ID: 1144578295

View in Genome Browser
Species Human (GRCh38)
Location 17:16443641-16443663
Sequence GTGCCACAGGGCCCCCTCCA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 267}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144578289_1144578295 -1 Left 1144578289 17:16443619-16443641 CCCTCATGGTGGTCTTCGGCAGG 0: 1
1: 0
2: 0
3: 6
4: 104
Right 1144578295 17:16443641-16443663 GTGCCACAGGGCCCCCTCCAGGG 0: 1
1: 0
2: 0
3: 23
4: 267
1144578287_1144578295 4 Left 1144578287 17:16443614-16443636 CCTTGCCCTCATGGTGGTCTTCG 0: 1
1: 0
2: 2
3: 11
4: 149
Right 1144578295 17:16443641-16443663 GTGCCACAGGGCCCCCTCCAGGG 0: 1
1: 0
2: 0
3: 23
4: 267
1144578291_1144578295 -2 Left 1144578291 17:16443620-16443642 CCTCATGGTGGTCTTCGGCAGGT 0: 1
1: 0
2: 0
3: 0
4: 78
Right 1144578295 17:16443641-16443663 GTGCCACAGGGCCCCCTCCAGGG 0: 1
1: 0
2: 0
3: 23
4: 267

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144578295 Original CRISPR GTGCCACAGGGCCCCCTCCA GGG Exonic
900145915 1:1158605-1158627 GAGCCACTGGGCCCCCTCCGTGG + Intergenic
900545959 1:3229350-3229372 GTGCCCCGGGGGCCCCTCCCCGG + Intronic
900686573 1:3952270-3952292 GGGCAACAGGGCCCCTTCCTGGG - Intergenic
901323755 1:8355295-8355317 GTTCCACAATGTCCCCTCCAGGG + Intronic
901678051 1:10898321-10898343 GGGTCAGAGGGCCCCCTCAAGGG + Intergenic
901686908 1:10948215-10948237 GTGCCCCCTGGCCCCCTCCCTGG + Exonic
902042502 1:13503047-13503069 TTGCCACAGGGACCCACCCAGGG + Intronic
902134373 1:14292352-14292374 TTTCCAGAGGCCCCCCTCCAGGG - Intergenic
902234304 1:15047903-15047925 GGGCCACAGGGCACACTGCATGG - Intronic
903141695 1:21343057-21343079 GTCACACAGGTCCCCCTCCCGGG + Intronic
903145405 1:21368816-21368838 GTGTCACAGGGCTCCATCCCTGG - Intergenic
903853322 1:26321084-26321106 GAGCCCCAGGGCACCCCCCAAGG + Intergenic
903951724 1:26999557-26999579 GTTCCCCAGGGCCCATTCCAGGG - Intronic
904437228 1:30506723-30506745 GTGCCACAGGGTTCCGTCCTGGG - Intergenic
905146764 1:35893242-35893264 GTGCCTCATGGCCACATCCAGGG - Exonic
905301927 1:36991478-36991500 GTCCCAGAGGGTCACCTCCATGG + Intronic
905907460 1:41628420-41628442 GGGCCACAGCCCCCTCTCCAGGG - Intronic
907669629 1:56463278-56463300 GTTCCTCAGGGTTCCCTCCACGG - Intergenic
912338919 1:108890724-108890746 GTGCCACAGAAACTCCTCCAGGG - Intronic
919768764 1:201143907-201143929 GAGCAACAGGGCACCCACCACGG + Exonic
920342811 1:205286150-205286172 GAGCCCTAGGGCTCCCTCCATGG - Intergenic
922278809 1:224102851-224102873 GTGCCCCAGGGCCCAGTCCTTGG - Intergenic
923096306 1:230777875-230777897 GTGTCCCAGGACCCCATCCATGG + Intronic
1062927562 10:1328218-1328240 GCGGCACAGGGACCCCTCTATGG + Intronic
