ID: 1144578172

View in Genome Browser
Species Human (GRCh38)
Location 17:16443027-16443049
Sequence CTGGGTCTCCATAAGGAGGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 144}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144578169_1144578172 -9 Left 1144578169 17:16443013-16443035 CCTCAGAAATAGGGCTGGGTCTC 0: 1
1: 0
2: 1
3: 13
4: 189
Right 1144578172 17:16443027-16443049 CTGGGTCTCCATAAGGAGGTAGG 0: 1
1: 0
2: 2
3: 13
4: 144
1144578164_1144578172 8 Left 1144578164 17:16442996-16443018 CCTAGAATCAAGGTGGGCCTCAG 0: 1
1: 0
2: 1
3: 17
4: 188
Right 1144578172 17:16443027-16443049 CTGGGTCTCCATAAGGAGGTAGG 0: 1
1: 0
2: 2
3: 13
4: 144
1144578160_1144578172 22 Left 1144578160 17:16442982-16443004 CCTATGGGCAGATGCCTAGAATC 0: 1
1: 0
2: 0
3: 12
4: 104
Right 1144578172 17:16443027-16443049 CTGGGTCTCCATAAGGAGGTAGG 0: 1
1: 0
2: 2
3: 13
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144578172 Original CRISPR CTGGGTCTCCATAAGGAGGT AGG Intronic
900437604 1:2639015-2639037 CTGGGTCTCCACATGGTGGAGGG + Intronic
900650381 1:3727400-3727422 CTGGGCCTCCGGAGGGAGGTGGG + Intronic
901217577 1:7563296-7563318 CTGCCTCTCCGTAAGGAGTTGGG - Intronic
905506023 1:38480385-38480407 CTGGGCCTCCAGAAGGAACTGGG + Intergenic
905858484 1:41330599-41330621 CTGTGTCTCCATATGGAGAGGGG - Intergenic
907722456 1:56984482-56984504 CTGCTTCTGCATATGGAGGTGGG + Intergenic
908596092 1:65690252-65690274 CTGTGTCTCCAACAGGAGGTGGG - Intergenic
912487816 1:110042969-110042991 CTGGGTCTCTATAAAGACATGGG + Intronic
915340952 1:155176303-155176325 GTGGGTTTCCAAAAGGAAGTGGG + Intronic
917973092 1:180220832-180220854 GTGGGACTCCAAAAGGCGGTAGG + Intergenic
919016253 1:192041065-192041087 CTGGGCCACCACAAGGAGCTTGG - Intergenic
923280836 1:232441617-232441639 CTGGGTCTCCAGATGCAGGAGGG - Intronic
1064907516 10:20362738-20362760 CTGGATTTCCATTAGAAGGTGGG + Intergenic
1065158485 10:22894735-22894757 CTGGCTCTCCACATGCAGGTAGG + Intergenic
1066640567 10:37550852-37550874 CTGGGACTGCAGAAGGAGCTTGG - Intergenic
1070953100 10:80446538-80446560 CTGGGTCTCCATTTGCAGCTGGG + Intergenic
1071144274 10:82549422-82549444 CTGGGTCTGCACAGGGAGGTGGG + Intronic
1072735035 10:97873521-97873543 CATGGTCTCCATAAGCAGTTGGG + Intronic
1073608591 10:104920967-104920989 CTGGGCTCCCATAAGGAAGTTGG - Intronic
1074375082 10:112933918-112933940 CTGGGGCTCCCTAGGGAGGGTGG + Intergenic
1074400949 10:113140908-113140930 CTTGGGCTCCATAATGGGGTAGG + Intronic
1075743845 10:124712748-124712770 CTGTGTCTCCATGATCAGGTTGG - Intronic
1076305337 10:129462101-129462123 CTGGGTCACTAGAAGGAAGTGGG - Intergenic
1079488607 11:20962513-20962535 CTGGGTCTCAATAGAGAAGTGGG - Intronic
1081028366 11:38045009-38045031 GTGGCTCTCCATATGGAGGAGGG - Intergenic
1083664753 11:64268365-64268387 CTGGGTCTTCAGAAATAGGTGGG + Intronic
1084061359 11:66677604-66677626 CCGGGTCTCCGGAAGGAGGCGGG - Exonic
1099270003 12:80496977-80496999 CTGGATCTTAATGAGGAGGTTGG + Intronic
1099923252 12:88985278-88985300 CTGCTTTGCCATAAGGAGGTAGG - Intergenic
