ID: 1144578360

View in Genome Browser
Species Human (GRCh38)
Location 17:16443890-16443912
Sequence CAATGGCAACCGGTTGACCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 44}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144578360_1144578363 -10 Left 1144578360 17:16443890-16443912 CCCGGGTCAACCGGTTGCCATTG 0: 1
1: 0
2: 1
3: 0
4: 44
Right 1144578363 17:16443903-16443925 GTTGCCATTGAGTGCCAGTGTGG 0: 1
1: 0
2: 0
3: 5
4: 114
1144578360_1144578372 18 Left 1144578360 17:16443890-16443912 CCCGGGTCAACCGGTTGCCATTG 0: 1
1: 0
2: 1
3: 0
4: 44
Right 1144578372 17:16443931-16443953 CGGGGCAGGGTGCTGAGTGCTGG 0: 1
1: 0
2: 2
3: 68
4: 581
1144578360_1144578367 -1 Left 1144578360 17:16443890-16443912 CCCGGGTCAACCGGTTGCCATTG 0: 1
1: 0
2: 1
3: 0
4: 44
Right 1144578367 17:16443912-16443934 GAGTGCCAGTGTGGTGAGGCGGG 0: 1
1: 0
2: 3
3: 26
4: 305
1144578360_1144578366 -2 Left 1144578360 17:16443890-16443912 CCCGGGTCAACCGGTTGCCATTG 0: 1
1: 0
2: 1
3: 0
4: 44
Right 1144578366 17:16443911-16443933 TGAGTGCCAGTGTGGTGAGGCGG 0: 1
1: 1
2: 2
3: 29
4: 351
1144578360_1144578365 -5 Left 1144578360 17:16443890-16443912 CCCGGGTCAACCGGTTGCCATTG 0: 1
1: 0
2: 1
3: 0
4: 44
Right 1144578365 17:16443908-16443930 CATTGAGTGCCAGTGTGGTGAGG 0: 1
1: 0
2: 2
3: 11
4: 190
1144578360_1144578368 0 Left 1144578360 17:16443890-16443912 CCCGGGTCAACCGGTTGCCATTG 0: 1
1: 0
2: 1
3: 0
4: 44
Right 1144578368 17:16443913-16443935 AGTGCCAGTGTGGTGAGGCGGGG 0: 1
1: 0
2: 0
3: 21
4: 203
1144578360_1144578370 4 Left 1144578360 17:16443890-16443912 CCCGGGTCAACCGGTTGCCATTG 0: 1
1: 0
2: 1
3: 0
4: 44
Right 1144578370 17:16443917-16443939 CCAGTGTGGTGAGGCGGGGCAGG 0: 1
1: 1
2: 6
3: 27
4: 386
1144578360_1144578371 5 Left 1144578360 17:16443890-16443912 CCCGGGTCAACCGGTTGCCATTG 0: 1
1: 0
2: 1
3: 0
4: 44
Right 1144578371 17:16443918-16443940 CAGTGTGGTGAGGCGGGGCAGGG 0: 1
1: 0
2: 3
3: 47
4: 528

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144578360 Original CRISPR CAATGGCAACCGGTTGACCC GGG (reversed) Exonic
900799189 1:4727048-4727070 CAATGGCAACCTGCTGCCACAGG - Intronic
902619126 1:17640264-17640286 CAAATGTAACCTGTTGACCCAGG - Exonic
903547335 1:24134273-24134295 CGATGGCCACCGGCTAACCCTGG - Exonic
907648163 1:56264934-56264956 CAATGGCAACTGGGTGATTCAGG - Intergenic
916520901 1:165562852-165562874 TATTGGCAACCTGTTTACCCTGG + Intronic
1068054267 10:51991574-51991596 CAATGAGAACCGTTGGACCCAGG - Intronic
1072326064 10:94300069-94300091 CAATGGCACCAGGTGGACACAGG - Intronic
1083261768 11:61526973-61526995 CAATGGCCCCCGGTTCAACCAGG - Intronic