1065138252 10:22694057-22694079 GTGCCACAGGGCTGACTGCAAGG + Intronic
1067297279 10:44982126-44982148 GTGGCGCAGGACCCCCTCCCAGG + Intronic
1067944544 10:50681869-50681891 CTGCCACAGTCCCTCCTCCAGGG - Intergenic
1068701195 10:60021852-60021874 GTGCCACAGGGCCTTGTGCAAGG + Intergenic
1068717627 10:60205709-60205731 GAGCCCCAGGGCCATCTCCAGGG - Intronic
1074243034 10:111658064-111658086 GTGACACATGGCCCAGTCCAAGG + Intergenic
1075510956 10:123072825-123072847 GTGCTCCGGGGCCTCCTCCAGGG - Intergenic
1076078827 10:127559432-127559454 ACTCCACAGTGCCCCCTCCATGG - Intergenic
1076253248 10:128999535-128999557 GTGGCTCAGGGACCCGTCCATGG - Intergenic
1076851636 10:133096161-133096183 GTGCCCCGAGGCCCCCTCCTGGG + Intronic
1077235705 11:1481126-1481148 TTGCCACACGGGCCCCTGCACGG + Intronic
1077299710 11:1841299-1841321 GTGGTACAGGGCCCCCGGCAGGG - Intronic
1077918510 11:6626169-6626191 CTGCAGCAGGGGCCCCTCCAAGG + Exonic
1079153552 11:17923358-17923380 GTGCCAGAGGGCCCAATCCTGGG + Intronic
1079222685 11:18577527-18577549 GGCCCAAAGGCCCCCCTCCAAGG - Intronic
1080411398 11:32028651-32028673 GTCCCACACTGCCCTCTCCATGG + Intronic
1081695398 11:45105867-45105889 GGGCCACAGAGGCCTCTCCAGGG + Intronic
1081758552 11:45561181-45561203 GTGCCACCGGCTCCCCGCCACGG + Intergenic
1081808930 11:45904591-45904613 CTGCCCCAGGGACCCATCCAAGG - Intronic
1084149208 11:67280368-67280390 GTGACACAGAGCTCACTCCATGG - Intronic
1084274440 11:68044316-68044338 GTCCCGCAGGGCCTCCTGCAGGG - Exonic
1087013935 11:93538375-93538397 GTGGCACAGGGGACCCACCAGGG - Intronic
1088046331 11:105456998-105457020 GCACCACATGGCCACCTCCAGGG - Intergenic
1089100064 11:115955366-115955388 GTGCCACGGGGCACCCTAGATGG + Intergenic
1089698724 11:120231394-120231416 CTCCCACAGGGCCACATCCAAGG + Intergenic
1090334710 11:125954682-125954704 GTGCCTCAGTCTCCCCTCCAGGG + Intergenic
1090677039 11:129008071-129008093 GTGCCACAGGGCCACTACCAGGG + Intronic
1091196317 11:133733826-133733848 GTGTCACAGGGACCCCTCAGAGG - Intergenic
1094848519 12:34372040-34372062 GTGGCAGAGGTCCCCCGCCACGG - Intergenic
1096509492 12:52119846-52119868 GTGCTACAGGGAGCCCTCAAGGG - Intergenic
1100047460 12:90399931-90399953 GTGCCATATGCCCCTCTCCAGGG - Intergenic
1100702716 12:97164986-97165008 GTGCCACAGGGCTCAATCCTTGG - Intergenic
1101781550 12:107843330-107843352 GATCCCCAGCGCCCCCTCCAAGG + Intergenic
1101789224 12:107912498-107912520 GCTCCACAGCGCCCCCTGCAGGG - Intergenic
1102454335 12:113062596-113062618 GTGCCACAGGACACCCAGCATGG + Intronic
1102699489 12:114826537-114826559 GTGCCACAGTTCCTCCTCTAGGG - Intergenic
1103461248 12:121106849-121106871 GTGCCACATGGCCACTGCCAGGG - Intergenic
1103894414 12:124263668-124263690 TTGCCTCAGGGGCCCCTCCCTGG + Intronic
