ID: 1144580554

View in Genome Browser
Species Human (GRCh38)
Location 17:16456633-16456655
Sequence GAGGGAACACAGAGGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1265
Summary {0: 1, 1: 0, 2: 4, 3: 81, 4: 1179}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144580539_1144580554 30 Left 1144580539 17:16456580-16456602 CCATAGCTAGCCACATTCCCTAC 0: 1
1: 0
2: 1
3: 9
4: 94
Right 1144580554 17:16456633-16456655 GAGGGAACACAGAGGGAGGCAGG 0: 1
1: 0
2: 4
3: 81
4: 1179
1144580548_1144580554 8 Left 1144580548 17:16456602-16456624 CCATGCGGCAGGGGGAAGAGCAG 0: 1
1: 0
2: 2
3: 23
4: 326
Right 1144580554 17:16456633-16456655 GAGGGAACACAGAGGGAGGCAGG 0: 1
1: 0
2: 4
3: 81
4: 1179
1144580547_1144580554 12 Left 1144580547 17:16456598-16456620 CCTACCATGCGGCAGGGGGAAGA 0: 1
1: 0
2: 0
3: 11
4: 127
Right 1144580554 17:16456633-16456655 GAGGGAACACAGAGGGAGGCAGG 0: 1
1: 0
2: 4
3: 81
4: 1179
1144580541_1144580554 20 Left 1144580541 17:16456590-16456612 CCACATTCCCTACCATGCGGCAG 0: 1
1: 0
2: 1
3: 8
4: 125
Right 1144580554 17:16456633-16456655 GAGGGAACACAGAGGGAGGCAGG 0: 1
1: 0
2: 4
3: 81
4: 1179
1144580546_1144580554 13 Left 1144580546 17:16456597-16456619 CCCTACCATGCGGCAGGGGGAAG 0: 1
1: 0
2: 0
3: 8
4: 93
Right 1144580554 17:16456633-16456655 GAGGGAACACAGAGGGAGGCAGG 0: 1
1: 0
2: 4
3: 81
4: 1179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144580554 Original CRISPR GAGGGAACACAGAGGGAGGC AGG Intronic
900101546 1:964228-964250 GTGGGTAAACAGAGGGAGGAGGG - Intronic
900167114 1:1248237-1248259 GAGGCTAGACCGAGGGAGGCTGG + Intergenic
900167197 1:1248500-1248522 GAGGCTAGACCGAGGGAGGCTGG + Intergenic
900167280 1:1248764-1248786 GAGGCTAGACCGAGGGAGGCTGG + Intergenic
900167580 1:1249622-1249644 GAGGCTAGACCGAGGGAGGCTGG + Intergenic
900201685 1:1410608-1410630 AAGGGAACGCAGAGGCTGGCGGG + Intergenic
900279857 1:1859706-1859728 GTGGGAAAGAAGAGGGAGGCAGG + Intronic
900438374 1:2641901-2641923 CAGAGGACACAGAGAGAGGCAGG + Intronic
900487784 1:2931654-2931676 GAGGGGACACAGACGGGGCCGGG + Intergenic
900658277 1:3770834-3770856 GAGGGAAGACAGAGGATGGAGGG + Intronic
900681761 1:3920390-3920412 GAGGGAAGAGGGAGGGAGGGAGG - Intergenic
900863105 1:5246579-5246601 GAGGGAGGAGAGAGGGAGGGAGG - Intergenic
900964703 1:5949871-5949893 GAGGCAGCACATAGTGAGGCAGG + Intronic
900996057 1:6124284-6124306 GAGGACACACAGAGGGTGGGAGG - Intronic
901213449 1:7539751-7539773 GAGGGCAGACATAGGAAGGCAGG + Intronic
901675074 1:10878576-10878598 GAGGGAACGGGGAGGCAGGCGGG + Intergenic
901740617 1:11339419-11339441 GATGGGTCAGAGAGGGAGGCAGG + Intergenic
901934456 1:12618071-12618093 GCTGGAACAGAGAGGGAGGGAGG - Intergenic
901956974 1:12793412-12793434 CAGTGATCCCAGAGGGAGGCAGG - Exonic
901972299 1:12917877-12917899 CAGGGACCCTAGAGGGAGGCGGG - Exonic
901980370 1:13029548-13029570 CAGTGATCCCAGAGGGAGGCAGG - Intronic
901989066 1:13097765-13097787 CAGCGATCCCAGAGGGAGGCGGG + Intergenic
901992747 1:13129002-13129024 CAGCGATCCCAGAGGGAGGCGGG - Intergenic
902001717 1:13199383-13199405 CAGTGATCCCAGAGGGAGGCAGG + Intergenic
902005125 1:13225900-13225922 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902012880 1:13283885-13283907 CAGGGACCCTAGAGGGAGGCGGG + Exonic
902020945 1:13345108-13345130 CAGTGATCCCAGAGGGAGGCAGG + Exonic
902024350 1:13371694-13371716 CAGGGACCCCAGAGGGAGGCAGG + Intergenic
902232468 1:15036515-15036537 GAAGCAAGGCAGAGGGAGGCAGG + Intronic
902248157 1:15135482-15135504 AAGGGAACTCAGAGGCCGGCGGG - Intergenic
902281663 1:15379160-15379182 AAGGGAACTCAGAGGCTGGCGGG - Intronic
902395163 1:16128537-16128559 GCGGGAACAGACCGGGAGGCTGG - Intronic
902603580 1:17556198-17556220 CTGGGAGCACAGGGGGAGGCTGG + Intronic
902833108 1:19030192-19030214 GAGGGAGGAGAGAGGGAGGGAGG + Intergenic
902841162 1:19074767-19074789 GAGGGAGAACAGAGGGTGGAAGG + Exonic
902841473 1:19076870-19076892 CCAGTAACACAGAGGGAGGCTGG - Exonic
903034623 1:20485900-20485922 GAGGAAACCCGGAGGGAGGGTGG + Exonic
903369228 1:22824567-22824589 GAGGGAAGACGGGTGGAGGCTGG + Intronic
903400630 1:23043785-23043807 GTGGTAACACAGAGAAAGGCAGG - Intronic
903574546 1:24330797-24330819 CAGGGCACACAGAGGCAGGAAGG - Intronic
903651400 1:24924577-24924599 GAGGGAACAGGCAGGGTGGCAGG - Intronic
903663005 1:24990094-24990116 GAGGGAAGACTGTGGGAGGCAGG + Intergenic
903703253 1:25266765-25266787 GAAAGAACACAGAGGGTGGAGGG - Intronic
903730545 1:25491903-25491925 GAGGGAACATAGAAAGAGTCAGG + Intronic
903890447 1:26566783-26566805 GAAACAACACAGAGGGAGCCTGG - Intronic
903951581 1:26998809-26998831 GAAGAAACAGAGAGGGAGGGCGG + Intronic
904269197 1:29338225-29338247 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
904272586 1:29360125-29360147 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
904876286 1:33657033-33657055 GAGGGAACTTGAAGGGAGGCTGG - Intronic
904914889 1:33962635-33962657 GAGGGAGTAGAGAGGAAGGCAGG - Intronic
905042674 1:34973193-34973215 GAGTCAACGCAGAGGGAGGAGGG + Intergenic
905186990 1:36203919-36203941 GAGGGTACAAAGAGGGGGGTTGG - Intergenic
905257588 1:36694803-36694825 GAGAGAACCCAGCTGGAGGCAGG + Intergenic
905277397 1:36827378-36827400 GAGAGGACAGAAAGGGAGGCTGG + Intronic
905388579 1:37621586-37621608 GAGGGACCACAGGAGGAGGAGGG + Intronic
905440027 1:37989756-37989778 GAGGGAGCCCGGAGGAAGGCAGG + Intronic
905481892 1:38267669-38267691 GAGGGAGGAAAGAGGGAGGGAGG - Intergenic
905762628 1:40572829-40572851 AAGGGAACTCAGAGGCTGGCAGG + Intergenic
905780041 1:40700888-40700910 AAGGGGACACAGTGGGAGGATGG - Intronic
905788751 1:40778922-40778944 GAGGAGACACAGAGGGAGAAAGG - Intergenic
905835816 1:41119841-41119863 GAGGGAAAAAAGGAGGAGGCAGG - Intronic
906017975 1:42599968-42599990 GAAGGAAGAGAGAGTGAGGCAGG + Intronic
906037988 1:42764883-42764905 GAGGGAGAACAGAGAAAGGCAGG - Intronic
906039580 1:42777867-42777889 GAGGGGACAGAGGGGGAAGCAGG - Intronic
906098865 1:43243194-43243216 GGGGGAAGAGAGAGGGAGGGTGG - Intronic
906402366 1:45514305-45514327 AAGGGAACTCAGAGGCCGGCGGG + Intronic
906404238 1:45528903-45528925 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
906498277 1:46321098-46321120 AAGGGAACTCAGAGGCTGGCAGG + Intergenic
907120887 1:52007046-52007068 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
907915145 1:58861379-58861401 GAAGGAAGAGAGAGGGAGGCAGG + Intergenic
907981009 1:59480794-59480816 GAGGAAACAGAGAAGTAGGCAGG + Intronic
908013716 1:59810119-59810141 GAGGGAAGAAAGAGGGAGAAAGG - Intergenic
908167606 1:61473888-61473910 GAGGGGAACCAGAGGGAGCCAGG - Intergenic
908234590 1:62137550-62137572 GGGGGAACACAGAGTGAGGGGGG + Intronic
908234610 1:62137604-62137626 GGGGGGACACAGAGTGAGGGGGG + Intronic
908234628 1:62137658-62137680 GGGGGAACACAGAATGAGGGGGG + Intronic
908245926 1:62227760-62227782 AAGGGGACAGAGAGGCAGGCGGG - Intergenic
908494323 1:64679497-64679519 GAGGGAATACAGTGGGAAGGGGG - Intronic
908522459 1:64957374-64957396 GAGAGAACAAAGGTGGAGGCTGG - Intronic
908543167 1:65140596-65140618 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
908659960 1:66424958-66424980 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
909234049 1:73129441-73129463 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
909413249 1:75377888-75377910 AAGGGAACTCAGAGGCTGGCGGG + Intronic
909413900 1:75383293-75383315 AAGGGAACTCAGAGGCTGGCGGG + Intronic
909469299 1:76008822-76008844 GTGGGAAGAGAGAGGGAGGAAGG - Intergenic
909651721 1:77983017-77983039 AAGGGAACTCAGAGGCTGGCGGG - Intronic
910092413 1:83480746-83480768 AAGGGCATACAGAGGGAGACTGG - Intergenic
910604316 1:89067006-89067028 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
910891432 1:92024436-92024458 GAGGGAGAAGAGAGGGAGGAGGG + Intergenic
911010590 1:93276925-93276947 AAGGGAACTCAGAGGCTGGCGGG - Intronic
911023798 1:93415415-93415437 GATGGAACACATTGCGAGGCTGG + Intergenic
911607067 1:99919162-99919184 GGGGGAACACAGGTGGAGCCTGG - Intronic
912084867 1:105987022-105987044 GAGGGTACACGGTGGGAGGAGGG - Intergenic
912209300 1:107541109-107541131 GATGGAACACAAAGGGTGGGTGG - Intergenic
912628598 1:111227361-111227383 GTGTGAACACAGAGAGAGGTGGG + Intronic
912684828 1:111754230-111754252 GAGGGCACTAAGAGGAAGGCTGG + Intronic
912926812 1:113920318-113920340 GAGGTCACAGAGAGGGAGGCAGG + Intergenic
913199483 1:116484308-116484330 GAGGGAAGGAAGAGGGAGGGAGG + Intergenic
914240678 1:145850650-145850672 GAGGGGACAGAGAGGGAACCTGG - Intronic
914443988 1:147733985-147734007 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
914456413 1:147841146-147841168 CAGGGAACCCAGAGGGAGGCGGG - Intergenic
914514568 1:148362882-148362904 GAGGGAAAAGAGGGAGAGGCAGG - Intergenic
915100055 1:153492761-153492783 GTGGCAACAGAGAGGGTGGCTGG - Intergenic
915286429 1:154856236-154856258 GAGGCAGCAGGGAGGGAGGCTGG + Intronic
915346977 1:155202542-155202564 GAGGGAACCCCGAGGGAAGTGGG - Intronic
915397873 1:155599680-155599702 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
915401737 1:155626809-155626831 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
915402642 1:155635021-155635043 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
915480300 1:156180025-156180047 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
915480624 1:156182262-156182284 AAGGGAACTCAGAGGCTGGCAGG + Intergenic
915571625 1:156748063-156748085 GAGGGAAGAGAGAGGAAGACAGG + Intronic
915716565 1:157950148-157950170 GAGGGGAAACAGAGGGAGGGAGG + Intergenic
915952489 1:160198759-160198781 GAGGGAAGGCAGGGGGAGGTGGG + Intronic
916010342 1:160699851-160699873 AAGGGAACTCAGAGGCTGGCGGG + Intronic
916048347 1:161017641-161017663 AAGGGAACTCAGAGGCTGGCGGG + Intronic
916092149 1:161315850-161315872 AAGGGAACTCAGAGGCCGGCGGG - Intronic
916270087 1:162931509-162931531 GAGGAAACACAGAGGTAAACAGG + Intergenic
916324198 1:163538906-163538928 AAGGGAATAAAGAAGGAGGCTGG + Intergenic
917218380 1:172701705-172701727 GTGGGAACACAGAGGGAAAATGG + Intergenic
917483451 1:175433120-175433142 GAGAGAAGACAGAAGGAGCCTGG + Intronic
917723821 1:177811498-177811520 GAGGGAACACAGAGGACCCCAGG + Intergenic
918187138 1:182137980-182138002 TAGGGCACAGAGAGGGTGGCAGG - Intergenic
918735755 1:188061020-188061042 GAGGGAAGAGAGAGGGAAGACGG - Intergenic
919727848 1:200895410-200895432 GAAGGGGCACAGAGGGAGGGAGG - Intronic
920116364 1:203624502-203624524 GAGGGAAGAGGGAGGGAGGAAGG + Intergenic
920350127 1:205332383-205332405 GAGGGCACACAGAAGGACCCAGG - Intergenic
920780904 1:208990181-208990203 GAGGGGAAACAGAGGGAGAGGGG + Intergenic
920796451 1:209142008-209142030 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
921379066 1:214505290-214505312 AAGGGAACACCCAGGGAAGCAGG + Intronic
922178866 1:223217991-223218013 GAGGCAAGAGAGAGGGAGGGAGG - Intergenic
922305475 1:224340633-224340655 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
922715460 1:227868483-227868505 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
923048465 1:230372887-230372909 GACGCACCACAGAGGAAGGCTGG - Intronic
923315118 1:232772970-232772992 GAGGGGACACAGTGGGAAGTCGG - Intergenic
923348364 1:233079751-233079773 CAGCGAACACAAAGGAAGGCTGG - Intronic
923620843 1:235577854-235577876 GAGGAAGGAAAGAGGGAGGCTGG - Intronic
924049052 1:240061931-240061953 GAGGGAATAGGGAGGGAAGCTGG - Intronic
924199930 1:241648063-241648085 CAGGGGACAAAGAGGTAGGCAGG - Intronic
924710103 1:246524297-246524319 TCTGGAACACAGAGGCAGGCTGG + Intergenic
924764110 1:247015926-247015948 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1063502719 10:6569658-6569680 GAGGGAACACAGAGGAATTGGGG + Intronic
1063531191 10:6832817-6832839 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1063649252 10:7917229-7917251 GAGGGAAAAGAGAGCGAGGATGG + Intronic
1063735284 10:8746748-8746770 GAGAAGACAGAGAGGGAGGCTGG + Intergenic