1086701591 11:89905662-89905684 TAATGGCATCCCCTTGACCCTGG + Intergenic
1086704577 11:89938863-89938885 TAATGGCATCCCCTTGACCCTGG - Intergenic
1099839739 12:87950548-87950570 CACTGGCAACTTGTTGACACTGG + Intergenic
1114903717 14:27099345-27099367 CAATGCCTACCCGTTGCCCCAGG + Intergenic
1132024158 15:98390766-98390788 CAATGGGAAGAGGTTGACCTGGG - Intergenic
1133255274 16:4512732-4512754 CAGAGGCAGCCAGTTGACCCTGG + Intronic
1144578360 17:16443890-16443912 CAATGGCAACCGGTTGACCCGGG - Exonic
1144829465 17:18123242-18123264 CAATGGCAACCGGGGCAGCCTGG + Intronic
1151994515 17:77600304-77600326 CATTGGCAGACGGTTGTCCCAGG - Intergenic
1154338817 18:13486885-13486907 AAATGGGAAACCGTTGACCCTGG - Intronic
1163545269 19:17937683-17937705 CATTTCCAACCTGTTGACCCAGG + Intronic
926893253 2:17657280-17657302 GAATGGCACCCGGTTAAACCAGG + Intergenic
927904439 2:26847197-26847219 CAATGGCAAAGGCTTGAACCGGG + Intergenic
934723398 2:96598034-96598056 CAATGGTAACTGGCTGGCCCAGG + Intronic
1173367998 20:42405386-42405408 CAATGAGAACAGGTGGACCCAGG - Intronic
1173868310 20:46327010-46327032 CACTGGGAACCGGTAGACCTGGG - Intergenic
1175045457 20:56100666-56100688 CTATGGCATCCTGCTGACCCAGG - Intergenic
1176012068 20:62903297-62903319 CCATGGCACTCGGTTGACCTGGG - Intronic
1181694513 22:24586167-24586189 CAACGGCAACCGACTGACGCGGG - Exonic
1184445593 22:44545118-44545140 CAATGGCACCCTGTCGAGCCAGG - Intergenic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
984347338 4:178546407-178546429 CAATGGCAAGCTGGAGACCCAGG + Intergenic
985918880 5:2950488-2950510 CAATAGCATCACGTTGACCCAGG - Intergenic
990509892 5:56480921-56480943 CAAAGGCAGCCAGCTGACCCCGG + Intronic
998288715 5:140891067-140891089 CAATGGAAACCAGTAGACACTGG - Intronic
1003171012 6:3722199-3722221 GAAAGGCAACCGGTCAACCCCGG + Intergenic
1012225703 6:96700997-96701019 CTATGGCAACAGCTTGACCGGGG - Intergenic
1015015912 6:128412754-128412776 TAATGGCTTCCGGTTGGCCCAGG + Intronic
1019946089 7:4330571-4330593 CAATGGCCACCTGATGTCCCAGG + Intergenic
1022607367 7:31828718-31828740 CAATGGCCACAGGTTGACCCAGG - Intronic
1026513646 7:71048456-71048478 GAATGCCAGCCGGTGGACCCAGG - Intergenic
1038343905 8:26714490-26714512 CTATGGCAATCGCTTGAACCTGG + Intergenic
1041364988 8:57092510-57092532 CAGTGGCCACCTGCTGACCCTGG - Intergenic
1049536481 8:143184757-143184779 CATTGGCAACCAGCTGAACCAGG + Intergenic
1060030677 9:120212401-120212423 CTTTGGCCACTGGTTGACCCAGG - Intergenic
1062475152 9:136723030-136723052 CAAGGACAACCGGGTGTCCCTGG + Exonic
1188920903 X:35975856-35975878 CAATGGCAACCCGTAAACACAGG + Exonic
1195869241 X:109469018-109469040 CAGTGACCACCTGTTGACCCAGG - Intronic