ID: 1144579464

View in Genome Browser
Species Human (GRCh38)
Location 17:16450245-16450267
Sequence GCTGATGGGAAGGCAAGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 572
Summary {0: 1, 1: 0, 2: 3, 3: 56, 4: 512}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144579446_1144579464 29 Left 1144579446 17:16450193-16450215 CCATTATGCAGTGGGGGAGCCTG 0: 1
1: 0
2: 0
3: 12
4: 175
Right 1144579464 17:16450245-16450267 GCTGATGGGAAGGCAAGAGAAGG 0: 1
1: 0
2: 3
3: 56
4: 512
1144579453_1144579464 10 Left 1144579453 17:16450212-16450234 CCTGAGGCCCAGAGGGCTGGGGA 0: 1
1: 0
2: 5
3: 72
4: 590
Right 1144579464 17:16450245-16450267 GCTGATGGGAAGGCAAGAGAAGG 0: 1
1: 0
2: 3
3: 56
4: 512
1144579456_1144579464 3 Left 1144579456 17:16450219-16450241 CCCAGAGGGCTGGGGATGGGCTT 0: 1
1: 0
2: 8
3: 41
4: 373
Right 1144579464 17:16450245-16450267 GCTGATGGGAAGGCAAGAGAAGG 0: 1
1: 0
2: 3
3: 56
4: 512
1144579445_1144579464 30 Left 1144579445 17:16450192-16450214 CCCATTATGCAGTGGGGGAGCCT 0: 1
1: 0
2: 0
3: 9
4: 103
Right 1144579464 17:16450245-16450267 GCTGATGGGAAGGCAAGAGAAGG 0: 1
1: 0
2: 3
3: 56
4: 512
1144579457_1144579464 2 Left 1144579457 17:16450220-16450242 CCAGAGGGCTGGGGATGGGCTTG 0: 1
1: 0
2: 4
3: 48
4: 475
Right 1144579464 17:16450245-16450267 GCTGATGGGAAGGCAAGAGAAGG 0: 1
1: 0
2: 3
3: 56
4: 512

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144579464 Original CRISPR GCTGATGGGAAGGCAAGAGA AGG Intronic
900300232 1:1973426-1973448 GCTGAAGGGAAGGAATGAGATGG + Intronic
900313982 1:2048101-2048123 CCTGATGGGCAGGAAAGAGCAGG - Intergenic
900682581 1:3925001-3925023 GCTGATGGGCCGGGAAGGGAGGG - Intergenic
900742659 1:4340127-4340149 GGTGAGGGGAAGGGAAGGGATGG + Intergenic
901417420 1:9127491-9127513 GCTGCCGGGAAGGCAAGGCAAGG + Intronic
901530973 1:9852246-9852268 GCTGTCGGGAGGGCCAGAGATGG + Intronic
901966061 1:12867448-12867470 GGTGAAGGGAAGGGAAGGGAAGG - Intronic
901981455 1:13037828-13037850 GGTGAAGGGAAGGGAAGGGAAGG - Intronic
902000630 1:13191097-13191119 GGTGAAGGGAAGGGAAGGGAAGG + Intergenic
902019861 1:13336793-13336815 GGTGAAGGGAAGGGAAGGGAAGG + Intergenic
902521752 1:17021980-17022002 TCTGATGTGCAGGCATGAGAAGG + Intronic
902663844 1:17923803-17923825 GATGTTGGGTAGGGAAGAGAGGG + Intergenic
902905958 1:19557718-19557740 AGTGAAGGGAAGGGAAGAGAAGG - Intergenic
903050200 1:20594917-20594939 GGTGATGGGCAGGGAAGAGAAGG + Intronic
903203080 1:21759279-21759301 ACTGAAGGGAAGGCAGGAGTGGG + Intronic
903265559 1:22156017-22156039 TCTGAACGGAATGCAAGAGACGG - Intergenic
903344421 1:22675348-22675370 GGAGATGGGCAGGCAGGAGAAGG - Intergenic
903495071 1:23760440-23760462 GTTGAGGGGAAGGAAAGATAGGG - Exonic
903551852 1:24162640-24162662 GCAGGTGGAAGGGCAAGAGAGGG + Intronic
904003005 1:27349346-27349368 GCTTAGGGGAGGGCAGGAGAGGG + Intronic
904048729 1:27625275-27625297 GGTGATAGGAAGGAAAGTGAAGG - Intronic
904479853 1:30786904-30786926 GCTGCTGGGAAGTCAGGGGAGGG + Intergenic
904501920 1:30917794-30917816 GATGCTGGGAAGGCTAGTGAGGG - Intergenic
904592665 1:31623707-31623729 GCTGATGGGCAGGTAGCAGAGGG - Exonic
904938354 1:34147707-34147729 GCTAATGGGAGGGAAACAGAGGG + Intronic
905027811 1:34863232-34863254 GCAGGTGAGAGGGCAAGAGAGGG - Intergenic
905488798 1:38327542-38327564 GCTGACTGGCATGCAAGAGATGG - Intergenic
905821523 1:40996039-40996061 GCTGATGAAATGGAAAGAGATGG + Exonic
907641366 1:56193709-56193731 GCTGATGGCAAGGAAAGGGGTGG + Intergenic
907756640 1:57317048-57317070 GCTAATGAGAGGGCAAGAGATGG - Intronic
908526990 1:64997797-64997819 GCTTATGTGAAGGATAGAGAAGG + Intergenic
909588088 1:77313590-77313612 GGTGATGGAAAGGAGAGAGAGGG - Intronic
912555947 1:110516098-110516120 GCTGCTGGGAAGGGAAGAGCAGG - Intergenic
912582705 1:110734815-110734837 TCTTGTGGGAAGGAAAGAGAAGG + Intergenic
913452164 1:118999814-118999836 GGAGATGGGGAGGAAAGAGAGGG + Intergenic
915874414 1:159597267-159597289 GGGGATGGGAGGGCAGGAGAAGG + Intergenic
916433596 1:164756029-164756051 GCAGAGGGGAAAGCAAGGGAAGG - Intronic
917852308 1:179075792-179075814 GCGGATGGGAAGGGAAGGGAAGG - Exonic
918051974 1:180981552-180981574 GCTGATGGAAAGCCAAAAAATGG - Intronic
918510602 1:185309789-185309811 TCTGAAGGGAAGGGAAGGGAAGG + Intronic
918926011 1:190787194-190787216 ATTCATGGAAAGGCAAGAGAAGG - Intergenic
919262218 1:195210195-195210217 GCTGATGGGAATGCAAAAATGGG - Intergenic
919329309 1:196149042-196149064 CCAGATGGTGAGGCAAGAGAAGG - Intergenic
920128120 1:203710018-203710040 GGGAATGGGAAGGAAAGAGAAGG - Intronic
920504175 1:206505120-206505142 GCTGCAGGGAAGGACAGAGATGG + Intergenic
920516660 1:206589539-206589561 GCTGATGTGTGGGAAAGAGAAGG + Intronic
923041440 1:230322784-230322806 GCTGGTGGGCAGGGGAGAGAGGG - Intronic
923625151 1:235607675-235607697 GCCGATGGGATGGCATGAAAGGG - Intronic
924836448 1:247652812-247652834 GCAGATGGGAAGTCAATATAGGG + Intergenic
1063438558 10:6054019-6054041 GGTGGAGGGAAGGCAAGATACGG - Intronic
1063634841 10:7772043-7772065 GCAGATGTAAAGGCAAGAAAGGG + Intronic
1063871028 10:10417899-10417921 GCTGATGGGAAGTTATGCGATGG - Intergenic
1063919577 10:10918967-10918989 TCTGATTGAAAGACAAGAGATGG + Intergenic
1064329353 10:14379302-14379324 GCTTGTGGGAAGGGAGGAGATGG - Intronic