1063941557 10:11135120-11135142 GAGGAAAAACACAGGGAGTCGGG - Intronic
1064086058 10:12347805-12347827 AAGGAAACACAGTGGGAGGAAGG + Intergenic
1064346863 10:14540527-14540549 GGGGGAGGACAGAGGGAGGGTGG - Intronic
1064458010 10:15506819-15506841 GGGGGGACCCAGTGGGAGGCAGG - Intergenic
1065376202 10:25044950-25044972 GAGGCATCAGAGAGGGAGTCAGG - Intronic
1065553807 10:26894272-26894294 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1065638289 10:27753194-27753216 GAGGGAAAAGAGAGGGAGAAAGG - Intergenic
1065638307 10:27753272-27753294 GAGGGAAAAGAGAGGGAGAAAGG - Intergenic
1065638317 10:27753311-27753333 GAGGGAAAAGAGAGAGAGGAAGG - Intergenic
1065723112 10:28644738-28644760 GAGGGAACGCAGAGGGAATTGGG + Intergenic
1066927325 10:41713988-41714010 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1067101502 10:43338005-43338027 AAGGGAACGCAGAGGCTGGCGGG + Intergenic
1067292883 10:44957432-44957454 GAGGAAAGAGAGAGGGAGGGAGG - Intergenic
1067460406 10:46454056-46454078 AAGGGAAGAGAGAGGGAGGATGG + Intergenic
1067626786 10:47930547-47930569 AAGGGAAGAGAGAGGGAGGATGG - Intergenic
1068092917 10:52454996-52455018 GAGGGGGCACAGAGGGAGCAAGG - Intergenic
1068830720 10:61491584-61491606 GAGGGAAGAGGGAGGGAGGAAGG + Intergenic
1068850354 10:61731749-61731771 GAGGGAGGACAGAGGGAGGAAGG + Intronic
1068876462 10:62001665-62001687 AAGGGAAGACAGAGAGAGGAAGG + Intronic
1069184772 10:65409373-65409395 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1069452146 10:68526471-68526493 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1069772011 10:70906097-70906119 GTGGGAGCACAGAGAGAGGAGGG + Intergenic
1069887976 10:71635896-71635918 GTGGGGACACAGTGGGAAGCAGG - Intronic
1070872772 10:79772182-79772204 GAGGAAAGAAACAGGGAGGCAGG + Intergenic
1071249025 10:83796938-83796960 GAGGGGACAGGGAGGGAGGAGGG + Intergenic
1071268965 10:83989755-83989777 GAGGGAAGAAAGAGGAAGGAAGG + Intergenic
1071302641 10:84267951-84267973 TAGGGAACAGATAGGGAAGCTGG + Intergenic
1071639696 10:87294331-87294353 GAGGAAAGAAACAGGGAGGCAGG + Intergenic
1071655538 10:87443621-87443643 GAGGAAAGAAACAGGGAGGCAGG - Intergenic
1072669214 10:97416981-97417003 AAGGGAACTCAGAGGCCGGCGGG - Intronic
1072719748 10:97773086-97773108 TAGGGAACACAGTGGGAAGAGGG + Intergenic
1072947232 10:99820955-99820977 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1073137790 10:101229367-101229389 GAGAGAAGAGAGAGGGAGGGAGG - Exonic
1073269049 10:102245933-102245955 GAGGGAACAGGGAGGTATGCAGG + Intronic
1073286421 10:102392240-102392262 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1074532067 10:114305009-114305031 GAGGGCACACAGATGCAGGAGGG + Intronic
1074532224 10:114305549-114305571 GAGGGGACACAGATGCAGGAGGG + Intronic
1074545515 10:114399314-114399336 GAGGGTACACAGTGGGAGTCAGG + Intronic
1074777361 10:116776007-116776029 GAGGGGACGCAGAGGATGGCAGG - Intergenic
1075335291 10:121604509-121604531 CAGGGCACACAGAGGGATGATGG + Intergenic
1075344213 10:121670414-121670436 GAGGGAGGACAGTGGGAGGATGG + Intergenic
1076459300 10:130628754-130628776 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1076660566 10:132053450-132053472 GATGGAACACAGGTGCAGGCTGG + Intergenic
1076764872 10:132627541-132627563 CTGGGGACACAGAGGGAGTCGGG - Intronic
1076804277 10:132847380-132847402 GAGGGCCCACCCAGGGAGGCCGG + Intronic
1077428395 11:2499017-2499039 GAGGGCACACAGAAGCAGGTGGG - Intronic
1078098326 11:8313742-8313764 GAGGGCACCCAGAGGGAAGGTGG + Intergenic
1078327345 11:10391452-10391474 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1078742763 11:14082654-14082676 GAGTGAACACTCAGGGAGACTGG + Intronic
1079106832 11:17577293-17577315 GTGGGGTCACAGAGGTAGGCAGG + Intronic
1079770040 11:24446887-24446909 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1080000771 11:27346457-27346479 GAGGGAAGACAGAGGAAAGAAGG + Intronic
1080050224 11:27851919-27851941 GAGGGAAGAAAGAGGGAGGGAGG - Intergenic
1080407643 11:31994144-31994166 GAGGAAACAGAGAGCGGGGCAGG + Intronic
1080557401 11:33430079-33430101 GAGGGAGGAGAGAGGGAGGGAGG - Intergenic
1080878935 11:36301322-36301344 GAGGGAACTCTGAGGCAGGACGG + Intronic
1081289391 11:41305948-41305970 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1081489811 11:43558551-43558573 GGTGGAACACAGGGGGAGGAGGG + Intronic
1081703701 11:45168161-45168183 GATGGAACAGCGAGGGAGGGAGG + Intronic
1081857538 11:46313076-46313098 ATGGGAACACAGAGAGGGGCAGG - Intronic
1081946835 11:47003357-47003379 GAGGGGACAGAGAGGAAGGAAGG + Intronic
1082071559 11:47943728-47943750 GGGGGAAGACAGAGAGAGGGAGG + Intergenic
1082649831 11:55776128-55776150 CAGGGTAAACAGAGGGAAGCAGG + Intergenic
1082766427 11:57171816-57171838 GAGGGTACAGAGAGGGTGACCGG - Intergenic
1082820697 11:57542874-57542896 GTGGAATCTCAGAGGGAGGCTGG + Exonic
1083263670 11:61536446-61536468 GAAGGCACACAGGGGGTGGCTGG - Intronic
1083285342 11:61655156-61655178 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1083372854 11:62195463-62195485 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1083467539 11:62858659-62858681 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1083543058 11:63528114-63528136 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1083631768 11:64099115-64099137 GTGGCAATCCAGAGGGAGGCAGG - Intronic
1083742508 11:64718334-64718356 GAGGAGAGCCAGAGGGAGGCCGG - Intronic
1083757097 11:64797479-64797501 GGTGCCACACAGAGGGAGGCTGG - Exonic
1083851905 11:65372952-65372974 AAGGGATCACAGAGGAAAGCTGG + Intergenic
1083904356 11:65660413-65660435 CAGGGAGCCCACAGGGAGGCTGG - Intronic
1084012998 11:66363075-66363097 GAGGGTTCAGAGTGGGAGGCGGG - Exonic
1084190417 11:67496121-67496143 GAGGGCACACACAGGAAGGGAGG - Intronic
1084207347 11:67603497-67603519 AAGGGAACTCAGAGGCTGGCGGG - Exonic
1084247335 11:67868107-67868129 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1084286198 11:68132608-68132630 GAAGGAAGACAGAGAGAAGCTGG + Intergenic
1084357886 11:68651721-68651743 CAGGGACCGCAGAGGGAGGGAGG + Intergenic
1084416231 11:69034315-69034337 GTGGGTACAGACAGGGAGGCAGG - Intergenic
1084642118 11:70432220-70432242 GAGGGACTAGAGGGGGAGGCCGG - Intronic
1084880154 11:72165176-72165198 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1084894939 11:72259278-72259300 TAAGGAATACAAAGGGAGGCAGG - Intergenic
1085391697 11:76185470-76185492 GAAGGAACAGCCAGGGAGGCAGG - Intergenic
1085681185 11:78576647-78576669 GAAGGAAGAGAGAGGGAGGGGGG - Intergenic
1085754047 11:79189323-79189345 GTGGGAACACAGAGAGATGGTGG - Intronic
1085796891 11:79549959-79549981 GAGTGGACAGAGAGGCAGGCAGG - Intergenic
1087684367 11:101246398-101246420 GAGAGAAGAGAGAGAGAGGCAGG + Intergenic
1087723787 11:101695865-101695887 AAGGGAACTCAGAGGCTGGCAGG + Intronic
1087724719 11:101704363-101704385 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1088250425 11:107857208-107857230 GAAGGAACAAAGAAGGAGGGAGG + Intronic
1088582660 11:111330832-111330854 GAGACAACACAGAGGAATGCAGG + Intergenic
1089333707 11:117708082-117708104 TAGGGCACAGAGAGGGAGGCAGG - Intronic
1089471156 11:118721158-118721180 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1089472051 11:118729350-118729372 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1089516999 11:119039412-119039434 AAGGGAACTCAGAGGCCGGCGGG - Intergenic
1089755040 11:120680328-120680350 TAGGGAGCACTTAGGGAGGCCGG - Intronic
1089768219 11:120783991-120784013 GAGGGGACAGGGAGCGAGGCAGG + Intronic
1090085035 11:123642976-123642998 GAGGGAGAACAAAGGCAGGCGGG + Intronic
1090198768 11:124839399-124839421 GAGGGAACACGAAGCGCGGCCGG + Intergenic
1090229722 11:125092815-125092837 GATGAATCACAGAGGGAGGCAGG + Intergenic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090462697 11:126906122-126906144 GAGGGAATTCAGAGAGGGGCAGG - Intronic
1090465230 11:126927672-126927694 GGTGGAAGACAGAGGGAGGAGGG - Intronic
1090579995 11:128148986-128149008 GTGGGGACAGTGAGGGAGGCTGG + Intergenic
1091250740 11:134141756-134141778 CAAGGGGCACAGAGGGAGGCAGG + Intronic
1091347860 11:134867242-134867264 GAGGGGACTGAGAGGAAGGCTGG + Intergenic
1091366096 11:135021977-135021999 TAGTGAACAAGGAGGGAGGCAGG + Intergenic
1091534362 12:1391591-1391613 CAGGGAAAGCCGAGGGAGGCAGG - Intronic
1091551210 12:1536213-1536235 AAGGGAAGGAAGAGGGAGGCAGG + Intronic
1091686691 12:2567506-2567528 GAGGAGGCAGAGAGGGAGGCAGG - Intronic
1091760865 12:3086387-3086409 GAGAGAAAACAGAGGGCGGAAGG - Intronic
1091831820 12:3555491-3555513 CAGGGATCAGAGAGGGAGGAGGG + Intronic
1091849460 12:3683516-3683538 GAGTGAAGAAAGAGTGAGGCTGG - Intronic
1091860351 12:3776026-3776048 GAGGGCCCACAGAGACAGGCTGG + Intergenic
1091963811 12:4721375-4721397 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1092142198 12:6191465-6191487 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1092249629 12:6885997-6886019 AAGGGAACTCAGAGGCTGGCAGG - Intronic
1092281473 12:7101114-7101136 GAGGGAAGAAGGAGGGAGGGAGG - Intronic
1092290493 12:7157244-7157266 GAACAAACACAGAGGGAGGCAGG - Intronic
1092437588 12:8462734-8462756 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1092559888 12:9601267-9601289 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1092663019 12:10759481-10759503 GAGGGAACAGAAAGGGAGGTGGG + Intergenic
1093117053 12:15223718-15223740 GATGTAACACAGTGGGAGTCAGG - Intronic
1093294524 12:17371838-17371860 GAGGAAAGAAAGAGGGAGGGAGG - Intergenic
1093439387 12:19176208-19176230 GGAGGAAGACAGAGGGAGGGAGG - Intronic
1093691646 12:22115877-22115899 GAGAGAACACATAGATAGGCAGG + Intronic
1094389299 12:29932197-29932219 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1094623274 12:32100313-32100335 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1096113464 12:49041867-49041889 GTGGGAACTGAGAGGGAGGGAGG - Intronic
1096127138 12:49128221-49128243 CAGGCACCACAGTGGGAGGCTGG + Exonic
1096134090 12:49185273-49185295 CAGGCACCACAGTGGGAGGCTGG + Exonic
1096145049 12:49272948-49272970 CAGGCACCACAGTGGGAGGCTGG - Exonic
1096420630 12:51454430-51454452 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1096558012 12:52415644-52415666 GGAGGAACAGAGAGGGAGGGTGG - Intergenic
1096601217 12:52731064-52731086 TAGGGAACACAGGGAGAGGATGG + Intergenic
1096672650 12:53209433-53209455 GTGGGAACAGAGAGGGTGGGGGG + Intergenic
1096863814 12:54549533-54549555 GAGGGAGAGCAGAGGGAGGGGGG + Exonic
1096940110 12:55334233-55334255 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1097076739 12:56400504-56400526 AAGGGAACTCAGAGGCTGGCAGG - Intergenic
1097262472 12:57727329-57727351 GAGGGAACAGAGCGGGGGGAGGG - Intronic
1097270777 12:57772591-57772613 GAGGGCAAACTCAGGGAGGCGGG + Exonic
1097330460 12:58327602-58327624 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1097331396 12:58336091-58336113 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1098162068 12:67655378-67655400 GAGGGTGCAGAGAGCGAGGCTGG + Intronic
1098632499 12:72741026-72741048 TAGTGAACAAAGAGGGAGGGTGG - Intergenic
1098971887 12:76865937-76865959 ATGGGGACACAAAGGGAGGCTGG + Intronic
1099014137 12:77324981-77325003 GAGGGAAGAAAGAGCGAGCCGGG + Intergenic
1099924156 12:88997016-88997038 AAGGGAAAAGAGAGGGAGGGTGG + Intergenic
1100276359 12:93075204-93075226 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1100289497 12:93200363-93200385 GAGGGAAGGGAGAGTGAGGCAGG + Intergenic
1100370792 12:93967011-93967033 GAGGGAGTATAGAGGGAGGGAGG - Intergenic
1100569886 12:95837519-95837541 GAGGGAGGAGAGAGGGAGGGAGG + Intergenic
1100748064 12:97667311-97667333 GAGGGAAGAGGGAGGGAGGGAGG + Intergenic
1101177877 12:102174967-102174989 GAGGGAAGAGACAGGGAGGAAGG - Intronic
1101254644 12:102965434-102965456 GAGAGAGCATAGAGAGAGGCTGG + Intergenic