1104718484 12:131031675-131031697 GACCCCCAGGGCCACCTCCATGG + Intronic
1104857117 12:131907568-131907590 GTCCCACAGGGCCCGCACCCAGG + Intronic
1104905535 12:132211706-132211728 CTGCCCCAGGGTCCCCTCGACGG - Intronic
1104981457 12:132574770-132574792 GTGCCGCAAGGCCCTCTCCTCGG + Intronic
1105947799 13:25204317-25204339 GTGCCACTTGGTCCTCTCCATGG + Intergenic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1106809421 13:33345421-33345443 GTACCACATGGCCTCCTCCCTGG - Intronic
1107066442 13:36218500-36218522 GTGACACAGTCCCTCCTCCATGG - Intronic
1113533593 13:111046707-111046729 GTGCAACAGGGGCACCTCCTGGG + Intergenic
1115660878 14:35493558-35493580 GTGCCACATGGCTGCTTCCAAGG - Intergenic
1117461026 14:55944973-55944995 TTGCCACAAGACCCCCTCGATGG + Intergenic
1117545885 14:56794674-56794696 GGGCCGCCGGGTCCCCTCCAGGG - Intergenic
1119786821 14:77320614-77320636 GGGCCACAGCGGCCCCTCCGGGG + Exonic
1119911883 14:78356973-78356995 GTGCCTCTGGGCCCTCACCAAGG + Intronic
1120311307 14:82831684-82831706 CTGCCACATGGACCTCTCCATGG + Intergenic
1120858700 14:89235211-89235233 GTTCCAAAGGGCCCTCTCCATGG - Intronic
1121234636 14:92383313-92383335 CTGCCTCCCGGCCCCCTCCAGGG - Intronic
1121778382 14:96606054-96606076 GGGACACAGAGCCCCCTCCATGG - Intergenic
1121839465 14:97120671-97120693 GACCCACAGGGCCCCCTTCCTGG + Intergenic
1121881668 14:97506456-97506478 CTGCCAAAAGGCCCCCTTCATGG - Intergenic
1122565023 14:102647719-102647741 TTGCCACTGGGCCCCAGCCAGGG - Intronic
1122862350 14:104588333-104588355 GTGCCCCACTGCCCCCTCCGTGG + Intronic
1123944325 15:25231694-25231716 GAGCCATAGGGTCACCTCCAGGG + Intergenic
1123947231 15:25244687-25244709 GAGCCACGGGGTCACCTCCAGGG + Intergenic
1123948052 15:25248420-25248442 GAGCCACGGGGTCACCTCCAGGG + Intergenic
1124372102 15:29109872-29109894 GGGCCACGGGGCCTCCTCCTTGG - Intronic
1124413576 15:29456592-29456614 GTGGGACAGTGCCCCCTCCCAGG + Intronic
1125599207 15:40906472-40906494 GGCCCCCAGGGCCCTCTCCAGGG - Intergenic
1128269805 15:66299124-66299146 GTGCCACAGGCCCCTCCCCATGG - Intronic
1128739278 15:70072546-70072568 ATGACACAGGCCACCCTCCAGGG + Intronic
1129252127 15:74314872-74314894 GTGCCAACGAGCCCCCTCCTAGG + Intronic
1130975295 15:88769223-88769245 GTTCCCAAGGGCCCCCTCCTGGG + Intergenic
1131383730 15:91985760-91985782 GGGCCACAGGACCACTTCCAGGG + Intronic
1132338857 15:101065621-101065643 GCCCTACATGGCCCCCTCCATGG + Exonic
1132523047 16:400242-400264 CTCCCGCTGGGCCCCCTCCACGG - Exonic
1132972118 16:2694216-2694238 GGGCCACAGGGCCAGCTCCCGGG - Intronic
1133116929 16:3582788-3582810 GTGCCACAGGCCAGGCTCCATGG - Intronic
1134338091 16:13319748-13319770 GTCCCACAGGGGCCTTTCCAGGG + Intergenic