1065169103 10:23010162-23010184 GCTGGAGAGAAGGGAAGAGAAGG - Intronic
1065864954 10:29906470-29906492 ACAGATGGGAGGGCAAGAGAAGG + Intergenic
1065935848 10:30519856-30519878 GATGAAAGGAAGGCAAGAGTAGG + Intergenic
1066311050 10:34197035-34197057 GCAGATGGGAAGGCACAGGATGG - Intronic
1066406532 10:35124547-35124569 GGTGAGGGGATGGCAAGGGATGG + Intergenic
1066537373 10:36406641-36406663 GCCAGTGGGAAAGCAAGAGAGGG - Intergenic
1067432425 10:46253000-46253022 GGGGAAGGGAAGGCAGGAGAGGG + Intergenic
1068063846 10:52103398-52103420 GCTGAGGGGGAGGAAGGAGAGGG - Intronic
1069350077 10:67514736-67514758 GCTGATAGGAATTCCAGAGATGG - Intronic
1069632514 10:69905638-69905660 GCTCCTGGGAAGGCTGGAGATGG + Intronic
1070266090 10:74904589-74904611 GCTGAGGGGAAAGCAAGTGTGGG - Intronic
1070827174 10:79398071-79398093 GCTGCTTGGCAGGCAAGGGATGG + Intronic
1070836749 10:79452255-79452277 GCTGGTGGGAATGGAGGAGAAGG - Intergenic
1071275234 10:84048296-84048318 ACTGAAGGGGAGGCAAGAGTGGG - Intergenic
1072188811 10:93064564-93064586 CCTGCTGGGAATGCAAAAGAGGG - Intronic
1072645467 10:97251125-97251147 GGGGAAGGGAAGGGAAGAGAAGG + Intronic
1073254241 10:102140885-102140907 GCTGGTGGGATGACAAGACAAGG - Exonic
1073313579 10:102562162-102562184 ACTTTTGGGAAGGCAAGAGGAGG - Intronic
1073403914 10:103280261-103280283 GCTGATGGGAGTGGAAGAGGAGG + Intronic
1073490514 10:103850224-103850246 GCAGAGGGGAAGGGAAGAGAAGG - Intronic
1073598989 10:104828360-104828382 GCTGAGGAGAAGGAGAGAGATGG + Intronic
1073930019 10:108565468-108565490 GTTGAAGGGAAGGGAAGGGAAGG + Intergenic
1074204698 10:111272407-111272429 GAGGAAGGGAAGGAAAGAGAAGG + Intergenic
1075654066 10:124149795-124149817 GCTGAAGGGCTGGCAAGAGGAGG + Intergenic
1075661573 10:124200554-124200576 AATGATGGGGAGGAAAGAGAAGG + Intergenic
1076034256 10:127185796-127185818 GCTGATGGGAGAGAAGGAGATGG + Intronic
1077099207 11:814016-814038 TCAGATGGGAAGGCAAGACCTGG + Intergenic
1077662283 11:4080344-4080366 TCTGATGGGAAGACAAGAGATGG - Intronic
1077792920 11:5461131-5461153 ACTGATGGGGTGGCAAGTGAGGG + Intronic
1078127389 11:8581119-8581141 GTTGATGGGAAGGAAGGAAAAGG - Intronic
1078314792 11:10285317-10285339 AGAGAAGGGAAGGCAAGAGAAGG + Intronic
1078707821 11:13762101-13762123 GGAGATTGGAAGGAAAGAGAAGG + Intergenic
1079428632 11:20366839-20366861 TATGATGTGAGGGCAAGAGATGG - Intronic
1079597519 11:22269161-22269183 AGGGATGGGAAGGGAAGAGAAGG + Intronic
1080171753 11:29312134-29312156 GATGAAGTGAAGGCAAGACAAGG + Intergenic
1080494288 11:32800948-32800970 GATAATAGGAAGTCAAGAGATGG + Intergenic
1080742018 11:35074751-35074773 ACGGATGGGAAGACATGAGAGGG + Intergenic
1081073361 11:38638055-38638077 GGGGAGGGGAAGGCAGGAGAGGG - Intergenic
1081693159 11:45092073-45092095 GCAGGAGGGCAGGCAAGAGACGG - Intergenic
1082631673 11:55549646-55549668 ACTGATGGGAAGGAAATAGTAGG + Intergenic
1082988501 11:59187576-59187598 GGTGCTGGGAAAGCAAGAGGAGG - Intronic
1083039874 11:59675718-59675740 GGTAAAAGGAAGGCAAGAGAAGG - Intergenic
1083224550 11:61276680-61276702 CCTGAGGAGGAGGCAAGAGAGGG + Exonic
1084534421 11:69748283-69748305 GCTGCAGGGAAGGCCAGGGAGGG - Intergenic
1084544500 11:69807912-69807934 GATGAGGGGAAGGGGAGAGAAGG - Intergenic
1084597594 11:70126240-70126262 GCAGCTGGGATGGCAGGAGAGGG - Intronic
1085126608 11:74006408-74006430 TCAGATGGGAAGGCAAGAAGGGG + Intronic
1086013680 11:82137793-82137815 GCTGCTAGGGAGGCAAAAGATGG + Intergenic
1086336172 11:85802616-85802638 GAGGAAGGGAAGGAAAGAGAAGG + Intronic
1086518692 11:87645915-87645937 GGGGAAGGGAAAGCAAGAGAAGG - Intergenic
1086946090 11:92845284-92845306 GCTGATGAGAAGCGAAGAAATGG + Intronic
1087261790 11:96020346-96020368 GCTAATAGGAAGGCAAGTGTGGG - Intronic
1087657806 11:100946598-100946620 GCTAAGGGGAGGGAAAGAGATGG + Intronic
1088394642 11:109352955-109352977 GCAGATGTGATGGCGAGAGAGGG + Intergenic
1089635726 11:119810456-119810478 GCTGATGGGAAGAAAAGGAAGGG + Intergenic
1089880827 11:121771884-121771906 GCAGAAGGGAAGGCAAGTGGTGG - Intergenic
1089936742 11:122372036-122372058 CCTGAAGGGAAGGTAATAGATGG - Intergenic
1089971460 11:122696837-122696859 GCTGATGTGAAAACAAGATAAGG - Intronic
1090102535 11:123815299-123815321 GCTGCTGGGCTGGCAGGAGATGG - Intergenic
1090602725 11:128389690-128389712 GGGGATGGGAAGAGAAGAGAAGG + Intergenic
1090832068 11:130427099-130427121 GCAGATGGGATGGAGAGAGATGG - Intronic
1090965745 11:131596549-131596571 GCAGAAAGGAAGGCTAGAGAGGG - Intronic
1091184911 11:133638387-133638409 GCTGGTGGGGAGGGAAGGGAAGG - Intergenic
1091391437 12:128680-128702 GCACTGGGGAAGGCAAGAGAGGG - Intronic
1091522551 12:1261612-1261634 GCTCATGGCAAGTCAACAGAGGG + Intronic
1092086703 12:5768644-5768666 GGTGATGAGAAGGCAAGAGCTGG - Intronic
1093715197 12:22374090-22374112 GCTGATGGAGAGGGAGGAGAGGG - Intronic
1093864236 12:24205683-24205705 GCTAGTAGGAAGGCAAGAAAAGG + Intergenic
1094345312 12:29461592-29461614 GCTGGTGAGAAGGCAGGAAATGG - Intronic
1095282948 12:40377817-40377839 TCTGATTGGAATGCCAGAGAAGG + Intergenic
1095726185 12:45455492-45455514 GCTGAACAGAAGGAAAGAGATGG - Intergenic
1095904175 12:47360528-47360550 GCTGAGAGTAAGGAAAGAGAAGG + Intergenic
1096660129 12:53119022-53119044 GGTGATGCCAAGGGAAGAGAAGG + Intronic
1097167792 12:57094829-57094851 GCAGGTGGGGAGGCAGGAGAAGG - Exonic
