCAGGG - Exonic
1083203361 11:61132984-61133006 AGCACAGCAGGAGGCCCCCAGGG - Intronic
1083206310 11:61151407-61151429 AGCTCTGCAGGGGAGACCCAGGG + Intronic
1083261105 11:61523656-61523678 TGCTCCAAAGGGGGGCCCCAGGG + Intronic
1083739348 11:64700251-64700273 TGCACTGCTGGGTGGACACATGG - Intronic
1083925064 11:65801137-65801159 TGCCCTGCAGGAGGGGCCAAGGG + Intergenic
1084029619 11:66473683-66473705 TGGCCTGCTGGGGGGCCCCTGGG + Intronic
1085463098 11:76706964-76706986 GGCAGTCCTGGGGGGCCCCAGGG + Intergenic
1085513921 11:77101565-77101587 TGAACAGCAGAGGGGCACCAAGG - Intronic
1085845571 11:80060743-80060765 GGCACACCAGGGAGGCCCCATGG + Intergenic
1089843087 11:121435692-121435714 GGCACTGCAGTGGGGCATCATGG - Intergenic
1090067759 11:123518170-123518192 TGCACTTAACGGTGGCCCCAAGG - Intergenic
1091394030 12:142719-142741 AGCACTGCTGTGGGGGCCCATGG + Intronic
1091567783 12:1661505-1661527 TGCTTTGCAGAAGGGCCCCAGGG - Intergenic
1091793386 12:3284008-3284030 GCCAGGGCAGGGGGGCCCCACGG + Exonic
1093181525 12:15972436-15972458 TGCATTGCAAGGGGGCCCTGCGG - Intronic
1094841667 12:34344940-34344962 TGCACGGCAGGGTGGGGCCAGGG + Intergenic
1095041181 12:37442510-37442532 GGCACTGCAGGGGGACTCCTTGG + Intergenic
1096555171 12:52399501-52399523 TGGAGGGCAGGGGGGCCCTAAGG - Intronic
1096976272 12:55700780-55700802 TGCACTGCTGTATGGCCCCAGGG - Intronic
1103446274 12:120997178-120997200 TGCACTGCTGTGGAACCCCAGGG + Intronic
1103745194 12:123117968-123117990 AGAACTCCAGGGGAGCCCCAAGG + Intronic
1105847811 13:24308307-24308329 TGCACCGCAGGCGGCCCCGACGG - Intronic
1107814240 13:44229848-44229870 TCCACCCCAGTGGGGCCCCAGGG - Intergenic
1108322883 13:49304269-49304291 TGGGCAGCAGGGGGACCCCACGG - Intergenic
1110458526 13:75717764-75717786 AGCACTGCATGGAAGCCCCAGGG - Intronic
1114270559 14:21098073-21098095 TGGAGAGCTGGGGGGCCCCAAGG - Intronic
1114355878 14:21907687-21907709 TGCACTGCAGGTGCCTCCCATGG - Intergenic
1114514118 14:23286321-23286343 TGCACTGCAGCTTGGCCCCAGGG - Intronic
1115490081 14:33950582-33950604 TGCACTGCACCGGGGCCCTGCGG - Exonic
1115854073 14:37611127-37611149 TGCACTTGAGGTGGGCGCCACGG + Intronic
1118920234 14:70143452-70143474 TGCACTCCAGGGGTGCTCCCAGG - Intronic
1121762558 14:96458306-96458328 TGAACTACAGGCGGGCGCCATGG + Intronic
1122113111 14:99515198-99515220 GGCCCTGCTGGGGGTCCCCAGGG - Exonic
1122788887 14:104176215-104176237 TCCAGGGCAGGGGGGCCCCCAGG - Exonic
1122921415 14:104881939-104881961 TACACTGCTGGGGGGCCAGAGGG - Intronic