1135030272 16:19032597-19032619 ATTCTTCAGGGCCCCCTCCAAGG - Intronic
1136064459 16:27749470-27749492 GTGAGGCAGGGCCACCTCCAGGG - Intronic
1136656902 16:31714730-31714752 GTAACAAAGGGCTCCCTCCATGG - Intronic
1137869281 16:51933942-51933964 GTGCCACTGGGCTCCCACCTCGG + Intergenic
1138387132 16:56643462-56643484 GAGCCAAAGGGCCGCCCCCAGGG + Intronic
1138457387 16:57129209-57129231 GGGCCACGGGGACCCCTGCAGGG + Intronic
1141202544 16:81908927-81908949 GAGCCACATGACCCACTCCAGGG - Intronic
1141961504 16:87412217-87412239 ATGCCAGTGGGCCCCCTGCAGGG - Exonic
1142620895 17:1165251-1165273 GGGTCACAGGCTCCCCTCCAGGG - Intronic
1143765873 17:9137467-9137489 GAGACACATGCCCCCCTCCACGG - Intronic
1143894797 17:10127689-10127711 GGGGCAGAAGGCCCCCTCCAAGG + Intronic
1144005339 17:11094537-11094559 GTGCCAAAAGGGCCCCTCCGTGG + Intergenic
1144578295 17:16443641-16443663 GTGCCACAGGGCCCCCTCCAGGG + Exonic
1144794839 17:17884029-17884051 GTGCCAAGCTGCCCCCTCCACGG + Intronic
1146256595 17:31394775-31394797 GTGCCTCGGGGCCCTGTCCATGG - Intronic
1146931699 17:36782528-36782550 GTGGCACAGCGGCACCTCCATGG - Intergenic
1147488147 17:40838583-40838605 TTGCTACAGGGCCCTTTCCAAGG + Intergenic
1148075692 17:44934147-44934169 AGGCCACAGGGCCCCATCCTGGG - Intronic
1149649553 17:58268360-58268382 GTGCCACAGGGGACCCTCGGAGG - Exonic
1150648559 17:66995124-66995146 GGGCGCCAGGGCCACCTCCACGG - Intronic
1151178510 17:72308941-72308963 CTGCCACTGGGAACCCTCCATGG + Intergenic
1152067724 17:78120885-78120907 GCACCCCAGGGCCCCCACCAGGG + Intronic
1152092468 17:78254553-78254575 GTGCCACGGGGCTCGCTCCCTGG - Intergenic
1152243154 17:79170562-79170584 GTTCTACAGGGACCCCTCCGTGG + Intronic
1152812222 17:82387339-82387361 GAGCCACGGGGCCCCTTCCTGGG + Intergenic
1154274125 18:12945220-12945242 GTGCCACAGGACTCCATCCTGGG - Intergenic
1155047216 18:22113567-22113589 CTGGCGCAGGGCCACCTCCAGGG - Intergenic
1160192477 18:76725335-76725357 ATTCCACGGGGCACCCTCCAGGG - Intergenic
1160393928 18:78558494-78558516 GAGCCACAGGGGACCCTCAAAGG - Intergenic
1160754774 19:751501-751523 AGGCCAGAGGGGCCCCTCCATGG + Intronic
1160790489 19:920652-920674 GTCCCACCCGGCCCCCGCCAGGG + Exonic
1160918110 19:1507219-1507241 GTGCCACTGGGCCTCCAACAGGG - Intronic
1160938353 19:1608561-1608583 GTGCCAAAGGGCTCTCTCCTGGG + Intergenic
1160987994 19:1848397-1848419 GGGCCCCAGGGCCCCCTCACTGG + Exonic
1161450842 19:4344411-4344433 GGGCCTCAGTGTCCCCTCCACGG - Intronic
1161988330 19:7669852-7669874 GTGCCAGAGCGTCACCTCCAGGG + Exonic
1162345266 19:10114909-10114931 TGGCCACAGGGCTCCCTGCAGGG + Exonic
1164631119 19:29762122-29762144 CTGCCACAGAGCCTCCCCCAGGG + Intergenic