1099054379 12:77820400-77820422 GAAGGTGGAAAGGCAAGAGAGGG + Intergenic
1099685540 12:85883497-85883519 ACTAATGGGATGGTAAGAGATGG - Intergenic
1100158045 12:91824701-91824723 GTTTAAGGGGAGGCAAGAGAGGG + Intergenic
1100599481 12:96100620-96100642 TCAGATAGGAAGGGAAGAGATGG - Intergenic
1100650207 12:96578697-96578719 GCTGATGAGAAGGTAACAGATGG - Intronic
1101322681 12:103686880-103686902 GCTGGTGGGAAGGCCAGAGTTGG - Intronic
1101341896 12:103849509-103849531 GCTGTTGGCATTGCAAGAGAGGG - Intergenic
1101498644 12:105280271-105280293 GGTGATTGGAAGGCTAGAGTTGG - Intronic
1102833105 12:116025720-116025742 GGGGAGGGGAAGGGAAGAGATGG + Intronic
1103021975 12:117541311-117541333 GCTGATGTGGAGGCATGGGAGGG + Intronic
1104054987 12:125222743-125222765 GCTGATGGAAGGGCCAGGGATGG - Intronic
1104178790 12:126357888-126357910 GGGGAGGGGAAGGGAAGAGAGGG + Intergenic
1104295111 12:127504938-127504960 GGTTATGGGAAGGGAAGTGATGG + Intergenic
1104621917 12:130320398-130320420 GCAAATGGGAGGGCCAGAGAGGG + Intergenic
1104650350 12:130526931-130526953 GCTGGTGGGAAGCCTGGAGAGGG + Intronic
1104805116 12:131585014-131585036 GCTGATGAGACGCGAAGAGAGGG - Intergenic
1104805123 12:131585081-131585103 GCTGATGAGACGCGAAGAGAGGG - Intergenic
1105309014 13:19189884-19189906 GCTGATGGAAGGGAATGAGAAGG - Intergenic
1106144847 13:27041273-27041295 GCCGATGGGAGGTCAAGAGCAGG - Intergenic
1106953370 13:34908819-34908841 GCCGAAGGGAAGGGAAGAGAAGG - Intergenic
1107104893 13:36632492-36632514 GCTGCTGGGATGGAAGGAGATGG + Intergenic
1108350558 13:49586950-49586972 GATGCTGGGAAGACAAGAGTAGG - Intergenic
1110463470 13:75773671-75773693 GCTGATTTGGAGGCAAGAGATGG + Intronic
1110714290 13:78683870-78683892 GCAGAGGGGAAGAGAAGAGAAGG + Intergenic
1114557405 14:23569941-23569963 GCTGATGGGAGGGGACTAGAGGG - Intronic
1115241822 14:31257430-31257452 TCTTATGGGAAGCAAAGAGAGGG + Intergenic
1116072574 14:40067662-40067684 GGTGATGACATGGCAAGAGAAGG - Intergenic
1116658497 14:47678385-47678407 GCTTAAGGACAGGCAAGAGATGG + Intergenic
1117218952 14:53581926-53581948 GCTGAGGGAAAGGGAGGAGAGGG - Intergenic
1117386209 14:55215531-55215553 GCTCAGGGAAAGGGAAGAGAAGG + Intergenic
1118065995 14:62190638-62190660 GCTGAAGGGAAGACAAAACATGG - Intergenic
1118683405 14:68266497-68266519 TCAGAGGGAAAGGCAAGAGAAGG + Intronic
1119226420 14:72947708-72947730 GCTGAGGGCAAGGTCAGAGAGGG + Intronic
1119287488 14:73467444-73467466 GCTGAAAGGAAAGCAACAGAGGG - Intergenic
1119671762 14:76525400-76525422 GCTGCTGGGAAGGAAAAGGAGGG + Intergenic
1119815797 14:77566058-77566080 GCGGAGGGGAAGGGAAGGGAGGG - Intronic
1119840715 14:77790838-77790860 GCAGATGGGAAGGCAGAGGAGGG - Intergenic
1119851136 14:77867399-77867421 GCTGCTGGGAAGGCAGGATGAGG - Intronic
1120335725 14:83151744-83151766 ACAGATGGGAAGGGAAGAGGAGG + Intergenic
1120623426 14:86793500-86793522 TCTGATAGGAAGTCAGGAGATGG + Intergenic
1120880765 14:89413852-89413874 GGGGAAGGGAGGGCAAGAGAAGG + Intronic
1121120113 14:91371310-91371332 GCTGATGGATAAGCAAGAAAGGG + Intronic
1121156412 14:91689170-91689192 GCTGAGAGTAAGGCTAGAGATGG - Intronic
1121431948 14:93894005-93894027 GCTGATGGGAGGGGAAGGGCTGG - Intergenic
1121431991 14:93894149-93894171 GCTGATGGGAGGGGAAGGGCTGG - Intergenic
1121472323 14:94165317-94165339 GCTGATGGGGAGGCTAGTGGCGG + Intronic
1121856229 14:97272603-97272625 GCACATGGGAAGGAAAGAGGTGG + Intergenic
1122023632 14:98859153-98859175 ACTGAGGGGAGGGCAAGAGCTGG - Intergenic
1122299367 14:100723259-100723281 GGGGATGGGAGGGCAAGAGCAGG - Intergenic
1122817063 14:104319100-104319122 GCTCCAGGGAAGTCAAGAGATGG + Intergenic
1124044622 15:26137536-26137558 GATGATGGGAGGGAAAGGGAAGG - Intergenic
1125578296 15:40769408-40769430 GCTGATGGCAGGCCAAGAGGAGG + Intronic
1125852046 15:42913211-42913233 GCTGATGGCAAAAGAAGAGAAGG + Intronic
1126331858 15:47541215-47541237 GCTGTTAGGAAGGCTAGAGTTGG + Intronic
1126346156 15:47696464-47696486 GCTGTGGGGAAGGAGAGAGAGGG + Intronic
1126711274 15:51459303-51459325 GGTGATGGGAAGGAAAGAAAAGG + Intronic
1127349759 15:58138887-58138909 GTTGATGGGAATGGAAGAGAAGG + Intronic
1128006469 15:64246733-64246755 GCTGCTGGGAAGCCAGGATATGG + Intronic
1128244074 15:66120938-66120960 GCAGTTTGGAAAGCAAGAGAGGG + Intronic
1128330187 15:66750660-66750682 AGTGCTGGGAAGGGAAGAGAAGG + Intronic
1128661095 15:69501633-69501655 GCCGAAGGGAGGGCAGGAGAAGG - Intergenic
1129898021 15:79122892-79122914 GCTGATGGGAAGGCTGGGGAGGG + Intergenic
1130174089 15:81549286-81549308 ACTCATGGGAAGGCACTAGAGGG + Intergenic
1131057707 15:89385507-89385529 GCTGTTGAGAGGGCAAGACAGGG + Intergenic
1131132587 15:89909761-89909783 GAGGAAGGGAAGGCAAGGGAGGG + Intronic
1132988982 16:2783445-2783467 GCAGAAGGGAAGGGAAGATAAGG - Intergenic
1133423405 16:5666180-5666202 GCAGCTGGGAAGGAAAGGGAGGG + Intergenic
1134128060 16:11629972-11629994 GGTGTTGGGGAGGGAAGAGAAGG + Intronic
1134465961 16:14477803-14477825 GGGGAAGGGAAGGGAAGAGAAGG + Intronic
1134823178 16:17263130-17263152 GCTGATAACAAGGAAAGAGAAGG - Intronic
1135784419 16:25335945-25335967 GAGGAAGGGAAGGTAAGAGATGG - Intergenic
1136251763 16:29009809-29009831 GGTGCTGGGAAGGGAAGGGATGG - Intergenic
1136609564 16:31357952-31357974 GCTGATGGGGAAGAAAGATAAGG + Intronic