1124237369 15:28002346-28002368 GGCCCTGCAGGGAGGCCCCATGG - Intronic
1124497247 15:30193919-30193941 TGCTCAGCAGGAGGGCACCAGGG + Intergenic
1124746327 15:32344728-32344750 TGCTCAGCAGGAGGGCACCAGGG - Intergenic
1125722227 15:41850841-41850863 AGCACTGCAGGTGGGCTTCAGGG - Exonic
1126293601 15:47111221-47111243 GGCACTGCAGGGGGACTCCTTGG - Intergenic
1127311023 15:57752559-57752581 TCCACAGCAGAGGGGCCCCATGG + Intronic
1131144039 15:90000451-90000473 CGCACTGCTGGGGGGCGCCGAGG - Intergenic
1131307173 15:91255255-91255277 TCCATGGCAGAGGGGCCCCATGG + Intronic
1132633783 16:932826-932848 CGCACTGCGGGGGAGGCCCAGGG + Intronic
1132686211 16:1163224-1163246 TGCCCTGCAGACGGGCACCAGGG - Intronic
1132692763 16:1188957-1188979 TGCACTGGAGCTGGGCCCCTTGG + Intronic
1132870775 16:2114835-2114857 AGCAGTGCAGGAGGGCGCCAGGG + Exonic
1134950178 16:18347925-18347947 AGCAGTGCAGGAGGGCGCCAGGG + Intergenic
1140376266 16:74447795-74447817 TGCACTGCAGGGGGACCTGGAGG + Intergenic
1141759664 16:86019645-86019667 TCCACTGAAGTGGGGCCCCCAGG + Intergenic
1142349752 16:89574736-89574758 TGCAGGGCGGGGAGGCCCCACGG - Intergenic
1142398938 16:89849155-89849177 GGCCCTGCAGGGGGGCCCTTTGG - Intronic
1142851069 17:2704990-2705012 TGGGCTGCAGGGGGGCTGCAGGG + Intronic
1144576619 17:16433747-16433769 TGCACTGCAGGGGGGCCCCAGGG - Intronic
1146579516 17:34024433-34024455 TGCACTGGGCGGTGGCCCCAGGG + Intronic
1148481288 17:47961118-47961140 TGTAATGCAATGGGGCCCCATGG - Intergenic
1148700869 17:49586016-49586038 TGGGCTGCAGAGGGGCCACATGG + Intergenic
1148805212 17:50260510-50260532 CTCTCTGCAGGCGGGCCCCAGGG + Intergenic
1148865043 17:50624018-50624040 AGCACTGCCGAGGGGCCCCTGGG + Exonic
1149026715 17:52035676-52035698 TGAACTCCATGTGGGCCCCACGG - Intronic
1151053256 17:71003885-71003907 AGCTCTGCAGGGAGGGCCCAGGG - Intergenic
1151692933 17:75698137-75698159 TGCAGTGCCGGGGTGGCCCAAGG + Intronic
1152095222 17:78268530-78268552 GGCATTGCAGGGGGTCCCTACGG + Intergenic
1152292285 17:79446803-79446825 TGCAGAGCAGGGCTGCCCCATGG - Intronic
1152645962 17:81468621-81468643 TGCACAGCTGCGGAGCCCCAAGG + Intergenic
1153226803 18:2906328-2906350 GACCCTGCCGGGGGGCCCCAGGG - Intronic
1153482088 18:5556967-5556989 AGCACAGCTGGGGGGCCCCGGGG + Intronic
1154384372 18:13880121-13880143 GGAACTGCAGAGGGGCCCCTAGG - Intergenic
1157329511 18:46693064-46693086 TGCCCTGCAGGGCAGCCCCAGGG - Intronic
1157587939 18:48817150-48817172 TGCACAGCAGGGTGGCACCCAGG + Intronic
1157588571 18:48820732-48820754 AGCACTGCAGGGGAGCCCCGGGG - Intronic