1164731420 19:30508065-30508087 GTGCCACAGGCCCTGTTCCATGG - Intronic
1166239251 19:41478620-41478642 AACGCACAGGGCCCCCTCCAAGG + Intergenic
1166745302 19:45139315-45139337 TTGCCCCAAGGCCCCCTCCTCGG + Intronic
1167074443 19:47240108-47240130 GTGGCACAAGGCCAACTCCAGGG - Intergenic
1168686203 19:58350994-58351016 GGACCACAGGGGCCCCTCCGTGG - Intronic
925015420 2:520808-520830 GATCCACAGGGGCCCCTCCGGGG - Intergenic
926087213 2:10028054-10028076 CTGCCACATGGCCCTCTCCGTGG - Intergenic
927208315 2:20623906-20623928 CAGCCACAGGGACGCCTCCAAGG - Exonic
927241235 2:20921023-20921045 GTGCCAGAAGGCTCCCTCGATGG - Intergenic
927750447 2:25664871-25664893 GTGTCACATCGCCCCCTCCAGGG + Intronic
933686885 2:85148473-85148495 ATGCCCCAGGGCCCCCCTCAGGG + Intronic
934918259 2:98318923-98318945 GTTCCACAGGGCCAACTGCAGGG - Intergenic
935204267 2:100883942-100883964 ATGCTTCAGGGCCCTCTCCAGGG - Intronic
935319596 2:101872761-101872783 GTACCATTGGACCCCCTCCATGG - Intronic
935540098 2:104338531-104338553 GGTCCACAGAGACCCCTCCATGG + Intergenic
937999400 2:127720034-127720056 GGGCCCCAGGGCCCGCCCCAGGG - Exonic
941154494 2:161959528-161959550 TTGCCACAGTGGCCTCTCCATGG + Intronic
946261053 2:218491285-218491307 TTGCCACATGGCCCCCTCATAGG - Intronic
948321394 2:237072514-237072536 GTGCCACAGCGCCCCCTGGTGGG + Intergenic
948348972 2:237322779-237322801 GTGCCACAGGTGCACCTCCCAGG + Intergenic
948603508 2:239120658-239120680 GCCCCACAGGGTCCCCTCTAAGG - Intronic
948827196 2:240578448-240578470 GGGCCAGAGGGCCCTCCCCAGGG - Exonic
948888517 2:240895941-240895963 GTGCCACAGGGGCACCTGCACGG + Exonic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1171414093 20:24965738-24965760 CTGTCACATGGCCCCATCCAGGG - Intronic
1171481739 20:25460010-25460032 GACTCACAGGGCCCTCTCCACGG - Intronic
1174188445 20:48723238-48723260 GGGCCACGGGGACCCCTGCAAGG + Intronic
1175503961 20:59469107-59469129 GTCACCCAGGGCCCCCTCCAGGG - Intergenic
1175746191 20:61459098-61459120 GGGCCACTGGGGCCTCTCCAGGG - Intronic
1176011446 20:62898645-62898667 CAGCCACAGGACCCCCTCCTTGG + Intronic
1176041889 20:63070020-63070042 GTGCCTGGGGGCCCTCTCCAAGG + Intergenic
1176108137 20:63399128-63399150 GGACCCCACGGCCCCCTCCAGGG - Intergenic
1176145430 20:63563335-63563357 CTTCCACAGGGCCGTCTCCACGG + Exonic
1179563689 21:42233358-42233380 GTGCAAGAAGGCTCCCTCCACGG - Intronic
1179591563 21:42412516-42412538 GTTCCACAGGGACTCCTCTAAGG - Intronic
1179643916 21:42763937-42763959 ATGCCTCAGGGCCCCGTCCCAGG - Intronic
1179793321 21:43768131-43768153 CAGCCAGGGGGCCCCCTCCATGG - Intergenic
1179888436 21:44324399-44324421 GAGACACAGGGCTCCCTGCAGGG + Intronic
1179912411 21:44457099-44457121 CTCCCACAGGGCCTCCTGCAGGG - Exonic