1101147492 12:101854901-101854923 TTGGGTCACCATGAGGAAGTGGG - Intergenic
1101467702 12:104964672-104964694 ATGGCTATTCATAAGGAGGTTGG - Intergenic
1105266085 13:18816895-18816917 CTCTTTCTCCATAAGGAGCTTGG + Intergenic
1107810681 13:44197126-44197148 GTGTGTCTCCTTAAGGAGGTTGG + Intergenic
1112912657 13:104507514-104507536 CTGGGTCTCCAAAAGGAGGAAGG - Intergenic
1113364197 13:109661321-109661343 CTGAGTCTCTATCAGGAGCTGGG + Intergenic
1114922148 14:27344985-27345007 CTAGTTCTCCATAAGGATGATGG - Intergenic
1121095761 14:91217051-91217073 CTGGGGCTCCTCAAGGAGATGGG + Intronic
1121520076 14:94580135-94580157 CTGGGTATCCAGAAGCAGGCAGG - Intronic
1122513689 14:102290855-102290877 ATGAGTCTCCAAATGGAGGTGGG + Intronic
1122919431 14:104873988-104874010 CTGGATCTCCCTCAGGGGGTTGG - Intronic
1129668235 15:77591759-77591781 CTGGGTCACTCTAAGGAGGGAGG + Intergenic
1129718727 15:77866308-77866330 CTGAGGCTCCACAAGGAGGCTGG - Intergenic
1130849115 15:87776676-87776698 CTGGGTCTACAGAAGCAGATAGG + Intergenic
1131988516 15:98068631-98068653 GTGAGTCTCCAAGAGGAGGTTGG - Intergenic
1132805607 16:1773726-1773748 CAGGGCCTCCATCAGGACGTCGG - Exonic
1132910225 16:2306484-2306506 CTGGGTCTGTGGAAGGAGGTGGG - Intronic
1134812458 16:17179223-17179245 CAGGGTCTCCTTGAGGAGGCAGG + Intronic
1135566681 16:23516621-23516643 TTGGGTCTTCATAAGGAGGGAGG - Intronic
1136506720 16:30709121-30709143 CTGGGTCTCAAAAAATAGGTAGG - Intronic
1136750853 16:32634434-32634456 CTCAGTCTCCCTAAGGAGCTGGG - Intergenic
1137543062 16:49377884-49377906 CTGGGTCTCCAAATGGAGGAGGG + Intronic
1137547783 16:49416240-49416262 GTGTGTCTCCATAATGAGGGGGG + Intergenic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1138973310 16:62172129-62172151 CAGTGTCTCCCTAAGAAGGTTGG - Intergenic
1140963270 16:79938201-79938223 CTGGTTCTCAATAATCAGGTTGG + Intergenic
1141719575 16:85748664-85748686 CTGGGTTACGATAAGGAGTTTGG + Intronic
1203052988 16_KI270728v1_random:893698-893720 CTCAGTCTCCCTAAGGAGCTGGG - Intergenic
1144578172 17:16443027-16443049 CTGGGTCTCCATAAGGAGGTAGG + Intronic
1146049096 17:29534618-29534640 CTTGCTCTACCTAAGGAGGTTGG + Intronic
1147718059 17:42521385-42521407 CTGGCTCACCACCAGGAGGTGGG - Exonic
1147769913 17:42860343-42860365 TTGGGGCTCCATGAGTAGGTAGG - Intergenic
1151393889 17:73807002-73807024 CTGTGTCTTCATATGGTGGTAGG + Intergenic
1153720475 18:7896549-7896571 ATGGGTCTCCATAAAGAAGTGGG + Intronic
1153818294 18:8809866-8809888 CTGGGTGTGAATGAGGAGGTGGG + Intronic
1154422326 18:14244591-14244613 CTCTTTCTCCATAAGGAGCTTGG - Intergenic
1155007881 18:21745394-21745416 GTGGGTTGCCACAAGGAGGTGGG - Intronic
1156479717 18:37428410-37428432 CTGGGTCTCTGTAAGGAAGGAGG + Intronic
1156486343 18:37468357-37468379 CTGGAGCTCCAGAAGAAGGTTGG + Intronic
1156764208 18:40631735-40631757 CTAGTTCTCCTTCAGGAGGTGGG + Intergenic
1160463822 18:79059218-79059240 CTGCATCTCCATATGGCGGTTGG + Intergenic
1164486985 19:28666929-28666951 TTTTGTCCCCATAAGGAGGTAGG + Intergenic
1165585714 19:36914028-36914050 CTGGGTATTAATAAGGAGGGGGG + Intronic
1167508025 19:49881364-49881386 CTGGGTCACCAGAACCAGGTAGG - Exonic