1157822926 18:50787097-50787119 TGCACTGCAGAGAAGCCCCTAGG + Intergenic
1159428086 18:68315042-68315064 TGCACTGCAGCAGGGCCCTTAGG + Intergenic
1160911236 19:1474715-1474737 TGCTCTGCAGTGGGGCCCCTGGG - Exonic
1162085597 19:8247196-8247218 TGCAAGGCATGGGGGCCGCAGGG - Intronic
1162806119 19:13138805-13138827 GGGACTTGAGGGGGGCCCCAGGG + Exonic
1163947807 19:20556176-20556198 TGCACTAAAGGGTGGCCACAGGG - Intronic
1164239602 19:23372922-23372944 TGCTCTGCAGGGCAGACCCAAGG - Intronic
1165139759 19:33691711-33691733 TGCATGGCTGGGTGGCCCCAAGG + Intronic
1166873488 19:45884265-45884287 TACAGCACAGGGGGGCCCCAGGG + Exonic
1168239581 19:55082367-55082389 CCCGCTGCAGGGGGGCCCGAGGG - Intronic
924979856 2:209703-209725 TGCACTGCAGAGTGGCCTGAGGG + Intergenic
925480875 2:4272673-4272695 GCCAGTGCAGGGGGGCCACAAGG - Intergenic
925532827 2:4883648-4883670 TGCACAGCAGGGGGCCAGCATGG + Intergenic
929419708 2:41778136-41778158 TTCAATGCAGGGTGGCACCATGG - Intergenic
931220969 2:60287370-60287392 TGCACAGGTGGGGTGCCCCATGG + Intergenic
931626253 2:64258455-64258477 TCCACTGCAGTGTGGTCCCAAGG - Intergenic
932134363 2:69215200-69215222 TGCACTGGAGGGGAAGCCCAGGG + Intronic
932777570 2:74537142-74537164 TCTACTGCAGGAGGTCCCCAAGG - Intronic
936058999 2:109282463-109282485 AGCACTGCAGGAAGGCCCGAGGG + Intronic
943611096 2:190035523-190035545 TGCACAGCAGGGCTACCCCATGG + Intronic
946174822 2:217916222-217916244 TGGATTGCAGGGGGACACCATGG - Intronic
947715249 2:232335962-232335984 TGCAGTGCTGGGGGAGCCCAGGG - Intronic
947734299 2:232446752-232446774 TGCAGTGCTGGGGGAGCCCAGGG - Intergenic
947876470 2:233471054-233471076 TGCACTGCAGAGGGGACAGAGGG - Exonic
948379122 2:237540852-237540874 TGTACTGGACGGGGTCCCCAGGG - Exonic
948783339 2:240338352-240338374 TGCTCTTCCTGGGGGCCCCATGG - Intergenic
1170582728 20:17711256-17711278 GGCCCTGGAGGGGGGCCCCGGGG - Intronic
1171535773 20:25887419-25887441 GGCACTGCAGGGGGACTCCTTGG + Intergenic
1171572086 20:26262479-26262501 GGCACTGCAGGGGGACTCCTTGG - Intergenic
1171805320 20:29673765-29673787 GGCACTGCAGGGGGACTCCTTGG - Intergenic
1171838733 20:30182665-30182687 GGCACTGCAGGGGGACTCCTTGG + Intergenic
1173838111 20:46138900-46138922 GGCACAGCAGGGGGCCTCCACGG - Intergenic
1173903311 20:46606893-46606915 TGCACTTCCTGGGGGACCCAGGG - Intronic
1174060025 20:47826174-47826196 TGCACTGCACGGGGCCTCCTTGG + Intergenic
1174071871 20:47905202-47905224 TGCACTGCACGGGGCCTCCTTGG - Intergenic
1174152179 20:48493467-48493489 TGCACTGCACGGGGCCTCCTTGG + Intergenic