1101498823 12:105281844-105281866 AAGGGAAAACAGAAGGAGCCTGG + Intronic
1101520590 12:105478702-105478724 AAGGGAACTCAGAGGCTGGCAGG - Intergenic
1101540355 12:105659499-105659521 GAGGGAACACAGGATGGGGCAGG - Intergenic
1101834887 12:108288248-108288270 GAGGAACGAGAGAGGGAGGCAGG + Exonic
1102027557 12:109722162-109722184 GAGGCAGCTCAGAGGCAGGCAGG + Intronic
1102135513 12:110570840-110570862 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1102505388 12:113381278-113381300 GAGGAAAGCAAGAGGGAGGCAGG - Intronic
1102550100 12:113685413-113685435 GTGTGAACATAGAGGGGGGCTGG + Intergenic
1102666583 12:114579298-114579320 GAGGTTTCAGAGAGGGAGGCAGG - Intergenic
1103058911 12:117843200-117843222 AAGGGAACACCGAGGGATGAAGG + Intronic
1103092428 12:118106778-118106800 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1103318765 12:120077951-120077973 GAGGGAAACCAGAGGGACGCAGG - Intronic
1103741868 12:123096566-123096588 GAAGGAAGAAAGAGGGAGGAAGG + Intronic
1103794423 12:123493678-123493700 GAGGGAACAGTGAGCTAGGCCGG - Intronic
1103882881 12:124180025-124180047 GAGGCAACTCAGAGGTTGGCAGG + Intronic
1104191073 12:126482430-126482452 GAGGGAGGAGAGAGGGAGGGAGG - Intergenic
1104737252 12:131143232-131143254 GAAGGAAGTCAGAGGGCGGCAGG - Intergenic
1104938921 12:132385731-132385753 CAGGGAAAACACAGAGAGGCTGG + Intergenic
1105651896 13:22387905-22387927 GAGAGAAGAGAGAGAGAGGCTGG - Intergenic
1105865054 13:24451691-24451713 CAGGGGCCACAGAGGCAGGCAGG + Intronic
1106777136 13:33019486-33019508 GTGGAAACACAGAGGGAGTGAGG - Intronic
1106947038 13:34840167-34840189 GAAGGGACAGGGAGGGAGGCAGG + Intergenic
1107014903 13:35700486-35700508 GAGAGAGAACAGAGGAAGGCAGG + Intergenic
1107632772 13:42359149-42359171 GAAGAAACACAAAGTGAGGCAGG - Intergenic
1107709879 13:43141223-43141245 GAGGGAACCCAAATGGAAGCAGG + Intergenic
1107711347 13:43153300-43153322 GAGGGCACACAGAGATAGGAAGG - Intergenic
1107831206 13:44374619-44374641 GAGGGAAGACAGGTGGAGTCCGG - Intronic
1107832976 13:44390736-44390758 GAGGGAAAAAAGAGAGATGCCGG - Intronic
1108323051 13:49305361-49305383 GGGGGAACAATGAGGGAGGGTGG - Intergenic
1108352487 13:49599825-49599847 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1109006603 13:56885492-56885514 CATGGAACAGAGAGGGAGGAAGG + Intergenic
1109959748 13:69615019-69615041 AAGGGAACTCAGAGGCTGGCAGG - Intergenic
1110386072 13:74912192-74912214 GAAGGAACATAGAGGGAGGTAGG + Intergenic
1110529032 13:76575089-76575111 AAGGGAACAGAAAGGGAGTCAGG - Intergenic
1110568623 13:76980432-76980454 GAGGGAAGAGAGAGGGCGCCAGG + Intergenic
1110694456 13:78471919-78471941 AAGGGAACTCACAGGGAGACAGG - Intergenic
1110977488 13:81858801-81858823 GATGGAACAGGGAGGGAAGCAGG - Intergenic
1111446196 13:88348129-88348151 GAGGGAAGAAGGAGGGAGGAAGG + Intergenic
1111924789 13:94451114-94451136 GAGGAATCAGAGAGGGTGGCTGG - Intronic
1112002881 13:95228184-95228206 GAGAAAACCCAGAGGGAGACGGG + Intronic
1112446763 13:99471581-99471603 GAGGGAAGGAAGAGGGAGGAAGG + Intergenic
1112461400 13:99606578-99606600 GGGCGAAGACAGAGCGAGGCGGG + Intergenic
1113260279 13:108553943-108553965 GAAGGAGCACAGGGGGAGACAGG - Intergenic
1113614508 13:111671085-111671107 GACGGAAGAGAGAGGGAGGGAGG - Intronic
1113619976 13:111755999-111756021 GACGGAAGAGAGAGGGAGGGAGG - Intergenic
1113656780 13:112072682-112072704 GAGGGAAGAACGGGGGAGGCGGG - Intergenic
1114170656 14:20269725-20269747 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1114438086 14:22724828-22724850 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1114525323 14:23364490-23364512 AAGAGAAGACAGAGGGAGGAGGG - Intronic
1115898589 14:38118902-38118924 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1116085294 14:40229594-40229616 GAGGGAGGAGAGAGGGAGGGAGG - Intergenic
1116133323 14:40889252-40889274 GAGGGAAGAAGGAGGGAGGGAGG + Intergenic
1117365689 14:55025338-55025360 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1117447292 14:55816333-55816355 GAGGGCTCACAGAGGGAGCTGGG - Intergenic
1118115909 14:62776384-62776406 GTGGGAACACAGTGAGAAGCTGG + Intronic
1118351978 14:64978731-64978753 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1118520540 14:66578362-66578384 GAAGGAACACAGAGAGAGAAAGG + Intronic
1118971889 14:70643751-70643773 CTGGGAAGACAGAGGTAGGCTGG - Intronic
1119826558 14:77661541-77661563 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1119847442 14:77840906-77840928 GAGGGAAGAGGGAGGGAGGGAGG + Intronic
1119854545 14:77889588-77889610 GAGGCAACACTGAGGGATACTGG - Intronic
1119920147 14:78439126-78439148 GAGGGAACACAGAGCCAGTGGGG + Intronic
1119920613 14:78442592-78442614 AAGGGAAGACAGGGAGAGGCAGG + Intronic
1120216045 14:81681703-81681725 GAGGGAAGAGAGTGGGGGGCTGG - Intergenic
1120525819 14:85575739-85575761 GAGGGAAGACAGAATGAGCCTGG + Intronic
1121445340 14:93975165-93975187 GAGGGGGCTCAGAGGGACGCAGG - Intronic
1121854253 14:97252048-97252070 AAGGGACCACAGAGAGAGGTGGG + Intergenic
1122221007 14:100239139-100239161 GAAGGAAGGCAGAGGGAGGAAGG - Exonic
1122232177 14:100311933-100311955 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1122296158 14:100706748-100706770 TCGGGCACACAGAGGGCGGCTGG + Intergenic
1122706826 14:103627119-103627141 GGGTGAACTCAGAGGCAGGCGGG - Intronic
1122724125 14:103739447-103739469 GACGGAGCAGAGAGGGAGCCAGG - Intronic
1122879584 14:104684210-104684232 GAGGCAACCGAGAAGGAGGCTGG + Intergenic
1122880501 14:104688717-104688739 GAGGGAGGGCAGAGGAAGGCAGG - Intergenic
1122917935 14:104867354-104867376 CAGGGAACACAGAGGCAGGGCGG - Intronic
1122986256 14:105212998-105213020 GAGGGACCACATGGGGAGCCCGG - Intronic
1123898931 15:24856592-24856614 GAGGGAAGACAGGGGGCGGCTGG - Intronic
1123996061 15:25718750-25718772 GAGGCAGGACAGAGGGTGGCAGG + Intronic
1124012793 15:25852206-25852228 GAGGGAGGATAGAGGGAGGATGG - Intronic
1124139793 15:27067356-27067378 GAGGGGACACAGAAGGGTGCGGG - Intronic
1124211996 15:27771075-27771097 GAGGGAGAAAAGAGGGAGGGAGG - Intronic
1124497025 15:30192926-30192948 GAGGGGAGAAAGAGGGATGCAGG + Intergenic
1124746551 15:32345721-32345743 GAGGGGAGAAAGAGGGATGCAGG - Intergenic
1125517710 15:40332001-40332023 GAGGGCACACAGGAGGAGGGAGG - Intronic
1125768481 15:42150282-42150304 GAGGGACCCAAGAGGGTGGCTGG - Intronic
1125834775 15:42739435-42739457 TAGGGAAAAAAGAGGGAGGGGGG - Exonic
1126219914 15:46200954-46200976 GTGGGAACACAGATTGATGCGGG - Intergenic
1126781214 15:52140362-52140384 GAGGGAGCACAGTGGGAGGCAGG - Intronic
1126946230 15:53823471-53823493 AAGAGAAAACAGAGGGAGGAAGG + Intergenic
1127276007 15:57444753-57444775 GTGGGAACACAGAGCCAGGATGG + Intronic
1127736144 15:61840798-61840820 AAGGGAACAGGGAGGGAGGGAGG - Intergenic
1128130949 15:65226685-65226707 AAGGGAACGCAGAGGCTGGCGGG - Intergenic
1128194017 15:65734456-65734478 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1128532615 15:68464912-68464934 GAGAGAGGCCAGAGGGAGGCTGG - Intergenic
1128634803 15:69296282-69296304 GAGGGACCACAAACGGAGGGGGG - Intergenic
1128732011 15:70027455-70027477 GAAGGATGACAGAGGGAGGCTGG + Intergenic
1128827683 15:70735193-70735215 GAGGGCAGACAGAGGGATGGGGG + Intronic
1128933951 15:71729792-71729814 GAGGCACCAGAGAGGGAGGGAGG + Intronic
1129119526 15:73387532-73387554 GAGGGAAAAAAGAGGGAGTGAGG + Intergenic
1129239591 15:74243574-74243596 GAAGGGTGACAGAGGGAGGCAGG + Intronic
1129325858 15:74800019-74800041 GAGTGAATACAGAGGGACACGGG - Intronic
1129485805 15:75870997-75871019 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1129868491 15:78926231-78926253 GAGGCAGGACTGAGGGAGGCTGG - Intronic
1130029374 15:80297777-80297799 GAGGGAAGACAGAGAGAGGGAGG + Intergenic
1130032827 15:80331984-80332006 GAGTGAACACTCAGGGAGGGCGG + Intergenic
1130096603 15:80860860-80860882 GAGGGAACACAGAAAGAGAAGGG - Intronic
1130111128 15:80966614-80966636 GAGTGGACACAGAGGCAGCCTGG - Intronic
1130148256 15:81292028-81292050 CAGGGTAGACAGAGGGAGGACGG + Intronic
1130936308 15:88473757-88473779 GAGAGCTCACAGAAGGAGGCAGG - Intronic
1130944569 15:88541354-88541376 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1131005207 15:88972176-88972198 GAAGGACCAGAGAGGGAAGCAGG + Intergenic
1131671128 15:94620532-94620554 GAGGCCAAACAGATGGAGGCAGG - Intergenic
1131793347 15:95988422-95988444 GAGGGAAGGAAGAGGGAGGGGGG + Intergenic
1132068993 15:98758797-98758819 GAGGGGACTGTGAGGGAGGCAGG + Intronic
1132435345 15:101796452-101796474 CAAAGAGCACAGAGGGAGGCTGG - Intergenic
1132440531 15:101860120-101860142 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1132546760 16:536779-536801 GACGGAACACAGGGGGACCCAGG + Intronic
1132679404 16:1133565-1133587 GAGGACAGACAGAGGGAAGCTGG - Intergenic
1132932308 16:2464890-2464912 GAGAGAAAACAGAGGGAGCCAGG - Exonic
1133224226 16:4332971-4332993 AAGGGAACACTGAGGCAGGAAGG + Intronic
1133327914 16:4953341-4953363 AATGGAACACAGCGGGAGGAGGG - Intronic
1133432941 16:5754531-5754553 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1133687362 16:8178904-8178926 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1133981983 16:10639846-10639868 GAGGGGACACAGAAGGGGACAGG - Intronic
1133985370 16:10664271-10664293 GAGGGAAGGAAGAGGGAGGGAGG + Intronic
1135023853 16:18984176-18984198 GAGGGCGCACGGAGGGAGCCGGG + Intronic
1135074720 16:19383364-19383386 GAGGGTGCACGGAGGGAGCCGGG - Intergenic
1135350666 16:21726545-21726567 AAGGGCACACACTGGGAGGCTGG - Exonic
1135542606 16:23343521-23343543 GAAGGAAGAAAGAGGGAGGGAGG + Intronic
1135577919 16:23600278-23600300 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1135894440 16:26386138-26386160 CAGGGAAAGCAGAGTGAGGCTGG - Intergenic
1135973874 16:27092797-27092819 CAGGTAACCCAGAGGAAGGCAGG + Intergenic
1136612046 16:31372202-31372224 GAGAGAACAGAGAGGGTGTCAGG + Intronic
1136930307 16:34412200-34412222 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1136974267 16:34999606-34999628 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1137366653 16:47865261-47865283 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1137552177 16:49445266-49445288 GAGGGAAAAAAGAGGGAGAGAGG - Intergenic
1137616331 16:49849670-49849692 GGAGGTAAACAGAGGGAGGCAGG + Intronic
1137977260 16:53042295-53042317 GAGGGGAGACGGAGGGAGGAAGG - Intergenic
1138130622 16:54476602-54476624 GAGGGGAGACAGAGGGAGGGGGG + Intergenic
1138225717 16:55292605-55292627 GATAGACCAGAGAGGGAGGCAGG + Intergenic
1138445261 16:57059374-57059396 CAGGGCACAGAGAGGGAAGCGGG - Intronic
1138452773 16:57103654-57103676 GAGGGGACAGTGAGAGAGGCAGG - Intronic
1138548062 16:57731091-57731113 GAGAGAACCCACTGGGAGGCTGG + Intronic
1138600151 16:58049246-58049268 GAGGAACCACACAGGGAGGTAGG + Intergenic
1139391301 16:66607665-66607687 GAGGGAAATCAAAGCGAGGCAGG - Intronic
1139476045 16:67203044-67203066 GAGGGCAGGCAGAGGGCGGCTGG + Intronic
1139760378 16:69180186-69180208 GAGGGAAGAGAGAGGAAGGGAGG - Intronic
1139923680 16:70474406-70474428 GAGGAAACCCAGAGAGAGGTGGG + Intronic
1139967446 16:70753688-70753710 GAGGGACGACTGAGGAAGGCCGG + Intronic
1140257516 16:73349758-73349780 GAGGGAAAAAAGAGGGAGGAAGG - Intergenic
1140418827 16:74799536-74799558 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1140967696 16:79983111-79983133 GAGGGAAGAGAGAGGGAGGAAGG - Intergenic
1141798953 16:86294400-86294422 AGGAGCACACAGAGGGAGGCTGG + Intergenic
1142222630 16:88863177-88863199 GACGGGACACAGAAGGCGGCTGG - Intergenic
1142251370 16:88993562-88993584 GAGGGAAGAGGGAGGGAGGAAGG - Intergenic
1142251404 16:88993652-88993674 GAGGGAAGAGGGAGGGAGGAGGG - Intergenic
1142280921 16:89147167-89147189 GAGGGTCCACAGAGGGAGGGAGG + Intronic
1142281030 16:89147536-89147558 GAGGGGCCACAGAGCGAGGAGGG + Intronic