1179960503 21:44764830-44764852 GTGACATGGGGCCACCTCCAGGG - Intergenic
1180017596 21:45097501-45097523 CTGCCACAGGGACCCTTCCACGG - Intronic
1180843348 22:18969428-18969450 CTCCCTCAGGGCCACCTCCATGG + Intergenic
1181058125 22:20269307-20269329 CTCCCTCAGGGCCACCTCCATGG - Intronic
1181409056 22:22705260-22705282 ATGCCACAGTGTCCCCTCCTTGG - Intergenic
1181438581 22:22924181-22924203 ATGCCACAAGGGCCCCTCCCAGG - Intergenic
1181514667 22:23403756-23403778 GTCCCTCAGGGCCACCTCCATGG - Intergenic
1181645819 22:24231454-24231476 GTCCCCCAGGGGCACCTCCAGGG + Exonic
1183582623 22:38734991-38735013 GTGCCCCAGGCCCCTCTCCACGG + Exonic
1184247722 22:43244203-43244225 GTTCCACAGGGCACCCCCCTTGG + Intronic
1184340237 22:43881841-43881863 GAGCCACAGGGACACCTGCAGGG + Intronic
1184498426 22:44857398-44857420 AAGCAACAGGGCCCCCACCAAGG - Intronic
1184650292 22:45916515-45916537 ACGCCACAGGGACCTCTCCAGGG + Intergenic
1185176208 22:49328385-49328407 GGGTCACAGGGCCCCCAGCACGG + Intergenic
1185207549 22:49548801-49548823 GAGGCACAGCGCCCCCTTCAAGG + Intronic
1185257813 22:49845890-49845912 GTGCCACATGGCTTCCTGCAGGG + Intergenic
950072197 3:10161649-10161671 GTGCCACAGGGCCTCTTCCCTGG - Intergenic
950263158 3:11556321-11556343 CTGCCCCAGGCCCCCCTCCAGGG + Exonic
950475912 3:13214660-13214682 GTGCCACAGTGGCCCCTTGATGG - Intergenic
953541353 3:43821336-43821358 GTTCCTCAGGTCCCCCTGCAAGG + Intergenic
954105544 3:48407881-48407903 GACCCGCAGGGCCACCTCCAGGG - Intronic
954432655 3:50479527-50479549 GTGTCCCAGTGCCACCTCCAAGG + Intronic
954452304 3:50578341-50578363 GAGCCTCAGTGCCCCCTCCATGG + Intronic
954452579 3:50579745-50579767 GTTCCACAGGGCCCCATTCATGG + Intronic
954622140 3:52002379-52002401 CTGTCACAAGGCCCCCTCCATGG - Intergenic
954807103 3:53226933-53226955 GTCCCACCAGGCCCCCACCAGGG - Intronic
956295955 3:67713839-67713861 TTGCCACATGGACCTCTCCATGG - Intergenic
963864216 3:150342893-150342915 TTGCCACATGGGCCTCTCCATGG + Intergenic
964883248 3:161447564-161447586 TTACCACAGAACCCCCTCCAGGG - Intergenic
965656371 3:170989393-170989415 GTGCCACAGAGCCCACTCAGGGG - Intergenic
967912249 3:194552050-194552072 GTGCCACAGCACTCCATCCAGGG + Intergenic
968545010 4:1194012-1194034 GGGCCACAGGGCACCCCCCTGGG - Intronic
968652845 4:1766981-1767003 GAGCCGGAGGGTCCCCTCCACGG - Intergenic
968742975 4:2340670-2340692 CTGCCCCAGGACCCACTCCACGG + Intronic
969364252 4:6684870-6684892 ATGCCACAGCACCTCCTCCAGGG + Intergenic
969488447 4:7485466-7485488 GAGCCCCAGGGCCCCCTGCCGGG + Intronic
969601865 4:8181619-8181641 GTGCCATAGGGCCCAGTGCAAGG - Intergenic
970110889 4:12636879-12636901 GTGCCACATGACCCCATCCCTGG - Intergenic