1174369654 20:50078000-50078022 TCCAGGGCAGTGGGGCCCCATGG + Intergenic
1175413619 20:58787273-58787295 TGCACTGCAGGGAGCCCCAGGGG - Intergenic
1175862258 20:62156743-62156765 GGCACAGCTGGGTGGCCCCAAGG + Intronic
1176125717 20:63473587-63473609 GGGACTGGAGGGTGGCCCCAGGG + Intergenic
1176216551 20:63950852-63950874 TGAACAGCAGAGTGGCCCCAGGG + Intronic
1176219040 20:63961395-63961417 TGCATTGCAGGGGGCCCACCTGG - Exonic
1178981200 21:37267026-37267048 TGCCCTGCGAGGAGGCCCCAGGG - Intronic
1179437128 21:41369672-41369694 CGCCCTGCAGGAAGGCCCCAGGG - Intronic
1179494972 21:41766061-41766083 TGGGGTGCAGGAGGGCCCCATGG + Intronic
1179717295 21:43296087-43296109 TGGACTGGAGGGGGCCCCCAAGG - Intergenic
1180007778 21:45031113-45031135 TGGCCTGCAGGGAGGTCCCAGGG + Intergenic
1180022242 21:45135825-45135847 TGGACTGCAGGTGGGCCCAGTGG + Intronic
1181336796 22:22141248-22141270 TTCACTGGAGGGAGGCCCCAGGG - Intergenic
1181669262 22:24418571-24418593 TGCACTGCAGGCGGGACGGATGG - Intronic
1182564483 22:31187137-31187159 TCCAGTGCAGGGGGGCCCAGTGG + Exonic
1182951683 22:34381958-34381980 TGCATTCCAGGGGGGCTGCACGG - Intergenic
1183544620 22:38448902-38448924 TGCCCTGCTGGGGGCCCCCCAGG + Intronic
1183603116 22:38851395-38851417 TGGGCTGCAGGGGGGCAGCAGGG + Intergenic
1183785071 22:40024484-40024506 TTCCCTGCATGGGGGCCCAAAGG - Intronic
1185000588 22:48243077-48243099 TCAACTGCAGGGGGTCCCCTGGG - Intergenic
1185013818 22:48332009-48332031 TGCCCTGCAGGGAGACGCCATGG + Intergenic
949489512 3:4574961-4574983 TGCACTCTAGGAGGGCCTCAGGG - Intronic
952961135 3:38589751-38589773 AGCACTGCCGGGGTGCACCAGGG + Intronic
953474510 3:43194263-43194285 TGCCCTTCAGTGGGGCCCGAAGG + Intergenic
953995389 3:47515257-47515279 TGGACTGCAAAGGGGACCCAGGG + Intergenic
954625283 3:52019154-52019176 TCCACGGCATGGGGGCCTCAGGG + Intergenic
956186803 3:66570367-66570389 TGCACTGCAGTGGGGCCGAGAGG - Intergenic
960995344 3:123336671-123336693 TGGAGTGCAGGGGAGCCCCTGGG - Intronic
961427329 3:126858454-126858476 AGCCCAGCAGGGGTGCCCCATGG + Intronic
961625204 3:128257347-128257369 TGCTCTCCAGAGGGGCTCCACGG + Intronic
968466972 4:757255-757277 TGCAGTGCATGGGGCCCGCAGGG - Intronic
968566503 4:1316319-1316341 TCCACTGCTGTGGGGGCCCATGG + Intronic
969297531 4:6278659-6278681 ACCACAGCAGGGAGGCCCCACGG - Intronic
969428122 4:7137815-7137837 TGCATTCCAGAGTGGCCCCAAGG + Intergenic
969592694 4:8130902-8130924 TGGACGGCAAGGTGGCCCCAGGG + Intronic
970653509 4:18204037-18204059 TGCACTGCAGAGGGTAACCATGG - Intergenic