1142282673 16:89156737-89156759 GAGGGAAGGCAGAGGGCGGCAGG - Intergenic
1142317191 16:89355215-89355237 GAGGGCTCACGGAGGGAGGGCGG + Intronic
1142342454 16:89532438-89532460 GAGGGGACACAGAGAGAATCAGG - Intronic
1142597653 17:1037331-1037353 GAGGTCAGGCAGAGGGAGGCTGG - Intronic
1143021336 17:3918356-3918378 GAGGGAGGAGAGAGGGAGGGAGG + Intergenic
1143195709 17:5074823-5074845 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1143273010 17:5689428-5689450 GTGGGAACACAGAGAGGGGGTGG + Intergenic
1143368378 17:6422983-6423005 GGTGGAACAGGGAGGGAGGCTGG - Intronic
1143378191 17:6479550-6479572 GAAGGACCATACAGGGAGGCTGG + Intronic
1143989176 17:10942188-10942210 GGGGGAAGAGAGAGGGAGGTGGG + Intergenic
1144190748 17:12843240-12843262 GGGGAGAAACAGAGGGAGGCAGG - Intronic
1144274857 17:13656463-13656485 GTGGGGACACAGAGGGAAGGGGG + Intergenic
1144580554 17:16456633-16456655 GAGGGAACACAGAGGGAGGCAGG + Intronic
1144745441 17:17611071-17611093 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1145030983 17:19505101-19505123 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1145269083 17:21394911-21394933 GAGGGACCCCTGAGGGTGGCAGG + Intronic
1146181365 17:30700184-30700206 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1146442754 17:32911330-32911352 GAGAGAACACAGAAAGAGGTGGG + Intergenic
1146515997 17:33489750-33489772 GAGTGAACACTCAGGAAGGCTGG - Intronic
1146682409 17:34817599-34817621 GAGGGAACAAAGAGGAATGGAGG + Intergenic
1146689729 17:34865135-34865157 GAGTGATCGCAGAGGGAGGATGG - Intergenic
1146804973 17:35857820-35857842 AAGGGAACATAGAGGAAGGTAGG + Intronic
1146821436 17:35986114-35986136 GAGGGAGTAGAGAGGCAGGCTGG + Intronic
1146839540 17:36140859-36140881 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1147418665 17:40311223-40311245 GAGGGAAGCCAGTGGGAGGATGG + Intronic
1147459060 17:40557062-40557084 GCGGGAGCACAGAGGGAGAGTGG - Intronic
1147575116 17:41594545-41594567 AAGGAAGCACAGAGGGAGGGAGG + Intergenic
1147575128 17:41594593-41594615 GAAGGAGGACAGAGGGAGGGAGG + Intergenic
1147844263 17:43393850-43393872 CAGGGAACACTGAGGCAGGCAGG - Intergenic
1147845950 17:43403971-43403993 GAGGGAAGAGGGAGGGAGGGGGG - Intergenic
1148467559 17:47874005-47874027 GAGGGAAGAAGGAGGGAGGAAGG - Intergenic
1148576492 17:48715251-48715273 GAGGGAACACACAGGGATAGAGG + Intergenic
1148733191 17:49850348-49850370 GGGGGAGCTCAGTGGGAGGCTGG - Intergenic
1148954791 17:51344770-51344792 GAGGGAACACAGGACGAGACAGG + Intergenic
1148960081 17:51385405-51385427 GAGGGGACAGAAAGGGATGCGGG - Intergenic
1148982082 17:51585851-51585873 GAAGGTACCCAGTGGGAGGCTGG - Intergenic
1149202419 17:54202376-54202398 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1149393255 17:56213521-56213543 CAAGGAAAACAGAGGGAGGCAGG + Intronic
1150645689 17:66976317-66976339 GAGGAAAGACAGAGGGAGGAGGG - Intronic
1151732582 17:75920205-75920227 GAGGGGACACTGAGAGTGGCTGG - Intronic
1152372085 17:79894993-79895015 GAAGGAAGAAAGAGGGAGGAAGG - Intergenic
1152373157 17:79903108-79903130 GAGGGAAGAAAGAGAGAGGGAGG - Intergenic
1152551652 17:81033375-81033397 CAGGGAACACAGCAGGAAGCTGG + Intergenic
1152573408 17:81130212-81130234 CTGGGAACACAGAGGCAGGAGGG - Intronic
1152869521 17:82744673-82744695 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1153422027 18:4917422-4917444 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1153932203 18:9887857-9887879 GAGGCATCACTGAAGGAGGCCGG + Exonic
1153969230 18:10210167-10210189 AGGGGAACACAGAGGCAGACAGG + Intergenic
1155483616 18:26316791-26316813 GAAGGAACACAGGGAGAGGGAGG - Intronic
1156294446 18:35777159-35777181 GAGGGGACATAAATGGAGGCTGG - Intergenic
1156908683 18:42385064-42385086 GAGGGAAGAAAGAGGAAGGAAGG - Intergenic
1157241023 18:46009524-46009546 AAGGGAACTTAGAGGGTGGCAGG + Intronic
1157569901 18:48705348-48705370 GAGGAGACACAGAGGGATGAAGG - Intronic
1157619667 18:49008999-49009021 GAAGGGCCACAGAGGGAGACAGG + Intergenic
1157636987 18:49168511-49168533 TAGGGTACACAGATGGTGGCAGG + Intronic
1157830700 18:50854645-50854667 GAGGGAGCAGAGGGGGAGGCTGG + Intergenic
1158440578 18:57471130-57471152 GAGGGGATGCAAAGGGAGGCGGG - Intronic
1158544823 18:58387040-58387062 GAAGAAACACAGAGGGAGGCAGG - Intronic
1159484866 18:69042995-69043017 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1159604594 18:70461915-70461937 GACGCAACACAGAGTCAGGCAGG - Intergenic
1160413265 18:78688887-78688909 GGGGGTAAACAGGGGGAGGCCGG + Intergenic
1160675241 19:387472-387494 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1160854393 19:1209855-1209877 GAGGGAACACGGAGGCAGGGAGG + Intronic
1161073714 19:2275039-2275061 GGAGGAACAGGGAGGGAGGCAGG + Exonic
1161195093 19:2982239-2982261 GAGAAAGCACAGAGGGGGGCCGG + Intronic
1161458413 19:4381575-4381597 CAGGGTAGACAGAGAGAGGCAGG - Intronic
1161545583 19:4878312-4878334 CAGGGAACAAAGAGGCAGCCGGG - Intergenic
1161756619 19:6138587-6138609 GAGGGAAGAGAGAGGGAGGAAGG + Intronic
1161899874 19:7110403-7110425 GAGGGAAAAGAGATGAAGGCAGG - Intergenic
1162078596 19:8205483-8205505 GAAAGAACAGAGTGGGAGGCTGG - Intronic
1162105583 19:8367679-8367701 GAGGAAAGAAAGAGGGAGGGAGG - Intronic
1162395884 19:10417876-10417898 GAGGGAGCAGAGTGGGAGGTGGG + Intronic
1162515567 19:11145374-11145396 GAGGGAGGAGAGAGGGAGGTTGG - Intronic
1162569266 19:11461523-11461545 GAGGGAGGAAAGAGGGAGGGAGG - Intronic
1162668078 19:12231972-12231994 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1162909805 19:13842738-13842760 GAGGGACCCAGGAGGGAGGCCGG - Intergenic
1163004756 19:14390120-14390142 GAGGGAAAGAAGAGGGAGGGAGG + Intronic
1163161469 19:15467144-15467166 GAGGTCACACAGAGGGAGAGGGG - Intergenic
1163548541 19:17952680-17952702 GAGGGGACAGAGAGGGAGGAGGG - Intronic
1163668084 19:18612443-18612465 CAGGGAACGGAGAGGGAGGAAGG - Intronic
1164122908 19:22284338-22284360 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1164153740 19:22575740-22575762 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1164370294 19:27637733-27637755 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1164411437 19:28009183-28009205 AGGGGAGCAAAGAGGGAGGCTGG + Intergenic
1164493513 19:28736208-28736230 GATGAGACACAGAGGGAGACAGG + Intergenic
1164516427 19:28940365-28940387 AGGGGAGCAAAGAGGGAGGCTGG + Intergenic
1164554637 19:29241801-29241823 GGGGGAAGAAAGAAGGAGGCTGG - Intergenic
1164581770 19:29439193-29439215 GAGGGGGGAGAGAGGGAGGCAGG + Intergenic
1164639235 19:29812305-29812327 GAGGGGACACTGAGGCAGCCCGG + Intronic
1164648648 19:29876377-29876399 CAGGAGACACAGAAGGAGGCTGG - Intergenic
1164744140 19:30599060-30599082 GAGGAAACAGGGAGGGAGGGAGG - Intronic
1164744217 19:30599332-30599354 GAGGGATCAGGGAGGGAGGAAGG - Intronic
1164811232 19:31157923-31157945 GAGTGACCACAGGGTGAGGCAGG - Intergenic
1164936819 19:32221155-32221177 GCTGGAAGACAGAGAGAGGCCGG - Intergenic
1165084926 19:33337911-33337933 GAGGAAAGAGAGAAGGAGGCCGG + Intergenic
1165177652 19:33941854-33941876 GAGAGAACACAGAGAGAGCAAGG - Intergenic
1165333125 19:35152388-35152410 GAGGGAGCACTGAGGAAGACGGG + Intronic
1165595156 19:37006961-37006983 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1165634871 19:37332207-37332229 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1165655643 19:37529946-37529968 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1165691470 19:37866979-37867001 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1165832690 19:38737106-38737128 GAGGGAACCCGGAGGGTGGAGGG - Intronic
1165940023 19:39410281-39410303 GAGGGAAGTGAGAGGGAGGAGGG - Intergenic
1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG + Intronic
1166179072 19:41094477-41094499 CTGGGGACACAGAGAGAGGCTGG - Intronic
1166251790 19:41576372-41576394 GAGGGAGCACAGAGACTGGCTGG + Intronic
1166255271 19:41599831-41599853 GAGGGAGCACAGAGACTGGCTGG + Intronic
1166281431 19:41796774-41796796 GAGGGATCACAGAGAATGGCTGG + Intronic
1166653706 19:44594898-44594920 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1166707188 19:44914588-44914610 GTGGGTGGACAGAGGGAGGCAGG + Intronic
1166750361 19:45161595-45161617 CAGGGCACACAGAGGCAGGGCGG + Intronic
1166914109 19:46182859-46182881 GAGAGATGACAGAGAGAGGCAGG - Intergenic
1167103211 19:47416707-47416729 GAGGGAAGAGAGAGGCCGGCAGG + Intronic
1167119054 19:47505917-47505939 GAGGGAAGACAGAGTGCAGCAGG - Intronic
1167123390 19:47532468-47532490 GAAGGAAAACAGAGGAAGGGAGG - Intronic
1167336641 19:48890438-48890460 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1167578096 19:50327376-50327398 GAGTGAACACAGAGGGGGCCTGG + Intronic
1167685702 19:50954685-50954707 GAGAGAACACACAGAGAGCCTGG - Intergenic
1167818899 19:51908334-51908356 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1167833188 19:52043935-52043957 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1167876856 19:52421100-52421122 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1167910455 19:52697883-52697905 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1168296528 19:55379728-55379750 CAGTGAAGACAGAAGGAGGCCGG + Intronic
1168344770 19:55644776-55644798 GAGGAGTCACAGAGGGAGCCAGG + Exonic
925427586 2:3763209-3763231 GAGGGATCTCAGAGCCAGGCTGG - Intronic
925800482 2:7594431-7594453 GAGGGGAGACAGTGGGAGCCAGG - Intergenic
926405661 2:12549843-12549865 GAGTCAACACAGTGGGTGGCAGG - Intergenic
927128520 2:20036226-20036248 GCTGGCACACAGAGGGAGGGTGG - Intronic
927149824 2:20189120-20189142 CAGGTTACACAGTGGGAGGCAGG + Intergenic
927415235 2:22872431-22872453 GGGGGAACCTAGAGAGAGGCAGG + Intergenic
927436632 2:23072104-23072126 GAGCGTAGGCAGAGGGAGGCTGG - Intergenic
927464746 2:23328747-23328769 CAGTGAAACCAGAGGGAGGCAGG - Intergenic
927553530 2:24017776-24017798 GAAGGAACCCAGAAGGAGGCAGG - Intronic
927886483 2:26721637-26721659 GAGGGCCCTCAGAGGAAGGCTGG - Intronic
927992901 2:27460781-27460803 AAGGGAACTCAGAGGCTGGCGGG + Intronic
928118219 2:28563354-28563376 GAGGGACCCCAGAGGGAGTGTGG + Intronic
928365875 2:30702092-30702114 GAAGGAAGAGAAAGGGAGGCAGG - Intergenic
928539961 2:32275725-32275747 AAGGGAACTCAGAGGCTGGCAGG - Intergenic
928990299 2:37226120-37226142 AAGGGAACTCAGAGGCTGGCGGG + Intronic
929208169 2:39321964-39321986 AAGGGAACTCAGAGGCTGGCGGG + Intronic
929410644 2:41694725-41694747 AAGGAAACGCAGAGGGGGGCTGG + Intergenic
929861260 2:45679790-45679812 GAGGGAACACAGAAGAAGGAAGG - Intronic
929942862 2:46348068-46348090 GAGGGAATCCAGTGTGAGGCTGG + Intronic
930105551 2:47636330-47636352 GAGGGAGCACAGAGAGAGACGGG - Intergenic
930519342 2:52444407-52444429 GTGGGAACACTGAGGCAGGAGGG - Intergenic
930606570 2:53499199-53499221 CGGGGAAAAGAGAGGGAGGCAGG + Intergenic
930697972 2:54430960-54430982 GAGGGAACACCGTGGGAAGGAGG - Intergenic
931419884 2:62117083-62117105 GTGGGGGCAAAGAGGGAGGCAGG - Intronic
931459058 2:62434408-62434430 GAGGCAACATTGTGGGAGGCTGG - Intergenic
931464373 2:62473794-62473816 AAGGGATCACAGAGGGATGCTGG + Intergenic
931616644 2:64165900-64165922 TAGTGAACACTGAGGGAGGTAGG - Intergenic
932661087 2:73652584-73652606 GAGGGAAGAGAGCGTGAGGCAGG - Intergenic
932963847 2:76447191-76447213 TAAGGAAGACAGAGGGAAGCAGG - Intergenic
933570885 2:84010251-84010273 GAAGGAGGAGAGAGGGAGGCAGG + Intergenic
934050735 2:88208563-88208585 GAAGGAAGAGAGAGTGAGGCAGG + Intergenic
934138590 2:89022044-89022066 GAGGGGAGACAAAGGGAGGAAGG - Intergenic
934144686 2:89080114-89080136 GAAGGAACACAAAGGGAGAAAGG - Intergenic
934150121 2:89138434-89138456 GAGGATAGACAGAGTGAGGCTGG - Intergenic
934217175 2:90043595-90043617 GAGGATAGACAGAGTGAGGCTGG + Intergenic
934224569 2:90120437-90120459 GAAGGAACACAAAGGGAGAAAGG + Intergenic
934230655 2:90178519-90178541 GAGGGGAGACAAAGGGAGGAAGG + Intergenic