1137253696 16:46758373-46758395 GCTGACGGGAAGGAGAGACAGGG + Intronic
1137515204 16:49137447-49137469 CTAGAAGGGAAGGCAAGAGATGG - Intergenic
1138137911 16:54539569-54539591 GATGATGGGCAGGAAGGAGATGG - Intergenic
1139471286 16:67179387-67179409 GCAGATGGGTAGGCATGAAAGGG - Intronic
1139660685 16:68418864-68418886 GGTGATGAGAAGGCCAGAGCAGG + Intronic
1140531459 16:75670301-75670323 ACTGATTGGAAGGCAGGATATGG + Intronic
1140536977 16:75718913-75718935 ACTGATTGGAAGGCAGGACATGG + Intronic
1141175975 16:81719497-81719519 GAGGAGGGGAAGGGAAGAGAGGG - Intergenic
1141461948 16:84183046-84183068 GCTGATGAGAAAGGAGGAGATGG - Intronic
1141628107 16:85272084-85272106 GATGATGGGAACGCAGGATACGG - Intergenic
1142472715 17:172236-172258 GCTGCTGAGAGGGAAAGAGAGGG - Intronic
1142648334 17:1329659-1329681 GGGGATGGGAAGGCAAAGGAAGG - Intergenic
1142788506 17:2244512-2244534 GATGAAGGGAAGAGAAGAGAAGG + Intronic
1143254883 17:5548740-5548762 GCTGCTGGGAGGTCAAGATAAGG - Intronic
1143562996 17:7706099-7706121 GCTGAGGGGAAGGCAGGGCAGGG + Intronic
1144255586 17:13463978-13464000 TATGCTGGGCAGGCAAGAGAGGG + Intergenic
1144579464 17:16450245-16450267 GCTGATGGGAAGGCAAGAGAAGG + Intronic
1144645384 17:16970239-16970261 GTTGATGGAAAGGGAAGAAAGGG + Intronic
1145241939 17:21245236-21245258 GGTGAGGGGAAGGGCAGAGATGG + Intronic
1145963936 17:28903620-28903642 GCAGAAGGGAAGGAAGGAGAAGG - Intergenic
1146634926 17:34496793-34496815 GCTCATGGCAGGGGAAGAGAGGG + Intergenic
1147027807 17:37603581-37603603 TCTGATGGCAATGCATGAGAAGG - Intronic
1147444074 17:40464189-40464211 GTTCAGGGGAAGGGAAGAGATGG + Intergenic
1147673484 17:42190087-42190109 GCTGATGGGAAGGAGAGGGGTGG - Intronic
1148198311 17:45730626-45730648 GCAGAATGGAAGGGAAGAGAGGG + Intergenic
1148845176 17:50525850-50525872 GAGGATGGGAAGGCATGTGAGGG - Intronic
1148897493 17:50847679-50847701 GCTGATGGGAAGGAGACAGTGGG + Intergenic
1148917562 17:50995175-50995197 TCTGGTGGGAAGACCAGAGATGG - Exonic
1149109166 17:53006274-53006296 GTTTATGGGAAAGCAGGAGAAGG - Intergenic
1149214663 17:54339513-54339535 GGTGATGGGAAGGGAAGGAAAGG - Intergenic
1149526694 17:57361720-57361742 GCTGATGAGAAGGAAGAAGAGGG + Intronic
1149719068 17:58824973-58824995 GCTGATGCAAAGGCATAAGAAGG + Intronic
1149880495 17:60285718-60285740 TCTGATAAGAAGGCAAGAAAAGG + Intronic
1150488263 17:65558990-65559012 GGTGAGAGGAAGGCAAGAGCTGG + Intronic
1150666756 17:67147417-67147439 GGTGAAAGGAAGGCAGGAGAAGG - Intronic
1151291183 17:73151202-73151224 GGTGAGAGGAAGGGAAGAGAGGG + Intergenic
1151352392 17:73539479-73539501 GCTGATGGGGAGAGGAGAGAGGG + Intronic
1151385515 17:73752995-73753017 GCTACTTGGAAGGCAGGAGAGGG + Intergenic
1151463349 17:74268832-74268854 GGAGATGGGAAGGCTGGAGAGGG - Intergenic
1152008417 17:77696364-77696386 GGTGAAGGGAAGGGAAGGGAAGG - Intergenic
1152261511 17:79269754-79269776 GCTAATGGCAAGGAAAGACAGGG - Intronic
1152382225 17:79947924-79947946 ACTGAGGTGAAGGCAAGCGAGGG - Intronic
1152638500 17:81439880-81439902 GCTGAGGGGCAGCCAAGAGAGGG - Intronic
1152652318 17:81500408-81500430 GCCGATGGGAATGCAAGATGAGG + Intergenic
1153003133 18:474442-474464 ACTGATGGGCAGGAAAGACAAGG + Intronic
1153472699 18:5464568-5464590 GCTGGGAGGAAGGAAAGAGATGG - Intronic
1154334730 18:13456345-13456367 GCAGGAGGGAAGGCGAGAGAGGG - Intronic
1155814319 18:30286073-30286095 TCTGATGGGGAGGCAAAAAATGG - Intergenic
1156641861 18:39111109-39111131 GCTGAAGGGAAGGGATGGGATGG + Intergenic
1158494582 18:57942903-57942925 GTTGATGGGGAGGAAAGACATGG + Intergenic
1159046584 18:63374636-63374658 GCTGATGGGAATGTAAAAAATGG + Intergenic
1159370964 18:67527249-67527271 ACTGATGGGAAGACAAAAGAAGG - Intergenic
1159940059 18:74400173-74400195 GGAGATGGGAAAGCCAGAGAAGG + Intergenic
1160056648 18:75488584-75488606 GCTGTTGGGAGAGCAAGAGTAGG - Intergenic
1160376770 18:78419858-78419880 GGTGATGGGGAGGCTGGAGACGG - Intergenic
1161663031 19:5558950-5558972 ACAGATGGGAAGGGAAGGGAAGG + Intergenic
1161674328 19:5635719-5635741 GCTTAACAGAAGGCAAGAGATGG + Intronic
1162412520 19:10515029-10515051 GCTGTTGGAGAGGCAAGATACGG + Exonic
1162470281 19:10869049-10869071 GCAGAGAGGAAGGCAGGAGAAGG + Intronic
1164813624 19:31177415-31177437 GAGGCTGGGAAGGCAAGGGATGG - Intergenic
1165770306 19:38376138-38376160 GCTGATGGGGAGGGGAGGGAGGG - Exonic
1165849372 19:38840380-38840402 GGGGGTGGGAAGGAAAGAGAGGG + Intronic
1166161166 19:40954543-40954565 GCAGATGAGAAGGCAAGGAAGGG - Intergenic
1167158885 19:47755190-47755212 GCTGCTGGGAAGGCACTGGAGGG + Intronic
1167494134 19:49808236-49808258 GCAGATGGGAAGGGAGGGGAAGG - Intronic
1167748263 19:51365495-51365517 GCTGATGGGAAGGACAGACATGG + Intronic
1168706695 19:58474433-58474455 GCTGGTGGGAAGACAAGGTAGGG - Intronic
925446373 2:3930077-3930099 GGCGAAGGGAAGGGAAGAGAAGG - Intergenic
925829691 2:7882225-7882247 GGAGATGGGAAGGCAGGTGAGGG + Intergenic
926135128 2:10331058-10331080 GCAGATGGGAGGCCACGAGATGG - Intronic
926985031 2:18613172-18613194 GCTGGTGGGAAGGGAAGAGAGGG + Intergenic
927086167 2:19675692-19675714 GGTGAATGGAAGGCCAGAGAAGG - Intergenic
927644991 2:24871997-24872019 TCAGATGGGAAGGTAAGGGAGGG + Intronic
927818237 2:26239653-26239675 CCTTATGGAAAGGGAAGAGAAGG + Intronic