971600040 4:28581064-28581086 TGTGCTGCAGGAGGGACCCAGGG + Intergenic
973748206 4:53985238-53985260 CGCACTGTAGGGAGGCCACATGG - Intronic
973942428 4:55924253-55924275 TGTCCTGCAGGGAGGACCCAGGG + Intergenic
985266539 4:188156727-188156749 TGCACTGCAAGGCGTCCCAAAGG + Intergenic
988764117 5:34350826-34350848 CACACAGCAGGGGGGTCCCAGGG + Intergenic
990240567 5:53812473-53812495 TGCGTTGCAGAGGGGCCCCTTGG + Intergenic
995798121 5:115962616-115962638 TGAGCTGGAAGGGGGCCCCATGG - Exonic
996052145 5:118947175-118947197 GACACTGCCGGGGGGCCCCATGG - Intronic
996522106 5:124438562-124438584 TCCACCGCAGGGCTGCCCCATGG - Intergenic
997195555 5:131976958-131976980 TGCACAGGAGGGGTGCCTCAAGG + Intronic
998369113 5:141649874-141649896 TGGACAGCAGGTGGGCCCTATGG - Exonic
1001667040 5:173441814-173441836 TGGGCTGCAGGGGGGATCCAGGG + Intergenic
1002775164 6:322400-322422 TTCCCTGCAGGGGCGCCTCAGGG + Intronic
1005315215 6:24597408-24597430 TGCACTCCAGAGGTGTCCCAAGG - Intronic
1005977478 6:30811094-30811116 TGGCGTGCAGGGGTGCCCCATGG - Intergenic
1006046239 6:31301140-31301162 TGCACTGTGGGTGGGTCCCAAGG + Intronic
1013411761 6:109889522-109889544 TACACTGCAGGGGGAACCAAAGG - Intergenic
1016904842 6:149138153-149138175 AGCACTGCAGGGAGGCAGCAGGG + Intergenic
1018013704 6:159693647-159693669 TGCGCTGCCGGGGGGCCGCGGGG + Intronic
1018983361 6:168616884-168616906 TGCACTGCGGGGGGGTTGCAGGG + Intronic
1019431080 7:1000162-1000184 TGCCCTGCAGTGGGGCCCTGAGG + Intronic
1019659859 7:2218208-2218230 TCCACTGCATGGGTACCCCAAGG + Intronic
1019747539 7:2709172-2709194 TGTCCTGCAGGGGGGCCTCGGGG - Exonic
1019896933 7:3990045-3990067 TGCACTACAGCGGGGCTTCAGGG + Intronic
1020967241 7:14886719-14886741 TGAACTGCAGGTGGGCCAGATGG - Intronic
1022453499 7:30537436-30537458 AGCACCGGAGGGGGTCCCCATGG + Intronic
1022510819 7:30933819-30933841 TGCCCTGCAGGGGTCCCCGAAGG - Intergenic
1023048449 7:36231154-36231176 TGGACTGCAGGGGTGCCCTCTGG + Intronic
1023795297 7:43787521-43787543 TCCACTGGAGGAGGGACCCAGGG + Intronic
1023907818 7:44534617-44534639 TGCATTGCAGGTGGACTCCAAGG - Exonic
1025150272 7:56541876-56541898 AGCACTGCTTGGGGGCACCAGGG + Intergenic
1026988778 7:74571253-74571275 TGCACTCCAGGGTGGCCCCAGGG - Intronic
1027569623 7:79847597-79847619 TGCCCTGCGCGGGGGCACCAGGG + Intergenic
1029492840 7:100881747-100881769 TGGACGTCAGGGTGGCCCCAGGG - Exonic
1031990897 7:128198182-128198204 TGGACTGTAGGGGTGGCCCAGGG - Intergenic
1032990190 7:137385849-137385871 TGCAGTGCAGGAGAACCCCAGGG - Intronic
1033447534 7:141436138-141436160 TGCTCTGCTGGGGTTCCCCATGG + Intronic
