ID: 1144581077

View in Genome Browser
Species Human (GRCh38)
Location 17:16459942-16459964
Sequence GTGTTGAAGTGGTCTGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 216
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144581070_1144581077 24 Left 1144581070 17:16459895-16459917 CCCACTCTGGCTGGCTCTGATTT 0: 1
1: 0
2: 3
3: 32
4: 247
Right 1144581077 17:16459942-16459964 GTGTTGAAGTGGTCTGAGGAAGG 0: 1
1: 0
2: 0
3: 19
4: 196
1144581071_1144581077 23 Left 1144581071 17:16459896-16459918 CCACTCTGGCTGGCTCTGATTTT 0: 1
1: 0
2: 2
3: 43
4: 664
Right 1144581077 17:16459942-16459964 GTGTTGAAGTGGTCTGAGGAAGG 0: 1
1: 0
2: 0
3: 19
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144581077 Original CRISPR GTGTTGAAGTGGTCTGAGGA AGG Intronic
902991090 1:20187367-20187389 GTGGTGAAGTGAACTGAGCAGGG + Intronic
903337290 1:22633618-22633640 CTGTTGAAGTGGGCAGATGAAGG - Intergenic
905037177 1:34925779-34925801 GAGTGGAAGTGGGCTGGGGATGG - Intronic
906186703 1:43867565-43867587 GTGGTGAAGTTGTGTGGGGAAGG + Intronic
908863072 1:68512263-68512285 GTGTTGCAGTGGTGTGATCATGG + Intergenic
909136070 1:71802053-71802075 GTGTTCTAGTGATCTGTGGAAGG + Intronic
912175723 1:107153864-107153886 TTGTTGGAGAGGTCTTAGGAAGG + Intronic
912443457 1:109715853-109715875 GTGTTGAAGTGCTCTGTGCTGGG + Intronic
915518870 1:156429865-156429887 GTGATTAAGTGGTGTGTGGAGGG + Intronic
916894807 1:169151438-169151460 GTTCTGTAGAGGTCTGAGGATGG - Intronic
918830987 1:189398276-189398298 GTGCTGAAGAAGTCTGTGGAAGG + Intergenic
921437938 1:215148807-215148829 GTGTGAAAGTGGTGTGAGGTGGG + Intronic
922391878 1:225152185-225152207 GAGTGGAAGTGTTCAGAGGATGG - Intronic
922989843 1:229897201-229897223 GTGGTTAAGTGACCTGAGGAGGG + Intergenic
924093612 1:240527558-240527580 GTTTATAAGAGGTCTGAGGAAGG + Intronic
1066305647 10:34137914-34137936 GTGTGGGGGCGGTCTGAGGAGGG - Intronic
1067427163 10:46218993-46219015 ATGGTGGAGTGGGCTGAGGATGG + Intergenic
1067427172 10:46219031-46219053 ATGGTGGAGTGGGCTGAGGATGG + Intergenic
1067582577 10:47454766-47454788 ATGTTGGAGTGAGCTGAGGATGG + Intergenic
1067582589 10:47454823-47454845 ATGGTGGAGTGGGCTGAGGATGG + Intergenic
1067868882 10:49939240-49939262 GTGTTTAAAGGGTATGAGGAAGG - Intronic
1070484007 10:76912476-76912498 GAGGTGAAATGGTCTGAGGAGGG + Intronic
1071909456 10:90214500-90214522 ATGTTGAACTGCTCTAAGGATGG - Intergenic
1072348236 10:94530115-94530137 GTGCTGATGGGGTTTGAGGAAGG - Intronic
1073591737 10:104764296-104764318 CTGATGAAGCGGTCTGAGGTGGG + Intronic
1074085737 10:110207956-110207978 GTGTTGAAAATGTCTGAGAAGGG - Exonic
1074976049 10:118582579-118582601 GTGTTGAAGATGTGTGAGCATGG + Intergenic
1075944445 10:126420034-126420056 GTGTTGAGGGGGTGGGAGGAGGG + Intergenic
1076857240 10:133123447-133123469 GTGTGGATGTGGCATGAGGACGG - Intronic
1077264414 11:1641929-1641951 GGGTGGAAGTGGTCTGGGGTGGG - Intergenic
1078668978 11:13348371-13348393 CTATTGCAGTGGTCTGAGCAAGG + Intronic
1078737754 11:14036170-14036192 CTGTTGAAATACTCTGAGGAAGG + Intronic
1079241743 11:18726736-18726758 CTGTTGAAGTGGGAAGAGGAAGG - Intergenic
1081302551 11:41470313-41470335 GGCCTGGAGTGGTCTGAGGAGGG - Intergenic
1081694317 11:45099000-45099022 GTATTGAAGTGGACTGGAGAGGG + Intronic