927995642 2:27483861-27483883 GCTGAAGGGAAGGTAAAAGAGGG - Exonic
929013485 2:37471050-37471072 GAGGAAGGGAAGGAAAGAGAAGG - Intergenic
930026423 2:47031899-47031921 GCTGATGGGGAGCCACGAGTGGG - Intronic
930712501 2:54562216-54562238 GCTGATGTGAAGTGGAGAGATGG - Intronic
931257391 2:60585241-60585263 GCTGATGGGAGGGCAGCTGAAGG + Intergenic
931436025 2:62247472-62247494 GCTGAGAGGATGGGAAGAGAGGG - Intergenic
932338008 2:70942054-70942076 CTTCATGGGAAGACAAGAGAGGG + Exonic
933275867 2:80283822-80283844 GAAGATGGGAGGGCAAAAGAAGG + Intronic
933790475 2:85880007-85880029 GTGGATGGGAAGGGAAGATAGGG + Intronic
934315365 2:91913227-91913249 GGAGAGGGGAAGGGAAGAGAAGG + Intergenic
934854106 2:97718396-97718418 GATGCTGGGGAGGCCAGAGAAGG - Intronic
935071478 2:99698118-99698140 GCTGGTGGGAAGTTCAGAGATGG - Intronic
935184535 2:100720162-100720184 GCTGATGGGAAGTGATGAGATGG - Intergenic
935932230 2:108139650-108139672 TTTGAAGGGAAGGCAAAAGAAGG + Intergenic
936235161 2:110736046-110736068 GCTCTAGGGAAGGAAAGAGAAGG - Intronic
936412067 2:112268801-112268823 GAAGATGGGAGGGCAAGAAAGGG + Intergenic
936447519 2:112607388-112607410 AGGGAAGGGAAGGCAAGAGAAGG - Intergenic
936480408 2:112880083-112880105 GGTGATGGGGAGTCAAGAGGGGG + Intergenic
939902745 2:147869860-147869882 GTTGCGGGGAAGGCAAGGGAAGG + Intronic
940024311 2:149189163-149189185 GCTGCTGAGTAGGCAAGAGGAGG - Intronic
940145242 2:150538986-150539008 GCTGAAGGCAAAGCAAAAGATGG - Intronic
940771704 2:157845644-157845666 GCTGCTGGGAAGGCCTGAAAGGG + Intronic
941561445 2:167050551-167050573 CCTGATGGCACGGCAAGGGATGG + Intronic
941580869 2:167293861-167293883 TCGGAGGGGAAGGGAAGAGAGGG + Intergenic
942109399 2:172665337-172665359 GCTGCAGGGAAGGCAAAATAGGG - Intergenic
942832189 2:180250531-180250553 AAAGAGGGGAAGGCAAGAGAGGG - Intergenic
943571168 2:189577091-189577113 ATTGGTGGGAAGGCAAGAAATGG - Intronic
943603977 2:189954073-189954095 GTCAGTGGGAAGGCAAGAGAAGG + Intronic
944057908 2:195542722-195542744 TGTGATGGGAAGGGAAGAGTGGG - Intergenic
944342231 2:198615105-198615127 GGAAATGGGAAGGCAGGAGAAGG - Intergenic
944391254 2:199222058-199222080 ACTGATGGGAGGGCCAGAGCTGG - Intergenic
945494907 2:210498645-210498667 TCTGGTTTGAAGGCAAGAGAGGG - Intronic
946174964 2:217916946-217916968 GCTGAAGGGCAGGCAACAAATGG + Intronic
946412408 2:219521937-219521959 GAGGATGGGAAGGCAGGAGGAGG + Intronic
947489395 2:230580829-230580851 GCTGGGGGTAAGGGAAGAGAGGG - Intergenic
947525711 2:230875534-230875556 GCGGACGGGTAGGCAAGAGGGGG + Intronic
947708455 2:232294921-232294943 GCTGATGGGAAGAAAACAGAAGG - Intronic
947752244 2:232539271-232539293 GCTGTTGGGTAGGCATGTGAGGG - Intergenic
948113194 2:235473437-235473459 GCTGCTGGCAAGGCAGAAGATGG + Intergenic
948358147 2:237397137-237397159 GGAGAAGGGAAGGGAAGAGAAGG + Intronic
948379263 2:237541531-237541553 GCTGATGAGAAGGGAAGTGGAGG - Intronic
948602912 2:239117410-239117432 GCATATGGAGAGGCAAGAGAGGG + Intronic
1168942135 20:1721658-1721680 TCTCATTGGAAGGAAAGAGAGGG + Intergenic
1169340381 20:4792229-4792251 GGAGATGGGAAGGGAAGGGAAGG + Intronic
1169753466 20:9019611-9019633 ACTGATGACAAGGGAAGAGATGG - Intergenic
1169766521 20:9153217-9153239 GCTGTTGGGAAGGCATGATTGGG + Intronic
1169818935 20:9687862-9687884 GATGAAGAGAAGTCAAGAGAGGG + Intronic
1170140149 20:13117714-13117736 GCTGGAAGGAAGGTAAGAGAGGG + Exonic
1170179892 20:13518572-13518594 GCTGAGAGGAAGGCAAATGAGGG - Intronic
1171197486 20:23211531-23211553 GATGATGTGGAGGAAAGAGAGGG - Intergenic
1172055279 20:32150470-32150492 GCTGTTGAGAAGACAAGGGAGGG + Intronic
1172110886 20:32544285-32544307 GATGATGGGAAGGCAGGGGGCGG + Intronic
1172182055 20:33009612-33009634 GCTGATGGGCAGGCAATGAAAGG + Intronic
1172188988 20:33050242-33050264 GGTGATGGGAAGCCAAGGAAGGG - Intergenic
1172289603 20:33766591-33766613 TCTGAGGGGAAGGCCAGAGAGGG + Intronic
1172563105 20:35906646-35906668 GCTGCTGGGAAGGGAAGTGAAGG + Intronic
1172624639 20:36340216-36340238 GCTGTTGGGCAGCCAGGAGAAGG - Intronic
1172775172 20:37403089-37403111 GCTGATGGGGAGGGCAGCGAGGG - Intronic
1173643824 20:44621474-44621496 GCAGAGGGGAAGGCTGGAGAGGG - Intronic
1173764895 20:45598306-45598328 GGAGATGGGAAAGGAAGAGAGGG - Intergenic
1174361213 20:50029919-50029941 GCTGATGGTTACGAAAGAGAGGG - Intergenic
1174723609 20:52838948-52838970 GAAGAAGGGAAGGCAAGGGAGGG - Intergenic
1174731325 20:52920899-52920921 GCTGTTGGGAAGAAAAGAAAAGG + Intergenic
1174747391 20:53077010-53077032 TCTGATGGAAAAGCAAAAGAGGG + Intronic
1175491307 20:59382811-59382833 GCGGATGGGAAGGCACAAGGGGG + Intergenic
1175568553 20:60000515-60000537 GCTCAGAGGAAGGAAAGAGAAGG - Intronic
1175948307 20:62568980-62569002 GCTGAGGGGTAGGGAGGAGAGGG - Intronic
1176408250 21:6433593-6433615 GATGATGGGAGGGCAGGAGCAGG - Intergenic
1177136138 21:17307075-17307097 GCTGATGGGAAGGAAAGGCAGGG - Intergenic
1177422013 21:20871831-20871853 GCTGATGGGAAAATAAGAAATGG + Intergenic
1178417929 21:32418844-32418866 GCTGATGGGAGGGTAGGAAAAGG - Intronic
1178890231 21:36514798-36514820 GCTGGAGGCAAGGCAAGAGAAGG - Intronic
1179683743 21:43041919-43041941 GATGATGGGAGGGCAGGAGCAGG - Intergenic
1180717977 22:17884930-17884952 GCTGATGGGCATGGAAAAGACGG + Intronic