934972221 2:98772976-98772998 GAGAGAGCTCAAAGGGAGGCAGG - Intergenic
935337372 2:102029192-102029214 GAGGGGACAGAGAGGAAGGAAGG - Intergenic
935358456 2:102226694-102226716 GAGGGAAAACGGAGGGAAGAAGG + Intronic
935858915 2:107305723-107305745 GAGGGAACAGAGATGCTGGCAGG + Intergenic
936060577 2:109293234-109293256 GAGGGAGGACAGAGGGATGGTGG + Intronic
936378455 2:111962986-111963008 AAGGGAACTCAGAGGCCGGCAGG - Intronic
936462263 2:112722336-112722358 GGGGGAGGACAGAGGGAGGGAGG + Intronic
936487067 2:112935056-112935078 AAGGGAACTCAGAGGCCGGCGGG + Intergenic
937122409 2:119449989-119450011 GAAGGAAGAAAGAGGGAGGGAGG + Intronic
937433229 2:121858525-121858547 GAAGGAACACACAGGGTTGCAGG - Intergenic
937854301 2:126661312-126661334 CAGGGACCACAGAGCCAGGCAGG - Intronic
938042780 2:128090134-128090156 AATGGAACACTGATGGAGGCCGG - Intergenic
938081187 2:128371034-128371056 GAGGGACCAGAGAAGGAGGACGG - Intergenic
938261148 2:129895891-129895913 CAGGGCACACAGAGGAAGGAAGG + Intergenic
938270048 2:129962108-129962130 AAGGGAACTCAGAGGCTGGCAGG - Intergenic
938727498 2:134120790-134120812 GAAGGAAGAAGGAGGGAGGCTGG + Intronic
939114070 2:138040552-138040574 GAGGGAACACAAAGGGAACCTGG + Intergenic
939223858 2:139339874-139339896 GAGGGGACAGAGAGAGAGGAGGG + Intergenic
939252913 2:139706036-139706058 GTTGGTGCACAGAGGGAGGCAGG + Intergenic
939356868 2:141114147-141114169 GAGGGGGCACACAGGCAGGCAGG + Intronic
939696915 2:145337648-145337670 GAGGGAAAACAGAGGGGACCTGG - Intergenic
939983763 2:148811122-148811144 CAGGGAACCCAGAGGATGGCAGG - Intergenic
940029334 2:149244313-149244335 AAGGGAAGAAAGAGGGAGGAGGG - Intergenic
941575977 2:167230814-167230836 GAGGGAGCACTGAAGGAGACAGG - Intronic
941724457 2:168845967-168845989 GAGAGAACTCAGAGGAAGGTGGG - Intronic
942450092 2:176103923-176103945 TTGGGAACTCAGAGGGCGGCGGG + Intergenic
942965853 2:181891901-181891923 GAGGGGACAGGGAGGGAGGGAGG - Exonic
942997009 2:182275138-182275160 GAGGGTCAAAAGAGGGAGGCAGG + Intronic
943838163 2:192542085-192542107 AAGGGAACTCAGAGGCCGGCAGG - Intergenic
944483639 2:200181344-200181366 GAGGGAAAATAGAAGCAGGCAGG - Intergenic
945175275 2:207037628-207037650 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
945483059 2:210364715-210364737 GGTGAATCACAGAGGGAGGCTGG + Intergenic
945832454 2:214803687-214803709 AAGGGAACTCAGAGGCTGGCGGG + Intronic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
946074790 2:217064855-217064877 GAGGGAACAGAGTGGGTGGGGGG - Intergenic
946307892 2:218866245-218866267 GTGGGGAAATAGAGGGAGGCTGG + Intronic
946366202 2:219250606-219250628 CAGGCACCACAGTGGGAGGCTGG + Exonic
946369465 2:219271860-219271882 CAGGCACCACAGTGGGAGGCTGG - Intronic
946653419 2:221918731-221918753 GTGGGTAAACAGAGGAAGGCAGG - Intergenic
946780740 2:223191280-223191302 AAGGGAACTCAGAGGCTGGCGGG + Intronic
947273349 2:228363785-228363807 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
947319369 2:228898873-228898895 GAGGCAACACAGAGGAAAGAAGG - Intronic
947402882 2:229746325-229746347 GTGGGAAGGCAGAGGCAGGCTGG + Intergenic
947473752 2:230422714-230422736 GAAGGAACACAGATGAATGCAGG + Intronic
947503316 2:230687676-230687698 GAGAGAACACAGAGGTTAGCGGG + Intergenic
947520682 2:230843780-230843802 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
947603327 2:231467989-231468011 GAAGGAAGACAGAAGGAGGCTGG - Intronic
947639713 2:231700232-231700254 GATGGATCTCAGTGGGAGGCTGG + Intergenic
948381944 2:237556885-237556907 GAGAGAACAGAGAGAGAGGGAGG - Intergenic
948381959 2:237556943-237556965 GAGAGAACAGAGAGAGAGGGAGG - Intergenic
948381972 2:237557001-237557023 GAGAGAACAGAGAGAGAGGGAGG - Intergenic
948381983 2:237557055-237557077 GAGAGAACAGAGAGGGAGGGAGG - Intergenic
948381994 2:237557101-237557123 GAGAGAACAGAGAGAGAGGGAGG - Intergenic
948479469 2:238240738-238240760 GGGGGAGCTCAGAGGGGGGCGGG - Intergenic
948770597 2:240249667-240249689 GAGAAGACACAGACGGAGGCAGG - Intergenic
948935139 2:241158986-241159008 GCGGGAACCCAAAGGGAGGCAGG - Intronic
1168890679 20:1293801-1293823 GAGGGAACTCAAGAGGAGGCAGG + Intronic
1169505779 20:6209468-6209490 GAGGGAGGAAAGAGAGAGGCAGG - Intergenic
1169505789 20:6209540-6209562 GAGGAAAGAAAGAGGGAGGGAGG - Intergenic
1169660996 20:7978232-7978254 GAGAGAAAGAAGAGGGAGGCTGG - Exonic
1169791427 20:9414336-9414358 CATGGAACACAGAGGCATGCAGG - Intronic
1169915380 20:10677626-10677648 GAGGGATCAGAGAGGATGGCTGG + Intergenic
1170716171 20:18832935-18832957 GAGAGAAAGGAGAGGGAGGCTGG + Intergenic
1171370872 20:24661321-24661343 GAGGGAAGAGAGGGGGAGGAAGG + Intronic
1171370883 20:24661358-24661380 GAGGGAAAACCGAGGGAAGAGGG + Intronic
1171420624 20:25014967-25014989 GAGGGAACTCAGAGGTCGCCTGG - Intronic
1171451951 20:25242050-25242072 AAGGGAACTCAGAGGCTGGCAGG + Intergenic
1171462718 20:25308059-25308081 CAGGGAACTGAGAGGTAGGCAGG + Intronic
1171464103 20:25315846-25315868 AAGGGAACACAGACAGAGGCAGG - Intronic
1171511266 20:25686476-25686498 GAGAGAAGTCAGAGGGTGGCTGG + Exonic
1172479439 20:35262267-35262289 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1172637071 20:36417124-36417146 GAGAGAACGCAGTGGGAGGGAGG + Intronic
1172833300 20:37855333-37855355 GTGGGAACCCAGAAGAAGGCTGG - Intronic
1172836085 20:37874023-37874045 GACGGAACAGAGAGTAAGGCAGG + Intergenic
1172853526 20:37983667-37983689 GAGGGTACAGAGAGGGAAGGCGG + Intronic
1173285683 20:41669878-41669900 GAAGGGACAAGGAGGGAGGCAGG + Intergenic
1173319128 20:41971698-41971720 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1173428670 20:42966387-42966409 GAGGGAACACAGAGGAAAGAGGG - Intronic
1173518069 20:43679094-43679116 TGGGGAACACAGAAGGAAGCAGG + Intronic
1174186552 20:48710201-48710223 GAAGCAACACAAAGGCAGGCAGG + Intronic
1174452713 20:50629690-50629712 GAAGGAACCACGAGGGAGGCAGG - Intronic
1175273899 20:57754461-57754483 GAGGGAGGAGGGAGGGAGGCAGG - Intergenic
1175387358 20:58605862-58605884 GAGGGAAGCCAGAGTGAGCCCGG - Intergenic
1175392497 20:58636073-58636095 GAGGGAGCACAGAGAGAGGGAGG + Intergenic
1175392534 20:58636193-58636215 GAGGGAGCACAGAGAGAGGGAGG + Intergenic
1175583517 20:60119060-60119082 CAGGGAACACATAGGGGAGCTGG - Intergenic
1175663377 20:60836824-60836846 GAGGTAAGGCAGAGAGAGGCTGG - Intergenic
1175824668 20:61930488-61930510 CAGGGATCCCAGTGGGAGGCAGG + Intronic
1176170031 20:63692587-63692609 GAGGTCACACAGTGAGAGGCTGG - Intronic
1176412639 21:6457376-6457398 GAGGGCACACAGAGGGTGAGAGG + Intergenic
1176424372 21:6538958-6538980 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1176552488 21:8232981-8233003 GAGAGAACAGACAGGGAGGGGGG - Intergenic
1176920554 21:14683196-14683218 GAGGGAACAGGGAGAGAGGAAGG + Intergenic
1177175091 21:17694359-17694381 AAGGGAACTCAGAGGCCGGCGGG - Intergenic
1177783189 21:25641184-25641206 AAGGCAACAGAGAGGTAGGCTGG + Intronic
1178566210 21:33688727-33688749 GAGGAAAGACAGAGGGAGCTTGG + Intronic
1178808588 21:35860169-35860191 GAGGGAAAAGAGAGGGAGGGAGG + Intronic
1178881332 21:36452590-36452612 GAGGCAATACAGAGGCTGGCAGG + Intergenic
1178889757 21:36511103-36511125 GCAGAAACACGGAGGGAGGCAGG + Intronic
1179030028 21:37712471-37712493 GAGGGAAGAGAAAGGGAGGAGGG - Intronic
1179030043 21:37712516-37712538 GAGGGAAGAGAAAGGGAGGAAGG - Intronic
1179030089 21:37712656-37712678 GAGGGAAGAGAAAGGGAGGAAGG - Intronic
1179030102 21:37712701-37712723 GAGGGAAGAGAAAGGGAGGAAGG - Intronic
1179066449 21:38029018-38029040 CAGGGAACACACAGAGAGGAAGG + Intronic
1179086221 21:38220196-38220218 GAGGGCACAGGGAGGGAGGAGGG + Intronic
1179356491 21:40665181-40665203 AAGAAAACACAGAGGCAGGCTGG + Intronic
1179444394 21:41421012-41421034 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1179649338 21:42796731-42796753 GAGGGAACACAGCGAGACGACGG + Intergenic
1179688133 21:43065698-43065720 GAGGGCACACAGAGGGTGAGAGG + Intronic
1179699865 21:43147273-43147295 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1179723399 21:43328745-43328767 GAGGGGACACACAGCAAGGCCGG + Intergenic
1179912252 21:44456457-44456479 GAGGGAGCGGAGAGGGAGGGAGG - Intronic
1180138529 21:45876765-45876787 GAGGGAACACAGTGCGGGGTGGG - Intronic
1180320005 22:11311157-11311179 GAAGGGAGAGAGAGGGAGGCAGG - Intergenic
1180333084 22:11550461-11550483 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1180837794 22:18939476-18939498 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1180838703 22:18947683-18947705 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1181474316 22:23159068-23159090 GAGGCAGCACAGTGGGAAGCAGG + Intronic
1181527342 22:23497569-23497591 GAGGGCATCCAGAGGGAGGAGGG - Intergenic
1181539553 22:23566181-23566203 GAGGGACCACAGCCGGGGGCGGG - Intergenic
1181594899 22:23907884-23907906 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1181762431 22:25067521-25067543 CAGGGAACACAGAGGGTGAAAGG - Intronic
1181998564 22:26902558-26902580 GAGGGAGCAGGGAGGGAGGGAGG - Intergenic
1182003595 22:26940889-26940911 GTGGGGGCACAGAGGGAGGGAGG + Intergenic
1182062033 22:27405245-27405267 GAGGGAAGAGGGAGGGAGGCAGG - Intergenic
1182103265 22:27671990-27672012 GAGGGAGCAGGGAGGGAGGAAGG + Intergenic
1182869346 22:33632589-33632611 GAGGCAACACAGAGGCAGGAAGG - Intronic
1182875982 22:33691262-33691284 GAGGGAGGAGAGAGGGAGGGAGG + Intronic
1182943584 22:34301210-34301232 GAGAGAACTCAGAGGGAAGAAGG + Intergenic
1183085378 22:35483693-35483715 GAGGGAAGAAAGAGGGAGGAAGG + Intergenic
1183292420 22:37010830-37010852 GATGGAGCCCAGAGAGAGGCAGG + Intergenic
1183469644 22:37998591-37998613 GAGGGTGCAGAGAGGGAGTCTGG - Intronic
1183730913 22:39617866-39617888 GAGGGAGGAAAGAGGGAGGGGGG - Intronic
1183731541 22:39621401-39621423 GATGGACCACAGAGGTTGGCTGG - Intronic
1183928020 22:41219689-41219711 AAGGGAACACAGAGCTTGGCAGG + Intronic
1184226275 22:43130371-43130393 GAGAGAAGACATAAGGAGGCAGG - Intergenic
1184308362 22:43624520-43624542 GCGAGATCACAGAGGCAGGCGGG - Intronic
1184351708 22:43948567-43948589 TAGGGAAGACAGAGAGAGGTTGG - Intronic
1184643161 22:45882856-45882878 GAGGGGACACCTAGGGAGGAGGG + Intergenic
1184691722 22:46120285-46120307 CAGGGAGCCCAGAGCGAGGCTGG + Intergenic
1184976455 22:48065885-48065907 GAGGGAATATAGAGGGAAGCTGG + Intergenic
1185006820 22:48282870-48282892 GAGGGAAAAAAGAAGGAGGGAGG + Intergenic
1185034123 22:48462382-48462404 GTGTGAACACTCAGGGAGGCGGG - Intergenic
1185156814 22:49198059-49198081 GAGGGCTGACACAGGGAGGCTGG - Intergenic
1203287885 22_KI270734v1_random:164775-164797 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
949563023 3:5220420-5220442 GTGGCAACACACAGGGAGGGAGG - Intergenic
949844132 3:8353100-8353122 GATGGAAGAGAGAGGCAGGCAGG - Intergenic
950030319 3:9847805-9847827 AAGGGAACTCAGAGGCTGGCGGG - Intronic
950185032 3:10939596-10939618 GAGAGAACTGAGAGGGAGGATGG - Exonic
950319763 3:12040363-12040385 GATGGAAGCCAGAGTGAGGCAGG + Intronic
950364171 3:12471500-12471522 GAGCGAGCAGAGGGGGAGGCTGG - Intergenic
950442510 3:13018337-13018359 GTGGGAAGGCAGAGGGGGGCAGG + Intronic
950607052 3:14091328-14091350 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
950610112 3:14121189-14121211 GCTGGGACACAGAGGGAGGTGGG - Intronic
950908512 3:16562186-16562208 GAGGGTACACAGAGACAGACAGG + Intergenic
950942373 3:16905844-16905866 GAGGTAATTGAGAGGGAGGCAGG + Intronic
951501366 3:23390710-23390732 GAGGGAGCACACAGGCAAGCAGG - Intronic
951514590 3:23544806-23544828 AAGGGAACTCAGAGGCTGGCGGG - Intronic
951703880 3:25524625-25524647 GAGGGAGGAAGGAGGGAGGCAGG - Intronic
952258994 3:31721082-31721104 GAGGGAAGTCAGAGGGAGATGGG + Intronic
952773361 3:37021968-37021990 GAGGGAAGAGACATGGAGGCTGG + Intronic
953059878 3:39418442-39418464 AAGGGAACTCAGAGGCCGGCAGG - Intergenic
953481816 3:43258447-43258469 AAGGGAACTCAGAGGTCGGCGGG - Intergenic