929401507 2:41587534-41587556 TAGGGACTCCAAAAGGAGGTGGG - Intergenic
929429743 2:41877239-41877261 CTGGGACCCCTTGAGGAGGTGGG - Intergenic
929591033 2:43146356-43146378 CTGTGTCTCCACCAGGTGGTGGG + Intergenic
929608724 2:43253961-43253983 CTGGGTCTCCAGAGGGAGACTGG - Intronic
930774916 2:55161984-55162006 CTGGGTCTGCATAGGGAGCGAGG - Intergenic
931167004 2:59758974-59758996 CTAGGTCTACATCAGGAGGTTGG + Intergenic
931295805 2:60923984-60924006 CTGGAGCTGCATGAGGAGGTGGG - Exonic
931899607 2:66772872-66772894 ATGGGTCTCAGAAAGGAGGTGGG + Intergenic
939067292 2:137498975-137498997 CTGAGTCTCCCTCAGGAAGTGGG + Intronic
943126442 2:183798480-183798502 TAGGGACTCCAAAAGGAGGTGGG - Intergenic
946189870 2:218002572-218002594 CTGGGACTCCATTGGGGGGTGGG + Intronic
946503187 2:220271518-220271540 ATGGTTCTCCATAATGTGGTGGG + Intergenic
947288899 2:228549579-228549601 ATGGTTATTCATAAGGAGGTGGG + Intergenic
1171887132 20:30663191-30663213 CTCTTTCTCCATAAGGAGCTTGG + Intergenic
1172226629 20:33309726-33309748 CTGGGTTTCCACAAGGAGGCTGG - Exonic
1176851152 21:13915358-13915380 CTCTTTCTCCATAAGGAGCTTGG + Intergenic
1178441564 21:32602667-32602689 CTGGATCTACATAAGGTGGAGGG + Intronic
1179460290 21:41530013-41530035 CTGGGTCTCACTCAGCAGGTGGG + Intronic
1181099033 22:20526728-20526750 CTCGGCCTCCCAAAGGAGGTGGG + Intronic
1182260333 22:29069495-29069517 CTGGGCCTCCAGAAAGATGTTGG - Intergenic
1183579494 22:38715424-38715446 CTGGGCCTGCAGAAGGAGGAAGG - Intronic
1183725994 22:39590018-39590040 CTGGGCCTGCAGAAGGAGGGTGG + Intronic
949941485 3:9158242-9158264 CTGGTTCTTTACAAGGAGGTGGG + Intronic
950471233 3:13187817-13187839 GTGGCTCTCCATAAGGAGGTGGG - Intergenic
950562592 3:13743385-13743407 CAGGGACTCCAAAAGGAGGAGGG - Intergenic
953746788 3:45580637-45580659 CTGGATCTCAAGAAAGAGGTAGG + Intronic
953925617 3:46980954-46980976 CTGGCCCTCCATAAGGAGGCTGG + Intronic
954379445 3:50211891-50211913 CTGGGTCTCAAAAAAGAGGATGG - Intronic
954575142 3:51671655-51671677 GTGGGGCTCCGTGAGGAGGTGGG + Exonic
961410230 3:126715092-126715114 CTGGGGCTCCATAAAGCAGTCGG + Intronic
963649965 3:147966656-147966678 CTGGGTCCCAATGAGGATGTGGG + Intergenic
968298172 3:197593231-197593253 CTGTGTCTCCGCACGGAGGTGGG + Intergenic
973370490 4:49242880-49242902 CTCTTTCTCCATAAGGAGCTTGG + Intergenic
977582708 4:98743113-98743135 CTTGGTCTGCATATGGAGTTGGG - Intergenic
983608846 4:169620382-169620404 CTGGGTCTCGAGGAGGAGGAGGG - Intronic
983884488 4:172965158-172965180 CTGGGGCTCAAAAACGAGGTTGG + Intronic
984828099 4:183946393-183946415 CTCGGTGTCCATGAGGAGGGGGG + Intronic
985049226 4:185972788-185972810 CTGGGGCTCCATCAGGAAGAGGG + Intergenic
985063062 4:186097107-186097129 CAGGGGCTCCCTAAGGAGGGAGG - Intergenic
985940214 5:3129220-3129242 CTGGGTGTCCAAAGGAAGGTTGG - Intergenic
986210757 5:5669649-5669671 CTGGGGCTGCACAGGGAGGTAGG - Intergenic
987136980 5:14909355-14909377 CTGGCTCTCCATAATGTGGTGGG - Intergenic
987864853 5:23525601-23525623 CTGGTTCTCCATCAGGAAGTGGG - Intronic