1180961026 22:19762385-19762407 GCAGAGGGGACGGCAAGTGAGGG + Intronic
1181388328 22:22560230-22560252 GCTGATGAGAAGGCAGCAGATGG + Intronic
1182005658 22:26957280-26957302 GGTCATGGGAGGGGAAGAGAAGG + Intergenic
1182363765 22:29764218-29764240 GCTGATGGGAAGTTCAGAGGAGG - Intronic
1182886423 22:33777716-33777738 GGTGAAGGGAAGGCAGGTGAAGG + Intronic
1183706299 22:39476700-39476722 GCTGATGGGAATGAAACAGACGG - Intronic
1183786289 22:40030918-40030940 GCTGATGTGAGAGCAAGAAAAGG + Exonic
1184417875 22:44362772-44362794 GGTGCTGGGAAGGGAAGTGAGGG - Intergenic
1184672565 22:46023069-46023091 GGGGAAGGGAAGGGAAGAGAAGG + Intergenic
949966344 3:9359673-9359695 GGTGAAAGGAGGGCAAGAGAAGG + Intronic
950876579 3:16280210-16280232 TCTGATGGGGAGGGTAGAGAGGG + Intronic
950895930 3:16450734-16450756 TCTGATGAAAAGGTAAGAGAAGG - Intronic
951529690 3:23686813-23686835 GCTGAGGGGAAAGCAGGAGGTGG - Intergenic
952157341 3:30657405-30657427 TCTGTTGGGAAGACAACAGAGGG + Intronic
952163892 3:30724740-30724762 GCAGAAGGAAAGCCAAGAGAGGG - Intergenic
952428743 3:33201699-33201721 GCTGTTGGGTAGGCCTGAGATGG - Intronic
954718132 3:52537145-52537167 GGTGAAGGGCAGGCATGAGAGGG - Intronic
956707948 3:72015606-72015628 GCTGGGGGGAGGGCAGGAGAAGG - Intergenic
957691764 3:83580054-83580076 GGTGAGAGGAAGTCAAGAGAAGG + Intergenic
959647614 3:108721470-108721492 GGTGATGGGAATGAAAAAGAAGG + Intergenic
960358572 3:116682655-116682677 GCAAATGGTAAGGCAACAGAGGG + Intronic
960533221 3:118788375-118788397 GATGAGGGGAGGGCAAGAGAAGG - Intergenic
960854700 3:122091282-122091304 GCTGCTAAGAAGGCAGGAGAGGG + Intronic
961072187 3:123943390-123943412 GGTGAAAGGATGGCAAGAGAAGG - Intronic
961370345 3:126424798-126424820 GCAGATGGGAGGGGTAGAGAAGG + Intronic
961469198 3:127100850-127100872 GCTGATGGGATGGCCTGAGCAGG + Intergenic
961928123 3:130504818-130504840 GCCGATAGGAATGCAAGTGAAGG - Intergenic
962072129 3:132044521-132044543 AAGGAAGGGAAGGCAAGAGAAGG + Intronic
962278624 3:134033754-134033776 GCTGCTGGGGAGGCAAGAGAAGG + Intronic
962378598 3:134878583-134878605 GCTGATGGAAAGGGAAGATTTGG + Intronic
962600000 3:136984448-136984470 GCTGCAGGAAAGGCAAGATAAGG + Intronic
963934930 3:151042751-151042773 GGTGGTGGGCAGGCAAGAGAAGG - Intergenic
964314806 3:155432343-155432365 GCTGATGGGAAGTCTAGAGGTGG - Intronic
965075242 3:163966969-163966991 GCTACTGGGGAGGCAAAAGAGGG + Intergenic
965705913 3:171508042-171508064 GCCAATGGGAAGGCAGGTGACGG - Intergenic
968761277 4:2443778-2443800 CCTGCTGGGGAGGCAGGAGAAGG - Intronic
969321199 4:6413903-6413925 GCTGATGGGAAAGAGAGACACGG - Intronic
969467536 4:7366517-7366539 GCTGGAGGGAAGGGAAGGGAGGG - Intronic
970013725 4:11489304-11489326 GCTGATGGAAAGTCCAGAGAAGG + Intergenic
971624791 4:28905508-28905530 GTTGGTGGGAAGGCAAGGGTGGG + Intergenic
973757337 4:54088539-54088561 ACAGAGGGGAAGGCTAGAGAGGG + Intronic
973875511 4:55214442-55214464 GCTGATGGGGAGGGCACAGACGG + Intergenic
975098112 4:70481078-70481100 GCTGATGGGAAAGTCACAGATGG - Exonic
978645934 4:110931827-110931849 GCTGATGGGACTCCAAAAGAAGG - Intergenic
979551331 4:121994440-121994462 GCTGATGGGAAGCCATGGGATGG + Intergenic
981741491 4:148006871-148006893 GCTGATGGGGAGGAAGGAAAGGG - Intronic
981804624 4:148700047-148700069 ACTGATAGGAAGGCAAGGAATGG - Intergenic
986835744 5:11635041-11635063 TCTGATGTTAAGGCAAGGGAAGG + Intronic
986886690 5:12246502-12246524 GATAATGTGAAGGCAAGAGATGG + Intergenic
987143434 5:14967869-14967891 GCTGAGGGTGAGGCTAGAGATGG - Intergenic
987487120 5:18537840-18537862 CTTGATGTGTAGGCAAGAGAGGG - Intergenic
987726660 5:21709404-21709426 CCTGAGGAGAAGGAAAGAGATGG - Intergenic
988540040 5:32100367-32100389 GCTGGTAGGCAGGCAAGGGAGGG + Intronic
988788229 5:34583785-34583807 GATGAGAGGAAGGAAAGAGAAGG + Intergenic
988911957 5:35852206-35852228 TCCGCTGGGAAGGCCAGAGAGGG + Intergenic
988961414 5:36375097-36375119 GCTGATGGGGAAGCAGGAGAGGG + Intergenic
989280637 5:39638976-39638998 GCAGCTGGGAAGGCAATAAATGG + Intergenic
990375679 5:55168153-55168175 GATGAGGGGAAGGGAAGAGTGGG - Intronic
990701951 5:58483426-58483448 GCAGTTGTGCAGGCAAGAGATGG + Intergenic
990763284 5:59154125-59154147 GATGATGGGAAGGCTTGAAAAGG + Intronic
991917356 5:71618346-71618368 GAAGGTGGGAGGGCAAGAGAGGG - Intronic
992073531 5:73170575-73170597 GCTGATTGGAGGGCAGGAGGAGG + Intergenic
992656604 5:78916514-78916536 GGGGATGGGAAGGAAACAGAGGG - Intronic
992749090 5:79845849-79845871 TATGATAGGAAGGCAATAGAGGG - Intergenic
993011357 5:82486864-82486886 GCAGCAGGGATGGCAAGAGAGGG + Intergenic
993869238 5:93231791-93231813 TCTGAAGGGAAGGAAAGAGTTGG + Intergenic
995534586 5:113122361-113122383 GATGGTGGGAAGGGAAGGGATGG - Intronic
998377477 5:141700777-141700799 GCTGATCCGAAGGCAGGAGAGGG + Intergenic
999380393 5:151117428-151117450 GGTTATGGGAATTCAAGAGATGG + Intronic
999572706 5:152938478-152938500 CATGATAGGAAGGCAAGATATGG - Intergenic
999631929 5:153580314-153580336 CCTGAAGGGAGAGCAAGAGAGGG - Intronic
1000045118 5:157516071-157516093 GAGGATGGGAAGGCAGGAAAGGG - Intronic
1000150236 5:158493173-158493195 CCTGAAGGCAAGGCAAGGGAGGG - Intergenic
1000359808 5:160436398-160436420 GCTGATGGGAAGGCCACATGAGG + Intergenic
1000990679 5:167908454-167908476 GGGGAGGGGAAGGAAAGAGAAGG - Intronic