953714872 3:45308608-45308630 GCTGGACCACAGAGGGAGGTGGG + Intergenic
953960147 3:47260336-47260358 AAGGGAACTCAGAGGCTGGCGGG + Intronic
954390553 3:50266053-50266075 GAGTGAACACAGGTGGAGGAAGG + Intergenic
954440729 3:50520683-50520705 AAGGGAACTCAGAGGCTGGCAGG + Intergenic
954453168 3:50582631-50582653 GAGGGCAGACACAGGGAGGAAGG + Exonic
954652435 3:52173353-52173375 GAGGCAAAACAGAAGGATGCAGG + Intergenic
954896234 3:53977657-53977679 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
955770231 3:62378145-62378167 GAGGGAAGAAGGAGGGAGGGAGG - Intergenic
956066121 3:65399261-65399283 GAGGGAATTCACAGGGAAGCTGG - Intronic
956403845 3:68907569-68907591 GAGGGAACACAGATGCAGACTGG - Intronic
956529465 3:70201764-70201786 GAGGGAATGGAGAGGGAAGCAGG - Intergenic
956893634 3:73637872-73637894 GAAGGAACTCAGAATGAGGCTGG - Intergenic
957184616 3:76925661-76925683 AAGGGAACACAGATGGGGTCAGG + Intronic
957916452 3:86693693-86693715 GAGGGAACCAAGAGAGGGGCAGG - Intergenic
958937486 3:100272637-100272659 AAGGGAACTCAGAGGCTGGCGGG - Intronic
958975713 3:100666284-100666306 AAGGGAACTCAGAGGCTGGCGGG - Intronic
959585136 3:108018763-108018785 GAGGCAACAGTGAGGAAGGCTGG - Intergenic
959728277 3:109570376-109570398 GAGGGACAACAGAGGAAGCCAGG - Intergenic
959974435 3:112442532-112442554 GAGGGCAGAGAGAGGGAGGGGGG + Intergenic
960027372 3:113024420-113024442 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
960028285 3:113032619-113032641 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
960891456 3:122452628-122452650 GAGGGAGGAGAGAGGGAGGGAGG + Intronic
961129790 3:124455346-124455368 GAGTCAACACAGAGGTAGGCAGG + Exonic
961347723 3:126274882-126274904 GAGGGAAGAAAGAGGGAGGAAGG - Intergenic
961388379 3:126537307-126537329 GAGGGAGCACAAGGGGAGCCTGG + Intronic
961512531 3:127411796-127411818 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
961624470 3:128252099-128252121 GAAGAAACACAAAGGGAGTCTGG - Intronic
961723291 3:128909841-128909863 AAGGGAAAACAGAAGGTGGCTGG + Intronic
962275712 3:134011871-134011893 GTGTGAGAACAGAGGGAGGCGGG + Intronic
962340063 3:134575175-134575197 GAGGGAAGAGAGAGAGAGACAGG - Intergenic
962439048 3:135395081-135395103 TGGGGGACACAGAGGGAGGGAGG - Intergenic
962454246 3:135550493-135550515 GAGGGAAGCAAGAGGCAGGCAGG + Intergenic
962890223 3:139665346-139665368 GAGGGAAGAAGGAGGGAGGGAGG - Intronic
962962769 3:140326322-140326344 GAGGCAAGACAGAGGGAAGAAGG + Intronic
963207624 3:142652566-142652588 GAGGGCACAGAGTAGGAGGCGGG + Intronic
963631001 3:147729652-147729674 CAGGAAAAAGAGAGGGAGGCAGG + Intergenic
963640237 3:147852372-147852394 GTAGGAACACAGAGGGAGTTGGG + Intergenic
963741480 3:149086223-149086245 CAGGGAACGCAGAGGAACGCGGG + Intronic
964282114 3:155079125-155079147 AAGGGAAGAAAGAGGGAAGCGGG + Intronic
964762465 3:160147193-160147215 AAGGGGAGACAGAGGGAGGGAGG - Intergenic
964851697 3:161102865-161102887 GATGGAACAAAGCTGGAGGCTGG + Intronic
965074817 3:163962977-163962999 GAAGGAAGAGAGAGGGAGGGAGG - Intergenic
965077087 3:163992884-163992906 GAGGAGACAGAGAGGGAGGAAGG + Intergenic
965173081 3:165293879-165293901 GAGGGAGGAGAGAGGGAGGGAGG + Intergenic
965524571 3:169702277-169702299 AAGGGAACATAGATGGTGGCTGG - Intergenic
966073293 3:175905693-175905715 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
966331818 3:178823211-178823233 GAAGAAACACAGAGGGTGGGTGG + Intronic
966806241 3:183810010-183810032 CAGGGAGCACAGAGGTAAGCAGG - Intronic
967025801 3:185562691-185562713 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
967026712 3:185570903-185570925 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
967179039 3:186887017-186887039 AAGGGAACTCAGAGGCTGGCAGG - Intergenic
967179795 3:186894021-186894043 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
967418843 3:189251514-189251536 AAGGGAACTCAGAGGCTGGCGGG - Intronic
967995651 3:195164465-195164487 GAAGGAACAAAGTGTGAGGCAGG - Intronic
968003021 3:195220617-195220639 TAGGGAGCACTGAGGCAGGCAGG - Intronic
968095547 3:195927668-195927690 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
968221734 3:196944870-196944892 AAGGGAACTCAGAGGCCGGCGGG + Intergenic
968387180 4:151885-151907 AAGGGAACTCAGAGGCTGGCGGG - Intronic
968748550 4:2373916-2373938 GAGAGAGGACACAGGGAGGCAGG - Intronic
968836285 4:2966891-2966913 CAGGGACCAGAGAGGGAGGGGGG - Intronic
969032204 4:4224390-4224412 GAGGGAATAGGGAGGGAGGGAGG + Intronic
969074798 4:4569411-4569433 GAGAGAACAAAAAGGGATGCTGG - Intergenic
969278639 4:6154173-6154195 GAGGGAAGACAGAGCGGAGCTGG + Intronic
969345727 4:6568672-6568694 GAGGGAAGGAAGAGGGAGGGAGG - Intergenic
969353866 4:6613825-6613847 GAAGGAAAAAAGAGGGAGGGAGG + Intronic
969371563 4:6734507-6734529 GAGGCAAGGCAGAGGGCGGCTGG - Intergenic
970320191 4:14867855-14867877 GAGGGAGCACAGTAGGAGGGAGG - Intergenic
970444876 4:16115230-16115252 AAGGCAATGCAGAGGGAGGCTGG + Intergenic
970724227 4:19025025-19025047 GAGGGAACCCAGAAGTAGACTGG + Intergenic
970993804 4:22242420-22242442 GAGGGCAGACAGAGGGAGTGGGG - Intergenic
971394347 4:26214675-26214697 GAGGGAGGAGAGAGGGAGGAAGG + Intronic
971424326 4:26501343-26501365 GTGAGGCCACAGAGGGAGGCAGG - Intergenic
971501861 4:27326929-27326951 AAGGCAACAATGAGGGAGGCTGG - Intergenic
971600789 4:28588745-28588767 GAGTAAACAGAGAGGGAGTCAGG - Intergenic
971609029 4:28697938-28697960 GAGGGAACAGAAAGGGAGGGAGG - Intergenic
971657164 4:29363584-29363606 GAGGGATCACAGAGTGAAGGAGG + Intergenic
972565522 4:40265676-40265698 GAGGGAAGGGAGAGGGAGGAGGG + Intergenic
972700954 4:41492421-41492443 GAGGGAGCCCAGAGGGAGAAGGG + Intronic
972772784 4:42213730-42213752 GAGGGAGAAGAGAGGGAGGGGGG - Intergenic
972831326 4:42817012-42817034 AAGTGAATAAAGAGGGAGGCAGG + Intergenic
974393053 4:61298331-61298353 GAGGGACCACAAACGTAGGCTGG - Intronic
974499247 4:62677506-62677528 GAGAGAAACAAGAGGGAGGCTGG - Intergenic
974518022 4:62941680-62941702 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
974799739 4:66801610-66801632 AAGGGAAAAAAGAGGCAGGCAGG - Intergenic
975246773 4:72129367-72129389 AAGGGAACTCAGAGGCTGGCGGG - Intronic
975738005 4:77400498-77400520 GAGGGGATAAAGAGTGAGGCAGG + Intronic
976036130 4:80823276-80823298 GTTGGAGCAAAGAGGGAGGCAGG - Intronic
976206541 4:82627984-82628006 GGGAGAACACAGACTGAGGCTGG - Intergenic
979046329 4:115870280-115870302 GAAGGAAGATAGAGAGAGGCTGG - Intergenic
979141715 4:117183915-117183937 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
979322672 4:119342677-119342699 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
979327535 4:119397167-119397189 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
980932726 4:139196937-139196959 GTGGGAACAAAAAGGAAGGCAGG + Intergenic
980967714 4:139539179-139539201 AAGGGAACACAGTGGAAGGAAGG - Intronic
982512789 4:156304905-156304927 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
982876656 4:160659588-160659610 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
983205395 4:164905657-164905679 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
983214555 4:164991185-164991207 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
983387414 4:167082798-167082820 GAGAGAGGACAGAGGGAGGGAGG + Intronic
983654026 4:170062888-170062910 GTTGGAACACAGAGGGTTGCAGG + Intronic
984328194 4:178280512-178280534 TAGACAACCCAGAGGGAGGCTGG + Intergenic
984401495 4:179271421-179271443 AAGGGAAAAGAGAGGGAGGCAGG - Intergenic
984662923 4:182392682-182392704 GTGGAAACAGAGAAGGAGGCAGG + Intronic
984954252 4:185030084-185030106 GAGGGAGCAAAAATGGAGGCTGG - Intergenic
985233658 4:187849416-187849438 GAAGGAAGAGAGAGGGAGGGAGG - Intergenic
985657890 5:1141490-1141512 GAGAGCACAGAGAGGGAGGCAGG - Intergenic
985669720 5:1201156-1201178 GAGGGAACTCAGCGGGAGCAGGG - Intergenic
985670909 5:1206158-1206180 GAGGGAGCAGTGAGAGAGGCTGG + Intronic
985679131 5:1246822-1246844 GAGGGAACAGAGGGAGAGGGAGG - Intergenic
985696019 5:1340607-1340629 GAGGGGACACGGAGAGGGGCAGG + Intronic
985738020 5:1596120-1596142 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
985882815 5:2653389-2653411 GAGGGAAGAGATTGGGAGGCTGG - Intergenic
985993673 5:3584508-3584530 GAGGAAAGAAGGAGGGAGGCAGG + Intergenic
985993794 5:3584987-3585009 GAGGAAGGAAAGAGGGAGGCAGG + Intergenic
985993828 5:3585118-3585140 GAGGAAGGAAAGAGGGAGGCGGG + Intergenic
986130549 5:4925731-4925753 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
986530115 5:8727034-8727056 GAGGGAAGAAAGAGCGAGGAAGG + Intergenic
986549685 5:8938543-8938565 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
987432166 5:17848091-17848113 GAGGGAAAAGAGAGTGAGGCAGG + Intergenic
988079079 5:26392937-26392959 GAGGGAGCAAAGAGCAAGGCAGG + Intergenic
988379927 5:30486796-30486818 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
988380851 5:30495292-30495314 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
988850664 5:35177188-35177210 AAGGGAACTCAGAGGCTGGCGGG + Intronic
989069658 5:37497260-37497282 GAGGGAAAAGGGAGGGAGGAAGG - Intronic
989737860 5:44730630-44730652 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
990028923 5:51231771-51231793 GAGGCAACCCAGAAGGAGTCTGG - Intergenic
990414351 5:55571874-55571896 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
990553612 5:56909221-56909243 GATGGAACACAGAGCGCGGCCGG + Intergenic
990789809 5:59464589-59464611 AAGGGAACTCAGAGGCTGGCGGG + Intronic
991017194 5:61944980-61945002 CAGGTAACACAGAGGAAAGCTGG + Intergenic
991304201 5:65159405-65159427 GAGGCTACAGAGAGAGAGGCAGG - Intronic
991507339 5:67339148-67339170 GGAGGAAGACAGAGGGAGGGAGG - Intergenic
992176460 5:74154091-74154113 GAGGGGACACAAATTGAGGCAGG + Intergenic
992320145 5:75605976-75605998 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
992872686 5:81022620-81022642 TGGAGAAAACAGAGGGAGGCAGG - Intronic
994341177 5:98630091-98630113 GAGGGACTACAGAGGGACACGGG + Intergenic
994927450 5:106135861-106135883 GAAGGAACAAGGAGGGAGGAAGG - Intergenic
995878915 5:116821933-116821955 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
996772398 5:127098921-127098943 GAGGGAACAGAGAGGAAGCCTGG + Intergenic
997197072 5:131987448-131987470 TGGGGAGCACATAGGGAGGCAGG + Intronic
997723208 5:136097432-136097454 GAGGGAGCACTGATGGAGGGAGG + Intergenic
998167908 5:139855041-139855063 AAGTGAACAGAGAGGGAGCCGGG - Intronic
998516873 5:142763835-142763857 ATGGGAAAACAGAGGGAGCCAGG - Intergenic
999822318 5:155240337-155240359 GAGGAAACAGAGTGGGAGACAGG - Intergenic
999951645 5:156657849-156657871 AAGGGAACTCAGAGGCTGGCGGG - Intronic
999952549 5:156666061-156666083 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1000588227 5:163126268-163126290 GAGGGAACAGAGAGGGAGTGGGG + Intergenic
1000819250 5:165963361-165963383 GAGGGACCCAAGAGGGAGGGAGG - Intergenic
1001196049 5:169674483-169674505 GAGGGAAGAAAGAGGATGGCTGG - Intronic
1001228149 5:169963370-169963392 GAGGGAGCAGAGAGGGATGGAGG - Intronic
1001232046 5:169997018-169997040 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1001251067 5:170147336-170147358 AAGGGGACACAGAGGGGAGCCGG - Intergenic
1001400604 5:171444211-171444233 GAGTGAACAGCGAAGGAGGCAGG - Intronic
1001801935 5:174552075-174552097 GAGCGAACCCAGATGGAGTCGGG - Intergenic
1001840851 5:174875567-174875589 GAGGAAACACAGCGTGAGGCAGG - Intergenic
1001950306 5:175811998-175812020 GAGAGAAGACAGGGTGAGGCTGG + Intronic
1001971353 5:175957409-175957431 GAGGGAAGACAGAGAGAATCTGG - Intronic
1002101692 5:176861067-176861089 TAGGGATGGCAGAGGGAGGCTGG - Intronic
1002246089 5:177886368-177886390 GAGGGAAGACAGAGAGAATCTGG + Intergenic
1002372912 5:178769031-178769053 GAGGAAACACAGAGAGATGAGGG - Intergenic
1002446028 5:179290692-179290714 CAGAGAGCACTGAGGGAGGCTGG - Intronic