972557811 4:40198170-40198192 TTGCCCCCAGGCCCCCTCCATGG - Intronic
975881321 4:78911283-78911305 GTGCCTCAGGCCCCACTGCATGG - Exonic
975900170 4:79141718-79141740 GTTCCACAGGTCACTCTCCATGG + Intergenic
980207264 4:129736046-129736068 TTGCCACTTGGCCCTCTCCATGG + Intergenic
980442418 4:132866677-132866699 GTGCCACATGGCCCCTGCCAGGG - Intergenic
980968549 4:139547160-139547182 CTGCCAAAGGGTCCCCTCCCTGG + Intronic
983878619 4:172906731-172906753 TTGCCATGTGGCCCCCTCCAGGG + Intronic
988518254 5:31923348-31923370 GTGCCACACGGCCATCGCCATGG + Intronic
990639210 5:57762606-57762628 TAGCCACAGGGCCACCTTCATGG + Intergenic
994040984 5:95259610-95259632 TACCCACAGGGCCCCCACCAGGG - Intronic
996038145 5:118781522-118781544 GTGCCTCTGGGACCCTTCCAGGG + Intergenic
996552110 5:124741930-124741952 TTGGCACAGGGGCCCCTCAAAGG - Intronic
998319591 5:141216302-141216324 GTGCCCGAGGGCCCCCTTCCAGG + Exonic
999389430 5:151179570-151179592 GTTCCACAGGGCACCCTCACTGG - Intergenic
1001402144 5:171451769-171451791 GTGCCCGAAGGCCCCGTCCATGG - Intronic
1002399182 5:178981701-178981723 GAGCCTCAAGGCCACCTCCACGG - Exonic
1003633599 6:7811025-7811047 GGCCCCCAGGGCCCCCACCATGG + Intronic
1006449921 6:34099846-34099868 TTGCCCCAGCGCCTCCTCCAGGG + Intronic
1006880533 6:37335226-37335248 GTGCCACAGGCCCACAACCATGG + Intergenic
1007701349 6:43768285-43768307 CTGGCTCAGGGCCCCCTCCCAGG - Intergenic
1009781504 6:68277479-68277501 TTGCCACATGGACCTCTCCATGG - Intergenic
1010115231 6:72298438-72298460 GAGACACAGATCCCCCTCCAGGG + Intronic
1012241410 6:96877340-96877362 GTGGCACCGTGCCCGCTCCAAGG + Intergenic
1016512161 6:144855572-144855594 GTGCTACAGTGCCCCTCCCAAGG + Intergenic
1017022580 6:150152344-150152366 GTGCTTCAGAGCCACCTCCATGG + Intronic
1017324885 6:153132383-153132405 ATGTCTCAGGGCCTCCTCCAGGG + Intergenic
1019352901 7:563271-563293 CCGCCCCAGGACCCCCTCCACGG + Intronic
1019468229 7:1202197-1202219 ATGCCACATGGCCACCTCCAGGG - Intergenic
1021439359 7:20660616-20660638 CTTACCCAGGGCCCCCTCCAAGG - Intronic
1023035396 7:36127170-36127192 TTTCCACACAGCCCCCTCCACGG + Intergenic
1023863413 7:44228075-44228097 GGGGCAGAGGGCACCCTCCAGGG + Intronic
1023995784 7:45158097-45158119 GAGGCACAGGGCCCCCTCCGGGG + Intronic
1024291454 7:47807481-47807503 GGGCCCCAGGGCCACCCCCAGGG - Intronic
1024573894 7:50748249-50748271 GGGCCACGGGGCCTCCTCCAGGG - Intronic
1024941448 7:54767491-54767513 GTGACCCAGGGCCCTATCCAGGG + Intergenic
1025235059 7:57228782-57228804 GTGCCCCAGGGCCTGCTCCCAGG + Intergenic
1025635093 7:63314723-63314745 ATCCCACAGAGCCCCCACCATGG - Intergenic
1025647602 7:63433447-63433469 ATCCCACAGAGCCCCCACCATGG + Intergenic