1001191201 5:169633157-169633179 TCTGATGGGAGGCCAAGAGTAGG - Intergenic
1001289417 5:170446063-170446085 GCTCAAGGGTAGGAAAGAGAGGG - Intronic
1001565502 5:172696926-172696948 GCAGATGGGGAAGCCAGAGAGGG - Intergenic
1001782719 5:174384266-174384288 GCTTCAGAGAAGGCAAGAGAAGG + Intergenic
1001802723 5:174558227-174558249 GTTGGGGGGAAGGGAAGAGATGG - Intergenic
1001945656 5:175775395-175775417 GCTGAGGGGAAGGAGAGTGAAGG - Intergenic
1002048480 5:176555501-176555523 GCTGGAGGGGAGGCAAGAGCAGG - Intronic
1002401277 5:178992741-178992763 GCTGGTGTGAAGGCCAGAGAGGG + Intronic
1002655497 5:180743458-180743480 TCTGAAGGGGAGGAAAGAGATGG - Intergenic
1003066943 6:2911909-2911931 GCTGATGTGAAGGTATGAAAAGG + Intergenic
1003403365 6:5809101-5809123 GCTGATGGAAGGGAAGGAGAAGG - Intergenic
1004058262 6:12163453-12163475 GCTGCTGGGAATGCAAAGGAAGG - Exonic
1004184795 6:13412718-13412740 CCAGAAGGGAAGGCAAGAGGAGG - Intronic
1004344622 6:14837200-14837222 AATGCTGAGAAGGCAAGAGAGGG + Intergenic
1006196157 6:32243794-32243816 GCTGATGGTGAGGCGGGAGAAGG + Intergenic
1006680455 6:35793469-35793491 GCAGCTGGGAAGGCGGGAGAAGG - Intronic
1008876056 6:56329356-56329378 GCTGTGGGGGAGGAAAGAGATGG + Intronic
1009890753 6:69678312-69678334 GCTGATGGGAAGGGGAAGGATGG + Intronic
1011184693 6:84661258-84661280 GCTAATAGGAAGGCAAGCAAGGG - Intergenic
1011362053 6:86537861-86537883 CCCCATGGGAAGGCAACAGATGG + Intergenic
1011434538 6:87322709-87322731 GCAGCTGGGAAGGGCAGAGACGG - Intronic
1012284464 6:97372170-97372192 GCTGAAGAGAAGGAGAGAGATGG - Intergenic
1012431473 6:99168293-99168315 GTTGATGGGAAGGGAATGGAAGG + Intergenic
1012564890 6:100636429-100636451 CCTGAGGAGAAGGAAAGAGATGG - Intronic
1013230824 6:108160640-108160662 GCTGCTGTGAAGGGAAGACAGGG + Intronic
1013429067 6:110039940-110039962 GCTGAGGGGAAGTAAAGAGAGGG - Intergenic
1014080089 6:117275893-117275915 GGTGATGAAAAGGAAAGAGACGG + Intergenic
1014818765 6:125961998-125962020 GGTGAGGGGAGGGCAAAAGAAGG + Intronic
1015399139 6:132768680-132768702 GCTGATGTGGAGGGAGGAGAGGG - Intergenic
1015603092 6:134929566-134929588 ACTGATGTGAAGGCATGAGACGG + Intronic
1015820840 6:137258770-137258792 GCTGAAGGGAACTCATGAGATGG - Intergenic
1015978022 6:138811149-138811171 GCAAATGAGAAAGCAAGAGAGGG - Intronic
1017045288 6:150341510-150341532 GCTAAAGTGAAGGCAAAAGAGGG - Intergenic
1018427678 6:163698287-163698309 GCTGACAGGAAGCAAAGAGAAGG + Intergenic
1018549514 6:164979228-164979250 TCTTATGGGAAGGGATGAGAGGG - Intergenic
1018648745 6:165972999-165973021 GCTGAATGGAATGGAAGAGAAGG - Intronic
1019152514 6:170018489-170018511 GCTGGTGGGAAGGCAGGCCAGGG + Intergenic
1020466426 7:8485019-8485041 GCTGATGGGAATTCAACACATGG - Intronic
1020566587 7:9805067-9805089 GCTGATGGAAATGCAAACGATGG + Intergenic
1020849536 7:13333728-13333750 TCTGATGGGAGGGTAAGGGAAGG - Intergenic
1021083753 7:16394868-16394890 GCAGATGGCAAGGCAAGGGATGG - Intronic
1021090292 7:16474877-16474899 GCTGATGGGAATCTAAGAGAAGG + Intronic
1021131659 7:16919774-16919796 GCTGCTGGGAATGCAAAATAGGG - Intergenic
1022093468 7:27123438-27123460 GCTGGTTAGAGGGCAAGAGAGGG - Intronic
1022690091 7:32641154-32641176 CCTGATGGGAGGGAGAGAGATGG - Intergenic
1023149415 7:37186768-37186790 GCTGATGGGAGGGAATGGGAGGG - Intronic
1023397365 7:39763739-39763761 AGGGAGGGGAAGGCAAGAGAAGG - Intergenic
1023821499 7:43983105-43983127 GCTGATGGGCAGGTAGGGGAGGG - Intergenic
1024062027 7:45704963-45704985 GCTGATGGGAGGAGAAGAGAGGG - Intronic
1024171356 7:46791143-46791165 GAGGAAGGGAAAGCAAGAGAAGG + Intergenic
1024397045 7:48881769-48881791 GATGATGAGAGGGCAAGAGAGGG + Intergenic
1024426478 7:49232026-49232048 GCTGCTAGGATTGCAAGAGAGGG + Intergenic
1026639795 7:72114241-72114263 GTTGAAGGGAAGGGAAGGGAAGG + Intronic
1027219728 7:76206296-76206318 GATGAGGGGAAGGGAAGGGAAGG + Intronic
1028702655 7:93799548-93799570 GCAGATGGTCAGGCAAGATATGG + Intronic
1028870304 7:95764289-95764311 GATGATGGGAAGGGAAGTGAGGG + Intergenic
1029012046 7:97272490-97272512 GCTGACGGGAAGGCTAGAGGTGG + Intergenic
1029048839 7:97661655-97661677 GCTTATAAGAAGGCAAGAGGTGG + Intergenic
1029460479 7:100691362-100691384 GCCAAGGGGAAGGCAAGGGAAGG + Intergenic
1029749761 7:102536526-102536548 GCTGATGGGCAGGTAGGGGAGGG - Intergenic
1029767711 7:102635631-102635653 GCTGATGGGCAGGTAGGGGAGGG - Intronic
1029885122 7:103861360-103861382 GGGGATGGGAAGGGAAGAGGTGG + Intronic
1029950354 7:104577703-104577725 GCTAATGGCTAGGCAGGAGATGG + Intronic
1030846473 7:114419931-114419953 TCCAATGGGAAGGCAAGAGGTGG + Intronic
1033639446 7:143247099-143247121 AGTGATGGGATGGGAAGAGAAGG - Intronic
1034457006 7:151176043-151176065 GATGTGTGGAAGGCAAGAGAAGG - Intronic
1035574568 8:696505-696527 GCTGATGGGGAGGAAGGAGAGGG - Intronic
1035574579 8:696550-696572 GCTGATGGGGAGGAAGGAGAGGG - Intronic
1035574646 8:696853-696875 GCTGATGGGGAGGAAGGAGAGGG - Intronic
1035574657 8:696898-696920 GCTGATGGGGAGGAAGGAGAGGG - Intronic
1035576573 8:710966-710988 GCAGATGGGAATGCAAAACAGGG - Intronic
1035877926 8:3211902-3211924 GCTGGTGGCAAGACAAGAGGGGG + Intronic
1035912502 8:3583110-3583132 GCTGTTAGGAAGGAAAGATAGGG - Intronic
1036157905 8:6359435-6359457 TCAGATAGGATGGCAAGAGATGG - Intergenic