1002482740 5:179514106-179514128 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1002666303 5:180828067-180828089 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1002909881 6:1481686-1481708 CAGGGAATGCAGAGGGAGGCTGG - Intergenic
1002950978 6:1810648-1810670 CAGGGAACAGACAGGGAGGAGGG + Intronic
1003016031 6:2468213-2468235 GAGGGTAGACAGAGAGAGGAAGG + Intergenic
1003212295 6:4078976-4078998 GGGGGGACAAAGAGGGCGGCGGG + Exonic
1003270674 6:4605228-4605250 GAGGAGACACAGAGGCATGCAGG + Intergenic
1003285603 6:4731445-4731467 GATGAGACACAGAGGGAGCCAGG - Intronic
1003472628 6:6451536-6451558 GAGGGAACACACAGGCTGGCTGG - Intergenic
1003513063 6:6797491-6797513 GAAGCAACAGAGAGGGAGGGAGG - Intergenic
1003528258 6:6916540-6916562 GAAGGAAAGCAGAAGGAGGCAGG + Intergenic
1003637519 6:7846510-7846532 GGGGAAACACAGAAGGAGGAAGG + Intronic
1003642525 6:7887790-7887812 GGGGGAACACAGTGGGAGACAGG - Intronic
1003754414 6:9100576-9100598 GAAGGAAGAAAGAGGGAGGAAGG - Intergenic
1003858872 6:10303688-10303710 GAGGTCACACAGATGGAGGTGGG - Intergenic
1004332098 6:14731193-14731215 AAGGGAATACAGAGGGAGACAGG - Intergenic
1004595355 6:17094349-17094371 GAGAGAAGACAGAGGGAAGGAGG + Intergenic
1004669564 6:17782988-17783010 GATGGAAGACACAGGGAGGGTGG - Intronic
1004859977 6:19793906-19793928 GAGGGAGGACAGAAGAAGGCAGG + Intergenic
1004945601 6:20609326-20609348 GAGGGAAAAGAGAGGGAGGAGGG - Intronic
1005223974 6:23620127-23620149 GAGGGGACAGAGAGAGAGGGAGG + Intergenic
1006046511 6:31303487-31303509 GAAAGAACACACAGGGAGTCTGG + Intronic
1006341282 6:33448546-33448568 GAGGGAGGCCAGAGGGAGGCTGG - Intronic
1006399719 6:33810103-33810125 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1006538398 6:34719603-34719625 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1007793468 6:44328191-44328213 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1007899831 6:45400239-45400261 GAGGGGAGACAGAGGGAGGAAGG + Intronic
1008057422 6:46959712-46959734 GAGGAAAGAAAGAGGGAGGGAGG + Intergenic
1008404703 6:51105772-51105794 AAGGGAAAACAGAGGGTGGGTGG + Intergenic
1008583047 6:52923475-52923497 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1008627843 6:53335332-53335354 CAGGGAAGCCAGAGGGAGACAGG - Intronic
1008730123 6:54472105-54472127 TAGGGAACTCAGAGGAAGTCAGG - Intergenic
1009565861 6:65310428-65310450 GTGGGTACTCAGAGGCAGGCAGG - Intronic
1010290708 6:74133312-74133334 GAGGGCACACAGTAGGAGGTGGG + Intergenic
1010467327 6:76183963-76183985 GAGGGAAGACAGTGGGAGGAGGG - Intergenic
1010584634 6:77642926-77642948 GAGGCAACTCAAAGGGAGGTGGG + Intergenic
1010591399 6:77717088-77717110 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1010592336 6:77725550-77725572 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1010686475 6:78859590-78859612 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1011050375 6:83141459-83141481 AAGGGAACACATAGGGAAGTGGG + Intronic
1011292990 6:85795798-85795820 GAGGGAATGGAGAGGGAAGCAGG + Intergenic
1011480549 6:87789410-87789432 GAGGGATCACAGACACAGGCAGG + Intergenic
1011686825 6:89830152-89830174 GAAGGACCACAGAGGGACGCAGG - Intronic
1011773445 6:90701304-90701326 AAGGAAACAGAGAGGGAGCCAGG + Intergenic
1012458202 6:99430173-99430195 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1013207518 6:107958218-107958240 GAGGGAAAACTGAGCGGGGCGGG - Intergenic
1013216610 6:108033114-108033136 GAGGGAAGAGGGAGGGAGGGAGG - Intergenic
1013555728 6:111255241-111255263 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1013605824 6:111746812-111746834 GAGGGTAGAGGGAGGGAGGCAGG + Intronic
1014266731 6:119286414-119286436 GAGGAAACACAGAGGGGAGTAGG - Intronic
1014800773 6:125775990-125776012 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1015163960 6:130182612-130182634 GAGGGAAGAAAGAAGGAGGGAGG + Intronic
1015178951 6:130341128-130341150 AAAGAAACACAGAGGGAGGGAGG + Intronic
1015574722 6:134659253-134659275 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1015633293 6:135252376-135252398 GATGAGGCACAGAGGGAGGCCGG - Intergenic
1015878182 6:137845182-137845204 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1017018373 6:150119431-150119453 GAGGGACCACAGGAGGAAGCTGG + Intergenic
1017171054 6:151455353-151455375 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1017217353 6:151924578-151924600 GAGGGAACAGAGTGGGAGTGGGG - Intronic
1017646075 6:156541029-156541051 GAGGGAATTCAGAGGGAAGAGGG + Intergenic
1017944727 6:159086262-159086284 GAGGAAACAGTTAGGGAGGCAGG - Intergenic
1017988854 6:159469086-159469108 GAGGGAAGAGAGAGAGAGGCAGG + Intergenic
1018024620 6:159794874-159794896 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1018163147 6:161067370-161067392 GAGGGAACAGGATGGGAGGCAGG + Intronic
1018171508 6:161146861-161146883 GAGGGAAGACGGAATGAGGCAGG - Intronic
1018381388 6:163261125-163261147 CCGGGAAGACAGAGGGAGGAGGG - Intronic
1018581898 6:165315142-165315164 GAGAGAACAGAGAGGCAGGAGGG - Intergenic
1018857974 6:167689107-167689129 AAAGGAACACAGCGGGTGGCAGG - Intergenic
1018869341 6:167769284-167769306 GATAAAACAGAGAGGGAGGCTGG - Intergenic
1018999395 6:168736112-168736134 GAAGGAAAAGAGAGGGAGGGAGG - Intergenic
1019070600 6:169341833-169341855 GAGGGTGCACAGATGGAGCCGGG - Intergenic
1019127424 6:169850100-169850122 GTGGGGACACAGCTGGAGGCAGG - Intergenic
1019325925 7:438264-438286 GCGGGGACACAGAGGGAGCTTGG - Intergenic
1019540857 7:1550399-1550421 CAGGGAGCACAGAGGGGGACCGG + Intronic
1019633612 7:2063852-2063874 GAGGGCAGAGCGAGGGAGGCTGG - Intronic
1019730654 7:2627628-2627650 GAGGGAGGACAGAAGGAGGGAGG + Intergenic
1019909667 7:4092287-4092309 AGGCGAGCACAGAGGGAGGCTGG - Intronic
1019976073 7:4582569-4582591 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1019977007 7:4591073-4591095 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1019977943 7:4599576-4599598 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1020011352 7:4807534-4807556 GAGGGGAGACAGAGGGAGAGAGG - Intronic
1020029133 7:4920674-4920696 GAGGGAGGAGAGAGGGAGGAGGG - Intronic
1020254968 7:6497853-6497875 GGGGGAACACAGAGGTAGGGTGG + Intronic
1020280260 7:6646702-6646724 CAGGGAGCACTGGGGGAGGCGGG - Intronic
1020983481 7:15101943-15101965 GAGGGAACTCAAAGGGAGAGAGG + Intergenic
1021067844 7:16198524-16198546 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1021089138 7:16461404-16461426 GAGAGGAGACAGAGGGAGACAGG - Intergenic
1021505957 7:21385349-21385371 CAGGTATAACAGAGGGAGGCAGG - Intergenic
1021584546 7:22193789-22193811 GAGAGAAAAGAGAGGGAGGGAGG + Intronic
1021671651 7:23040658-23040680 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1022105364 7:27192779-27192801 GAGGGAACGGAGAGCGAGCCGGG - Intergenic
1022164247 7:27741797-27741819 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1022471994 7:30687759-30687781 GAGGGAGGGCAGAGGAAGGCAGG + Intronic
1022506626 7:30911787-30911809 GGGGGAGCACAAAGGGAGGAAGG - Intergenic
1023031743 7:36095642-36095664 GAGGGAAGAGAGAAGGAAGCGGG + Intergenic
1023292041 7:38678656-38678678 GGGGGCACACAGAGGGAATCAGG + Intergenic
1023333690 7:39146339-39146361 GCAGGAAGGCAGAGGGAGGCAGG + Intronic
1023623615 7:42095902-42095924 GAGGAAACCTGGAGGGAGGCTGG + Intronic
1024094221 7:45971687-45971709 CAGGGAGCAGGGAGGGAGGCAGG - Intergenic
1024356824 7:48422097-48422119 GAAGGAAGAAAGAGGGAGGAAGG + Intronic
1024617863 7:51130654-51130676 GAGGACACCCAGGGGGAGGCAGG - Intronic
1024876514 7:54030330-54030352 GAGGGAAAAAAAAGGGAGGAAGG + Intergenic
1024959715 7:54961187-54961209 GAGAGAGGACAGAGGGAGGGAGG + Intergenic
1025850577 7:65240051-65240073 GAGGGAACACAGCGGGGAGGAGG - Intergenic
1025850911 7:65243177-65243199 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1026529557 7:71185154-71185176 GAGGGGACAGAGAGGAAGGAAGG - Intronic
1026822079 7:73556855-73556877 CAGGGAAATTAGAGGGAGGCTGG + Intronic
1026858040 7:73767962-73767984 GATGGAACATAAAGGGAGACAGG - Intergenic
1027049077 7:75010318-75010340 AGGGGAAGACAGAGGTAGGCAGG + Intronic
1027309270 7:76937238-76937260 AAGGGCATACAGAGGGAGACTGG - Intergenic
1028538291 7:91913916-91913938 GAAGGAAAACAGAGGCAGGGAGG + Intergenic
1029115050 7:98232452-98232474 GAGTTAGCACAGAGGGCGGCCGG - Intronic
1029126240 7:98296943-98296965 AAGGGAACAGAGAGGAGGGCAGG - Intronic
1029240999 7:99162450-99162472 GAGGCAACAAAGAGGAAGGAAGG - Intergenic
1029348624 7:99997206-99997228 GAGGAAGGACAGAGGGAGGGAGG - Intergenic
1029383942 7:100231341-100231363 AGGGGAAGACAGAGGTAGGCAGG - Intronic
1029534702 7:101149996-101150018 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1029644550 7:101845546-101845568 GAGGGAATAGAGGAGGAGGCTGG + Intronic
1030380365 7:108803965-108803987 CAGGGAGGAGAGAGGGAGGCAGG - Intergenic
1030380371 7:108803984-108804006 AAGGGAGGAGAGAGGGAGGCAGG - Intergenic
1030760242 7:113341661-113341683 AAGGGAACTCAGAGGCTGGCAGG - Intergenic
1031560895 7:123236768-123236790 GAGGGAACATAGGGAGAGGTGGG - Intergenic
1031607046 7:123781439-123781461 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1031724536 7:125221313-125221335 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1032085238 7:128880292-128880314 CAGGCATCAGAGAGGGAGGCTGG - Intronic
1032090552 7:128909644-128909666 GAAGGGGCACAGATGGAGGCAGG - Intronic
1032452229 7:132042906-132042928 GTGGGGAAACAGTGGGAGGCAGG + Intergenic
1032486593 7:132292265-132292287 CAGGTAAATCAGAGGGAGGCTGG + Intronic
1032547107 7:132753136-132753158 AAAGGAACAAAAAGGGAGGCGGG + Intergenic
1032746304 7:134790110-134790132 GAGAGGACAGAGAGGGAGGAAGG + Intronic
1033212186 7:139468208-139468230 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1033349824 7:140553127-140553149 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1033445493 7:141418180-141418202 GATGGAACACAGAGTCAGGGAGG - Intronic
1033583329 7:142755819-142755841 GAGGGAAGAGAGAAGGAGGGTGG - Intronic
1033586340 7:142777327-142777349 GAGGGAAGAGAGAAGGAGGGTGG - Intergenic
1034535041 7:151721079-151721101 GAGGGGACACAGAGGGCAGAGGG + Intronic
1034827067 7:154275292-154275314 GAGGGGACACAGAGGGAAGGAGG - Intronic
1035019464 7:155792140-155792162 GAGGGATTACAGAGAGAGGGAGG - Intergenic
1035019533 7:155792384-155792406 GAGGGATTACAGAGAGAGGGAGG - Intergenic
1035280221 7:157773658-157773680 GAGGCAACACAGACAGAGGGAGG - Intronic
1035349721 7:158237593-158237615 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1035473954 7:159129175-159129197 GAGGGAACAGAGTGTGAAGCTGG - Intronic
1035473966 7:159129231-159129253 GAGGGAACAGAGTGTGAAGCTGG - Intronic
1035473988 7:159129301-159129323 GAGGGAACAGAGTGTGAAGCTGG - Intronic
1035474013 7:159129413-159129435 GAGGGAACAGAGTGTGAAGCTGG - Intronic
1035474026 7:159129469-159129491 GAGGGAACAGAGTGTGAAGCTGG - Intronic
1035474038 7:159129525-159129547 GAGGGAACAGAGTGTGAAGCTGG - Intronic
1035474065 7:159129637-159129659 GAGGGAACAGAGTGTGAAGCTGG - Intronic
1035474079 7:159129693-159129715 GAGGGAACAGAGTGTGAAGCTGG - Intronic
1035474092 7:159129749-159129771 GAGGGAACAGAGTGTGAAGCTGG - Intronic
1035474107 7:159129805-159129827 GAGGGAACAGAGTGTGAAGCTGG - Intronic
1035474119 7:159129861-159129883 GAGGGAACAGAGTGTGAAGCTGG - Intronic
1035474141 7:159129931-159129953 GAGGGAACAGAGTGTGAAGCTGG - Intronic
1035625627 8:1068638-1068660 GAGGGAACAAGGACGGAGGGAGG + Intergenic
1035754753 8:2022912-2022934 CGGGGCAGACAGAGGGAGGCAGG - Intergenic
1036291621 8:7498018-7498040 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1036292553 8:7506521-7506543 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1036926978 8:12916400-12916422 GAGGGAGGACAGAGAGAGGATGG - Intergenic
1036978777 8:13445131-13445153 AAGAGAGCACAGAGGGAGGAAGG + Intronic