1029120892 7:98267503-98267525 CTGCCACATGACCCTCTCCAGGG + Intronic
1031353590 7:120763934-120763956 GTGCCACACGGCCACTGCCAGGG + Intergenic
1032086526 7:128886755-128886777 GTGGCACAGGCCCCCCACCCAGG - Intronic
1034540911 7:151757444-151757466 GAGACACAGTGCCCGCTCCAGGG + Intronic
1035201802 7:157272504-157272526 GTGCCACAGACCATCCTCCATGG - Intergenic
1035279277 7:157767057-157767079 TTGCCACAGCTCCCCCTGCAGGG + Intronic
1035811788 8:2497754-2497776 CTGCTACAGGGCTCACTCCACGG - Intergenic
1036433068 8:8707518-8707540 GTGCCACTGGGACCCCTCCTCGG + Intergenic
1037579861 8:20238743-20238765 GTGCCAATGGGCCAGCTCCAGGG - Intergenic
1038580759 8:28747334-28747356 CCTCCACAGGTCCCCCTCCAGGG - Intronic
1038643653 8:29347173-29347195 CTGCCCCAGAGCCCCCTCCCGGG + Intronic
1041689145 8:60672263-60672285 GATGCACAGAGCCCCCTCCAGGG + Intergenic
1045017309 8:98010672-98010694 GTGTCTCTGGGGCCCCTCCAAGG - Intronic
1046246524 8:111570253-111570275 TTGCCACATGTCCCTCTCCATGG + Intergenic
1046731042 8:117726733-117726755 GTGCCATAGAGCCCCCATCAAGG + Intergenic
1047756949 8:127926330-127926352 CTGCCCCAGGTCCCCCTCCCTGG + Intergenic
1049624984 8:143615889-143615911 GTGCCTCCAGGCCCCCTGCATGG + Intronic
1053427373 9:38019337-38019359 TTTCCACAGGGCCCACTGCAGGG + Intronic
1053593157 9:39533791-39533813 GGGGCCCATGGCCCCCTCCAGGG + Intergenic
1054573150 9:66831486-66831508 GGGGCCCATGGCCCCCTCCAGGG - Intergenic
1056331310 9:85523324-85523346 GTGCCAGATGGCTCCCTCCCAGG + Intergenic
1057180204 9:93025790-93025812 GTGACACACGAACCCCTCCAAGG + Intronic
1058773777 9:108264439-108264461 TGGCCTCAGAGCCCCCTCCATGG + Intergenic
1060508293 9:124214692-124214714 GTTCCACTGGGGCCCCGCCAAGG + Intergenic
1060517586 9:124275676-124275698 CTGCCCCAGGATCCCCTCCAGGG + Intronic
1061040360 9:128138152-128138174 GTGCAACATGGCCCCGCCCAAGG + Intergenic
1062622790 9:137430140-137430162 GGGACACAGGGACCCCCCCAGGG - Intronic
1203790786 EBV:150625-150647 ATGGCACAGGGCCATCTCCAGGG - Intergenic
1188045993 X:25426549-25426571 GCACCACAGGGACCCATCCAGGG - Intergenic
1188154688 X:26726374-26726396 CTGCCACATGGCCCCTTCGAAGG - Intergenic
1189250695 X:39598945-39598967 GTGCCCCAGAACCCCCTGCAGGG + Intergenic
1195706762 X:107742987-107743009 CGGCCACAGGGCCCTCTCCCTGG - Intronic
1196189192 X:112777278-112777300 TTGCCATAGGGCTGCCTCCAAGG - Exonic
1197487863 X:127075510-127075532 GTGCCACATGGCCACTGCCAGGG + Intergenic
1197777691 X:130130070-130130092 GTTCCACAGGCTCCCGTCCAGGG - Exonic
1199715318 X:150503755-150503777 GTGCCTCAGCCCCACCTCCAGGG + Intronic
1200234178 X:154460221-154460243 GTTGCCCAGGGCCCCCCCCACGG - Exonic
1201929651 Y:19328349-19328371 GTGCCAGAGGTCCCCCACAAGGG + Intergenic