1033659812 7:143395536-143395558 TGCACTGCAGGGCTCCTCCAGGG + Intronic
1034563857 7:151898392-151898414 TGCCCGGCAGGGGAGCCGCAGGG + Intergenic
1034753752 7:153595046-153595068 CTCACTGCAGATGGGCCCCAAGG - Intergenic
1035657197 8:1319157-1319179 TGCAGTGCCTGGGGCCCCCATGG + Intergenic
1035866004 8:3082575-3082597 CGCACTGCAGGCGGGTACCAAGG - Intronic
1037471477 8:19215518-19215540 TGCAAAGCAGGGCTGCCCCATGG - Intergenic
1037618675 8:20543935-20543957 TGCCCTTCAATGGGGCCCCACGG - Intergenic
1038004248 8:23416526-23416548 TGCACTCCAGGAGGTGCCCATGG + Intronic
1038046752 8:23772035-23772057 TTCACTGGAGGTGGGCTCCAGGG + Intergenic
1044730598 8:95225834-95225856 ACCCCTGCAGGGAGGCCCCAAGG + Intergenic
1049201383 8:141342162-141342184 TGGAGTCCAGGGGGGCCCCCAGG + Intergenic
1049220720 8:141427652-141427674 TGCAGGGCACGGGGGCCCAAGGG - Intronic
1049297822 8:141852508-141852530 TGGGCTGCAGAGGGGCCCCGTGG + Intergenic
1049300806 8:141868448-141868470 GGCACTGCTGGGAGGCACCAGGG - Intergenic
1049300818 8:141868486-141868508 GGCACTGCTGGGAGGCGCCAGGG - Intergenic
1049300830 8:141868524-141868546 GGCACTGCTGGGAGGCGCCAGGG - Intergenic
1049383960 8:142331555-142331577 TGCACTGCAGGACGGCCTGACGG + Intronic
1049647166 8:143740652-143740674 TGCCCAGCAGGGGCGCACCAGGG - Intergenic
1055435453 9:76287886-76287908 TGAAATGCATGTGGGCCCCAGGG + Intronic
1056018874 9:82421471-82421493 TGCCTTGCAGGCGTGCCCCATGG + Intergenic
1056691410 9:88811659-88811681 TCCATTGCAGGGGGGCACAAAGG - Intergenic
1060239101 9:121887890-121887912 TGAACTGCCTGGGGGCCCCCAGG + Intronic
1060471454 9:123951805-123951827 GGCACTTCAGGTGGGCCCCTGGG + Intergenic
1061395643 9:130342165-130342187 CACCCTGCAGGGAGGCCCCATGG - Intronic
1061925526 9:133804392-133804414 CGCACTGCAGTGGCGCTCCAAGG + Intronic
1062031378 9:134363566-134363588 TGCCCTCCAGGGAGGCCCCAAGG + Intronic
1062045107 9:134421427-134421449 TGCACCACTGGGGGGACCCAGGG - Intronic
1062444460 9:136587858-136587880 TGCCCAGCAGGTGGGCACCAAGG + Intergenic
1062566582 9:137166395-137166417 TGGACTGCAGGGTGGCCACGGGG - Intronic
1062729298 9:138100235-138100257 TGCATTGCAGAGGGGCTGCAAGG + Intronic
1186536867 X:10359083-10359105 TGCAGAGCAGGGCTGCCCCATGG + Intergenic
1187324524 X:18274217-18274239 TGAACTCCATGGGGGCCCCATGG - Intronic
1190263596 X:48814872-48814894 TGCCCTGCAAGGGGACCCCAAGG + Exonic
1191255424 X:58277579-58277601 TGCACTCCAGGTGGGATCCAGGG + Intergenic
1200561434 Y:4708413-4708435 GGAACTGCAGAGGGGCCACAGGG - Intergenic