991041461 5:62180199-62180221 CTGGGACTCCAAAAGGGGGGAGG + Intergenic
994189695 5:96856067-96856089 CTGGGCCTCCCTAAAGGGGTGGG - Intronic
996390277 5:122952932-122952954 CTGGGACTCCAGAAAGAAGTAGG - Intronic
996644724 5:125799737-125799759 CAGGGTCTCCATGAGGTAGTTGG - Intergenic
998138266 5:139685738-139685760 CTGGGTCACTCTACGGAGGTGGG - Intergenic
998222956 5:140302872-140302894 CTGGGTCTCCATAAACGGGGTGG - Intronic
1003530467 6:6933169-6933191 ATGGGCGTTCATAAGGAGGTGGG + Intergenic
1004897624 6:20163864-20163886 CTGGGCCTCCATAAGGAGTGAGG + Intronic
1007121120 6:39382322-39382344 CAGAGACTCCAAAAGGAGGTAGG - Intronic
1007660656 6:43483756-43483778 CTTGGTCTCTAAAATGAGGTTGG + Intronic
1013377008 6:109527082-109527104 CTGGGTCTCCATTAGGTGTTGGG - Intronic
1014214115 6:118736511-118736533 CAGGGTCTGAATCAGGAGGTAGG + Intergenic
1015042343 6:128737314-128737336 CTTGGTCTCCATAATCATGTGGG + Intergenic
1018538292 6:164848044-164848066 CTGGGACTCCGGAAGGAAGTGGG - Intergenic
1019780478 7:2936940-2936962 GTGGGTCTCCACGGGGAGGTGGG + Intronic
1024997105 7:55280237-55280259 CTGGGTCTGCAGGAGGGGGTTGG - Intergenic
1026365748 7:69646702-69646724 CTGGGTCTACAAAAGGAGAGAGG - Intronic
1026853960 7:73741094-73741116 CTGGACCGCCCTAAGGAGGTGGG - Intergenic
1031305834 7:120125826-120125848 CTGTGTCTTCATATGGAGGAAGG - Intergenic
1032650358 7:133871516-133871538 CTGGGTGTTCATAAGGCTGTGGG - Intronic
1035923204 8:3700812-3700834 TTGGGTCTTCATAAGGAATTTGG + Intronic
1040693186 8:49964253-49964275 CTGGCTCCCCACAAGGAGGAGGG + Intronic
1043477522 8:80619735-80619757 CTTGGTCTCCAAAAGGGGCTGGG + Intergenic
1044908249 8:97028449-97028471 ATGGCTCCCCATGAGGAGGTGGG + Intronic
1045683598 8:104688651-104688673 CTGGGTCTCCCCCTGGAGGTAGG - Intronic
1045738773 8:105328882-105328904 CTGAGTCTTCATTTGGAGGTGGG - Intronic
1048509967 8:135053484-135053506 TAGGGTCTTCATAAGGAGGCAGG + Intergenic
1048995930 8:139793750-139793772 CTGGGTCTCCATGTGGATCTGGG - Intronic
1049698105 8:143993476-143993498 CTGTGTCTCCATCAGCAGGGAGG - Intronic
1051836877 9:21348824-21348846 ATGATTATCCATAAGGAGGTGGG - Intergenic
1053055572 9:34991458-34991480 CAGGGACACCAAAAGGAGGTGGG + Intronic
1053306363 9:36986947-36986969 CTGGGTGTCCAGAGGGAGGAAGG + Intronic
1059505004 9:114790611-114790633 CTTGGTCCCCATGAGGAGCTGGG + Exonic
1060235758 9:121861616-121861638 CTTAGTCTCCAGAAGGAGGAGGG + Intronic
1062372866 9:136249179-136249201 CTAGGACACCATGAGGAGGTGGG + Intergenic
1203793956 EBV:166270-166292 ATGGGTCCTCATAAGGCGGTGGG - Intergenic
1185621205 X:1452483-1452505 CTGGGTCCCCATAGGGATGGGGG - Intronic
1186632310 X:11363161-11363183 CTGTGGCTCCATTAGGAGATGGG - Intronic
1186906619 X:14117951-14117973 CTTGGTCTCCACATGGAGGATGG - Intergenic
1188246696 X:27843572-27843594 CTGGGTAGCCATCAGAAGGTAGG - Intergenic
1191115291 X:56846236-56846258 CAGGGTATCCACAAGGAGGCTGG - Intergenic
1194432622 X:93828925-93828947 CTGTGTCTCCACAAAAAGGTAGG + Intergenic
1195832892 X:109079063-109079085 CTGTATCTTCATAAGGATGTGGG - Intergenic
1201291390 Y:12423679-12423701 CTGGGACTCCATAATGAAGATGG - Intergenic