1037192430 8:16142824-16142846 CTGGGAATACAGAGGGAGGGAGG + Intronic
1037429509 8:18794751-18794773 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1037540477 8:19865745-19865767 GAGGAAAGAAAGAGGGAGGGAGG + Intergenic
1038478384 8:27884897-27884919 CAGGGAGTACAGAGTGAGGCAGG + Intronic
1038650848 8:29401998-29402020 GAGGGAAGAGGGAGGGAGGAAGG - Intergenic
1038721333 8:30038579-30038601 GAGGGAACAGAGGGAGAGGGAGG + Intergenic
1038953628 8:32444078-32444100 GAGGAAAGAGAGAGGGAGGGAGG - Intronic
1039392584 8:37193511-37193533 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1039407544 8:37326286-37326308 GAGGGAAGCCAGTGGGAGGAAGG - Intergenic
1039561028 8:38512642-38512664 GAGGGGATGGAGAGGGAGGCAGG + Intronic
1039774080 8:40718645-40718667 GAGGGAAAGAAGAAGGAGGCTGG - Intronic
1039836528 8:41260608-41260630 CAAGGGACACAGAGGTAGGCTGG - Intergenic
1039845089 8:41320473-41320495 GGGGGAAGAGAGAGGGAGGGAGG - Intergenic
1039865705 8:41499643-41499665 GGAGGAACACACAGGGTGGCTGG - Intronic
1039871539 8:41549997-41550019 AAGGAAGCTCAGAGGGAGGCAGG - Intergenic
1040126100 8:43739682-43739704 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1040413243 8:47176176-47176198 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1040769073 8:50951023-50951045 GACAGAAAACAGAAGGAGGCAGG + Intergenic
1041060685 8:54031824-54031846 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1041374487 8:57199746-57199768 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1041731708 8:61069420-61069442 AAGGGAAAACAGAGGAAGGAAGG - Intronic
1041910797 8:63086373-63086395 GAAGGAAGAGAGAGGGAGGAAGG - Intergenic
1042021311 8:64373230-64373252 GAGAGAACGCAGAGGGAGGGAGG + Intergenic
1042875206 8:73435202-73435224 TTAGGAACCCAGAGGGAGGCAGG - Intronic
1043778195 8:84297198-84297220 GAGGGTAGACAGTGGGAGGAGGG - Intronic
1044119951 8:88382473-88382495 GAGGGAAGAGGGAGGGAGGAAGG - Intergenic
1044122115 8:88410841-88410863 GAGGAAACACAGAAGGTGGATGG + Intergenic
1044310235 8:90684834-90684856 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1044310367 8:90685681-90685703 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1044499518 8:92936459-92936481 GAGGATGAACAGAGGGAGGCAGG + Intronic
1044627190 8:94245578-94245600 GAGGGGACACAGAGGGAAGAAGG - Intergenic
1044785265 8:95786787-95786809 GAGGGAGCAAAGAGGAAGGAAGG + Intergenic
1044900298 8:96936973-96936995 GAGGGAGGAGAGAGGGAGGAAGG - Intronic
1045494790 8:102699274-102699296 GAGGAAGCACTGAGGGAGCCTGG + Intergenic
1045501756 8:102749015-102749037 CAGGGATCCCAGAGGGAAGCAGG + Intergenic
1045573422 8:103393402-103393424 GTGGGCATACAGAGGGAGTCAGG - Intergenic
1046521071 8:115327095-115327117 GAGAAAACACAGGGCGAGGCAGG - Intergenic
1046719978 8:117608435-117608457 GAGGGAAGAGGGAGGGAGGGGGG - Intergenic
1047503295 8:125458913-125458935 GTGGGAACACAGAGGAGGGGAGG + Intergenic
1048013048 8:130473946-130473968 GAGGGAACACAGAGGAAGGAGGG + Intergenic
1048838900 8:138547461-138547483 GAGAGGAGACAGAGGGAGACAGG - Intergenic
1048947154 8:139460049-139460071 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1049288125 8:141787571-141787593 CAGAGAACAGAGAGGGAGGGAGG + Intergenic
1049370248 8:142260978-142261000 GAGGGAGGAGAGAGGGAGGGGGG + Intronic
1049469840 8:142770395-142770417 GGGAGAACACAGAGGGAGCATGG + Intronic
1049556956 8:143287427-143287449 AAGGGAACTCAGAGGCTGGCAGG - Intergenic
1049565322 8:143335039-143335061 CAGGGAAACCAGGGGGAGGCCGG - Intronic
1049622670 8:143605642-143605664 GAAGGGACACAGGGAGAGGCAGG + Exonic
1049663692 8:143832791-143832813 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1049785734 8:144449826-144449848 GCGGGCACACAGATGGGGGCGGG + Exonic
1049806707 8:144544284-144544306 GTGGGCACACAGAGGCAGGGTGG - Intronic
1049845084 8:144796696-144796718 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1051175137 9:14353026-14353048 GAGGGCACACAGAGGCAAGCTGG + Intronic
1051335387 9:16061272-16061294 GATGGAAAACTGAGGCAGGCAGG - Intronic
1051391998 9:16575372-16575394 GATGGAACATAAAGTGAGGCTGG - Intronic
1051471345 9:17446163-17446185 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1052279311 9:26715294-26715316 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1052676520 9:31633022-31633044 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1052902088 9:33801985-33802007 GAGGGAAGAGAGAAGGAGGGTGG - Intergenic
1053317462 9:37064116-37064138 GAGGGAAAAGGGAGGGAGGAAGG - Intergenic
1054322179 9:63681752-63681774 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1054843052 9:69763280-69763302 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1054941980 9:70753543-70753565 GAGGGAACCCAGATGGGAGCAGG + Intronic
1054945585 9:70792607-70792629 GAGGGGAAACAAAGGGAGACAGG + Intronic
1055729830 9:79268982-79269004 CAGGGAACACAGAGCATGGCAGG - Intergenic
1056233405 9:84569501-84569523 GATGGAACACAGGGGAAGGTAGG - Intergenic
1056541284 9:87573464-87573486 GAAGGAGCAGAGAGGGAGGGAGG + Intronic
1056771546 9:89481274-89481296 GAGGGTCCAGCGAGGGAGGCGGG + Intronic
1057020512 9:91693722-91693744 GAGGGAACCAGGAGTGAGGCAGG + Intronic
1057157800 9:92859421-92859443 GAGGGAACTTAGAGGGAGAGAGG + Intronic
1057461819 9:95269914-95269936 AAGGGAACTCAGAGGCTGGCGGG - Intronic
1057704982 9:97389729-97389751 GAGGGAACTGAGAGGGTGGAAGG - Intergenic
1058806312 9:108595407-108595429 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1059204240 9:112448850-112448872 AAAAGAACACAGAGAGAGGCTGG - Intronic
1059468019 9:114481667-114481689 GAAGGAGCAGAGAAGGAGGCAGG - Intronic
1060167425 9:121429908-121429930 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1060187507 9:121572727-121572749 GAGGCAAAACAGTGTGAGGCTGG + Intronic
1060394167 9:123303983-123304005 GATGGAACACAGAAGGATTCTGG + Intergenic
1060413520 9:123415283-123415305 GAGGAAACACACAGGGACGGGGG + Intronic
1060467126 9:123916737-123916759 GAAGGAACACGGTGGTAGGCAGG + Intronic
1060482095 9:124022634-124022656 GAGGTGACACAGAGGGATGACGG + Intronic
1060494164 9:124105718-124105740 AAGGGGACACAGAGGGAAGGAGG - Intergenic
1060549134 9:124476964-124476986 AGGGGAGGACAGAGGGAGGCAGG - Intronic
1060967645 9:127720803-127720825 GAGGGAAGAAAGAAGGAGGGAGG - Intronic
1061292189 9:129657073-129657095 GAGGGGACACAGAGGCACACAGG - Intergenic
1061554312 9:131357513-131357535 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1061855356 9:133439115-133439137 GGGGCAAGCCAGAGGGAGGCAGG - Intronic
1061882367 9:133574718-133574740 GAAGGAACACAGAGCGAAGCAGG - Intronic
1061890286 9:133615715-133615737 GAGGGTGCAGAGAGGGAGGCTGG - Intergenic
1061955340 9:133958576-133958598 AAGGGAACTCAGAGGCTGGCGGG + Intronic
1061972795 9:134053878-134053900 TGGGGAACACACTGGGAGGCAGG + Intronic
1061977665 9:134078774-134078796 GGAGGAAGAAAGAGGGAGGCAGG - Intergenic
1061979448 9:134092579-134092601 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1062143988 9:134978884-134978906 GAGGGAGGATAGAGGGAGGGAGG + Intergenic
1062144026 9:134978993-134979015 GAGGGAGGAGAGAGGGAGGGAGG + Intergenic
1062174294 9:135152482-135152504 GAGGGAGCACAGAGGGATGTAGG - Intergenic
1062328247 9:136023061-136023083 GAGGGAAGAGGGAGGGAGGAGGG + Intronic
1062328259 9:136023091-136023113 GAGGGAAGAGGGAGGGAGGAGGG + Intronic
1062407900 9:136406117-136406139 GGGAGACCACAGACGGAGGCAGG + Intronic
1062523624 9:136969687-136969709 GAGGCAGGGCAGAGGGAGGCTGG - Intronic
1185545412 X:939879-939901 GAGGAGACACAGAGAGAGACAGG - Intergenic
1185659982 X:1719924-1719946 GAAGGAAGAGAGAGGGAGGGAGG - Intergenic
1186122444 X:6378684-6378706 GAGGAAAGACAGAGGGAGAAAGG + Intergenic
1186483177 X:9911680-9911702 CAGGGAAGACAAAGGCAGGCTGG - Intronic
1186627413 X:11309332-11309354 GTGGGAACAGAGAAGGAGACAGG + Intronic
1186757288 X:12685348-12685370 GAGAGAAGAAAGAGGGAGGAAGG - Intronic
1187009238 X:15263572-15263594 GAGAGAAGAGAGAGGGAGACAGG - Intronic
1187198806 X:17115154-17115176 AAGGGAACTCAGAGGCTGGCAGG - Intronic
1187802009 X:23074425-23074447 GAGGGTAAACAGTGGGAGGAGGG + Intergenic
1187933950 X:24318090-24318112 CAGGGATCACAAAGGGAAGCTGG + Intergenic
1188004853 X:25010222-25010244 GAGGGAAGAGGGAGGGAGGAGGG - Intronic
1189089881 X:38070509-38070531 GAGAGAAACCAGAGGTAGGCAGG - Intronic
1189277042 X:39794295-39794317 GAAGGCACACAGATGGAGGTGGG + Intergenic
1189720986 X:43917415-43917437 GAGGGAACCCAGATGAAGCCTGG - Intergenic
1189966674 X:46380437-46380459 GAAGGAAGAAAGAGGGAGGGAGG + Intergenic
1189989495 X:46580721-46580743 GAGTGAACAGGGAAGGAGGCTGG + Intronic
1190214420 X:48470222-48470244 GGGGGCCCCCAGAGGGAGGCAGG + Intronic
1190334283 X:49253034-49253056 GAGGGCACTCAGAGGGAGACAGG + Intronic
1190866244 X:54387125-54387147 GAGAGAAGAAAGAGAGAGGCCGG - Intergenic
1191956041 X:66643241-66643263 GAGTAAACACAGATGGAGACAGG - Intergenic
1192433077 X:71125740-71125762 GAGGGAAGGGAGAGGGAGGGAGG - Intronic
1193099621 X:77593975-77593997 GAGGGAAAAAAGAGAAAGGCAGG + Intronic
1193563314 X:83047157-83047179 GAGTGAACACAGATGGTAGCAGG - Intergenic
1194739549 X:97556604-97556626 GAGGGCACACAGAGGTAAGAAGG - Intronic
1195731829 X:107976246-107976268 GAGGGAAATGAGAGGGAGGGAGG + Intergenic
1196843582 X:119880782-119880804 GAGGGACCAGAGAGGTTGGCAGG + Intergenic
1197383912 X:125780313-125780335 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1197816750 X:130505660-130505682 GAGGAAACAGGGAGGGAGGGAGG - Intergenic
1198294225 X:135270106-135270128 GAGGGAGCAGTGAGGGAGGTGGG + Intronic
1198297624 X:135302880-135302902 AAGGGAACTCAGAGGCCGGCGGG - Intronic
1198308635 X:135406901-135406923 AAGGGAACTCAGAGGCCGGCGGG + Intergenic
1198428407 X:136542142-136542164 GAGGGGAGAGAGAAGGAGGCTGG - Intronic
1198499931 X:137233749-137233771 GAGGGAAATCAGGGGAAGGCAGG - Intergenic
1198853863 X:140995530-140995552 AAGGGAACACACAGACAGGCAGG + Intergenic
1198878151 X:141249576-141249598 AAGGGAACACACAGACAGGCAGG - Intergenic
1199256158 X:145720984-145721006 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1199490007 X:148387594-148387616 AAGTGAAAACAGAGGTAGGCAGG - Intergenic
1199998080 X:153039386-153039408 GAGAGGACACAGAAAGAGGCAGG - Intergenic
1200691382 Y:6308223-6308245 GAGGGAACAAAGAGGAGGCCAGG + Intergenic
1200827423 Y:7659040-7659062 GAGGGAACAGAGAGGAAACCAGG + Intergenic
1200856369 Y:7942901-7942923 GAGTGACCTCAGAGGGGGGCTGG + Intergenic
1200951067 Y:8901165-8901187 GAGGGAACAGAGAGGAGGCCAGG - Intergenic
1200954305 Y:8929220-8929242 GAGGGAACAGAGAGGAGGCCAGG - Intergenic
1200958100 Y:8971546-8971568 GAGGGAACAGAGAGGAGGCCAGG - Intergenic
1200986195 Y:9305060-9305082 GAGGGAACAGAGAGGAGGCCAGG + Intergenic
1201018347 Y:9626382-9626404 GAGGGAACAGAGAGGAGGTCAGG + Intergenic
1201043890 Y:9866493-9866515 GAGGGAACAAAGAGGAGGCCAGG - Intergenic
1201890906 Y:18942829-18942851 GAGGGGAGACAGAGAGAGGAAGG + Intergenic
1202110176 Y:21409430-21409452 GAGGGAACAGAGAGGAGGCCAGG + Intergenic
1202115133 Y:21464990-21465012 GAGGGAACAGAGAGGAGGCCAGG - Intergenic
1202124387 Y:21555841-21555863 GAGGGAACAGAGAGGAGGCCAGG - Intergenic
1202154621 Y:21873539-21873561 GAGGGAACAGAGAGGAGGCCAGG + Intergenic
1202161766 Y:21941582-21941604 GAGGGAACAGAGAGGAGGTCAGG + Intergenic
1202195599 Y:22296250-22296272 GAGGGAACAGAGAGGAGGCCAGG + Intergenic
1202229590 Y:22644791-22644813 GAGGGAACAGAGAGGAGGTCAGG - Intergenic
1202253092 Y:22893182-22893204 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1202313566 Y:23551374-23551396 GAGGGAACAGAGAGGAGGTCAGG + Intergenic
1202406082 Y:24526931-24526953 AAGGGAACTCAGAGGCTGGCGGG - Intergenic
1202464700 Y:25143150-25143172 AAGGGAACTCAGAGGCTGGCGGG + Intergenic
1202557237 Y:26119221-26119243 GAGGGAACAGAGAGGAGGTCAGG - Intergenic