1037945549 8:22987419-22987441 GCTTATGGGAAGGCAGGTGAAGG - Exonic
1038239857 8:25798419-25798441 CCAGAAGGGAAGGCAAGAGAAGG + Intergenic
1038428356 8:27479916-27479938 GCTGAAGGGAAGGAACGAGTGGG - Intergenic
1038651464 8:29407594-29407616 AGTGATGGGAAGGGAAGGGAAGG - Intergenic
1038781014 8:30568585-30568607 GGTGATGGGACGTCAAGACAGGG - Intronic
1039469389 8:37803868-37803890 CCAGCTGGGAAGGGAAGAGAAGG + Intronic
1039771099 8:40687722-40687744 GCTGATGAGAAGGTGAGGGAAGG - Intronic
1040425689 8:47283280-47283302 CCTAAGGAGAAGGCAAGAGATGG + Intronic
1040658653 8:49543739-49543761 GGTGAAAGGAGGGCAAGAGAAGG - Intronic
1041043083 8:53866352-53866374 GCTAAAAGGAAGGGAAGAGAAGG + Intronic
1041257902 8:55995268-55995290 CTTGATGGGAAGTCAACAGAAGG - Intronic
1041348108 8:56922389-56922411 GCTGATGGGTAGGAAGGGGAAGG - Intergenic
1041854686 8:62438182-62438204 GCTGATAGGAAGGGACGAGAGGG - Intronic
1043796396 8:84547114-84547136 CCTGTTGGGAGGGCAAGAGGAGG - Intronic
1044412736 8:91902139-91902161 GCTGCCGGGAAGGCACGGGAAGG - Intergenic
1044572999 8:93740696-93740718 GCTGACGGGAAAGGAAGAGTCGG + Intronic
1045299426 8:100898502-100898524 GCTGATGCGAAGCTAAGAGCTGG + Intergenic
1046234382 8:111403412-111403434 TCAGATGGGATGGCAAGAGTGGG - Intergenic
1047131270 8:122022723-122022745 GGGGAGGGGAAGGGAAGAGATGG - Intergenic
1047131293 8:122022797-122022819 GGGGAGGGGAAGGGAAGAGATGG - Intergenic
1047361767 8:124175649-124175671 GCTGATGGGGAAGGAAGAGGAGG - Intergenic
1047462881 8:125085684-125085706 GCTAGTGGGAAGGAAAGGGATGG - Intronic
1048806846 8:138249068-138249090 GCTGAAGATGAGGCAAGAGAAGG - Intronic
1049140039 8:140945915-140945937 ACTGATGGGAAGGACAGAGGAGG - Intronic
1049168148 8:141139798-141139820 GCTGCTGGGAAGGCAGGAGCAGG - Intronic
1050153687 9:2643316-2643338 GCTGATGGGGATGCAGGAGGAGG - Exonic
1050264505 9:3875755-3875777 CCAGCTGGGAAGGCAAGGGATGG + Intronic
1050352340 9:4752401-4752423 GCTGGTGGGAATGCAAAAAATGG + Intergenic
1051009871 9:12398313-12398335 GCTGAGGACAAGGAAAGAGATGG - Intergenic
1051857678 9:21587827-21587849 GTTGATGGGATGGCAGGAGAAGG + Intergenic
1052173297 9:25427650-25427672 GCCCATGGGAAGGGGAGAGAAGG - Intergenic
1052885170 9:33639450-33639472 GCTGAGGGGATGGAGAGAGAGGG - Intergenic
1055292882 9:74802037-74802059 GCTGATGAAAAGGCAGAAGATGG - Exonic
1056182921 9:84102861-84102883 GCTGTTGGTTAAGCAAGAGATGG - Intergenic
1056959621 9:91111582-91111604 TCTGAGGAGAAGGAAAGAGATGG + Intergenic
1057397050 9:94689662-94689684 GCTGGTGGGAAGGCGGGAGGGGG - Intergenic
1058074177 9:100634066-100634088 GGGGAAGGGAAGGCAAGGGAAGG - Intergenic
1058422271 9:104843319-104843341 GGTGATGGGAAGGGAGGACAGGG - Intronic
1058494557 9:105542205-105542227 ACTGATAGGAAGGCAAAAAATGG - Intronic
1058964490 9:110023878-110023900 GCTACTTGGGAGGCAAGAGATGG + Intronic
1059063713 9:111060369-111060391 CATGAAGGGAAGGGAAGAGAAGG + Intergenic
1059063770 9:111060621-111060643 CATGAAGGGAAGGCAAGAGAAGG + Intergenic
1059206713 9:112474286-112474308 AGTGAAAGGAAGGCAAGAGAAGG - Intronic
1059227302 9:112683715-112683737 GCTGATGGGATTCCAATAGAGGG + Intergenic
1059767098 9:117393879-117393901 GGAGATGGGAAGGGAAGGGATGG + Intronic
1060044890 9:120332124-120332146 ACAGTAGGGAAGGCAAGAGAAGG - Intergenic
1060195448 9:121620671-121620693 GTGTCTGGGAAGGCAAGAGAGGG - Intronic
1060196281 9:121625631-121625653 GCTGATGGGATGGCAGGATCAGG + Intronic
1060465169 9:123897583-123897605 ACTGAGGAGATGGCAAGAGAGGG + Intronic
1060681424 9:125568380-125568402 GCTGATGGGACTGCTAGAAAAGG + Intronic
1060910093 9:127342692-127342714 GCTGATGGGCAGGCAAAGGTGGG + Intronic
1061568988 9:131464415-131464437 GCTGATGGGCATGCAAGCTAAGG - Intronic
1062154776 9:135040932-135040954 GAAGGTGGGAAGGGAAGAGAGGG - Intergenic
1203435351 Un_GL000195v1:132252-132274 GCTAATGAGCAGGCAAGTGATGG + Intergenic
1187173393 X:16871731-16871753 GCTGAGGGGGTGGCTAGAGAGGG + Intergenic
1187453804 X:19423286-19423308 GATGGTGGGAAGGCAACACAAGG - Intronic
1187786580 X:22894940-22894962 GAGGATGGGAAGAAAAGAGAGGG - Intergenic
1189463658 X:41262260-41262282 GCGGAGGGGAAGGGAAGGGAAGG - Intergenic
1189911026 X:45810665-45810687 GCAGGTGGGGAGGGAAGAGATGG - Intergenic
1189999853 X:46675610-46675632 GATGAAAGGAGGGCAAGAGAAGG - Intronic
1190158505 X:48012990-48013012 GCAGATGGGAAGTCATGAGAAGG - Intronic
1190174200 X:48135256-48135278 GCAGATGGGAAGTGATGAGAAGG - Intergenic
1190223522 X:48528573-48528595 GCTCATGGGCAGGCACAAGAAGG + Exonic
1192325961 X:70132377-70132399 GCTGTTGGAAAAGCAAGAAAGGG - Intergenic
1193058193 X:77176888-77176910 GGTGATGGGAAGGCAATTTAAGG - Intergenic
1195922416 X:109996733-109996755 ACTGACGGGAAGGGAAAAGAAGG - Intergenic
1196376206 X:115035420-115035442 GCTGTTGATTAGGCAAGAGATGG - Intergenic
1197337894 X:125230898-125230920 GGTAAAAGGAAGGCAAGAGAAGG - Intergenic
1197340472 X:125260167-125260189 GAAGATGGGAAGGCAAGGGAGGG + Intergenic
1198393107 X:136196207-136196229 GCTAAGGGTAAGGCCAGAGAAGG + Intronic
1199184813 X:144903540-144903562 GCAGATGGGAAGGATAGTGAGGG + Intergenic
1199721901 X:150548110-150548132 GCTGAGGGAAAGGAAAAAGAAGG - Intergenic
1199944767 X:152656387-152656409 GTCGATGGGAAGGAAAGAAATGG - Exonic
1200356845 X:155561533-155561555 GCTGTTGGGAAGGCATGATTGGG - Intronic