1082760838 11:57125367-57125389 TTGTTGGAGAGGTCTGAGCATGG - Intergenic
1083447005 11:62714876-62714898 GTGATGAGGTGGTGTGGGGAGGG - Exonic
1089136612 11:116254342-116254364 GTGTTCAAGTGTTCTGAGCCAGG - Intergenic
1089623363 11:119735590-119735612 GTGTTGAAGTGCTGCCAGGATGG + Intergenic
1090597237 11:128333326-128333348 GTATTGCAGGGGTCTGAGCATGG - Intergenic
1090735265 11:129607292-129607314 GTGTTGGAGTTGACTGGGGATGG - Intergenic
1091165212 11:133469527-133469549 GAATTGAAGTGGGCTGAGGCTGG - Intronic
1092617346 12:10227209-10227231 ATTTTGAAGTGGTGTGTGGAGGG + Intergenic
1093063281 12:14629822-14629844 ATTTTGAAGTGGTCTTAGTAGGG + Intronic
1093551162 12:20413419-20413441 GTGGAAAAGTGGGCTGAGGAAGG + Intronic
1099475432 12:83103141-83103163 CTGTAGAAGTGACCTGAGGATGG + Intronic
1099820433 12:87701953-87701975 GTGGTGTAGTGTTATGAGGATGG + Intergenic
1101413832 12:104491781-104491803 GTGCTGAAGTGTTTTGAGAAGGG - Intronic
1102537692 12:113593404-113593426 AGATTGAATTGGTCTGAGGAGGG - Intergenic
1108740287 13:53330576-53330598 GTGTGGAAGTTGTCGGAAGAGGG + Intergenic
1109629940 13:65033027-65033049 GTGTGGGTGTGGTCTGAGGTGGG + Intergenic
1109641200 13:65193978-65194000 ATGTTGAAGTATTCTGAGGAAGG + Intergenic
1110863040 13:80365289-80365311 GTGTTAAAATGATCTGATGATGG - Intergenic
1110965435 13:81689238-81689260 GTGATGAACTGGTCTCTGGAAGG - Intergenic
1113040828 13:106102234-106102256 GTGTTCAGGGGGTCTGAGGAAGG - Intergenic
1115016020 14:28615449-28615471 CTATTGTAGTGGCCTGAGGAAGG - Intergenic
1115227680 14:31121271-31121293 GTGTGGAAGGGGTGAGAGGAGGG - Intronic
1118774099 14:68962563-68962585 GTGTTGAAGTAGTCTCAGGTTGG - Intronic
1119689627 14:76661437-76661459 GTGTTGCAGTGGGCTGAATAAGG - Intergenic
1119852346 14:77875054-77875076 GTGCTGAGGGGGTCTGAGGCTGG + Intronic
1121660252 14:95629843-95629865 GTGTAGAAGTGGTTTAAGGGAGG - Intergenic
1122340367 14:101024182-101024204 GTCCTGAAGTCATCTGAGGAGGG - Intergenic
1122648819 14:103213758-103213780 GTATTGAGGTGGTCTGGGAAAGG - Intergenic
1125432005 15:39605006-39605028 GTGTTGCAGTGGTTTGAAGTGGG - Intronic
1125433961 15:39626298-39626320 GTGTTGAGCTGGCCTGAAGATGG + Intronic
1125655289 15:41351734-41351756 GGGGTGAAGTGGTATGAAGATGG - Intronic
1125882582 15:43207312-43207334 GTCTGGAAGTGCTGTGAGGATGG - Exonic
1128702167 15:69812786-69812808 GTGTTGAAGGATTCTGAGCAGGG - Intergenic
1128991749 15:72266612-72266634 ATGTTGATGTGGTCTGAGCATGG - Intronic
1129965839 15:79734754-79734776 GTGTAGCAGTGGTCAGAGCACGG + Intergenic
1131765711 15:95673665-95673687 ATGTTGCTGTGGGCTGAGGAAGG - Intergenic
1132553972 16:564693-564715 GTGATGCTGTGGCCTGAGGACGG + Exonic
1136084913 16:27877879-27877901 ATGGTGAAGTGTTCTGAGCAGGG - Intronic
1138249670 16:55492093-55492115 GTGTTGACCTGGTCTTGGGAAGG + Intronic
1138883289 16:61042964-61042986 GTGCTGAAGTGGGCAGAGAAGGG + Intergenic
1139490740 16:67284713-67284735 GCCTTGACGTGGGCTGAGGAGGG + Exonic
1140048539 16:71459066-71459088 CTGTAGAACTGGACTGAGGATGG - Intronic
1140795716 16:78435582-78435604 TTGTTGAAGTTGTCTGTGGAGGG + Intronic
1141673304 16:85504187-85504209 TTGGTGAAGTGGGCTGAGGAGGG + Intergenic
1142746723 17:1963111-1963133 GTGTTTTAATGGTCAGAGGAGGG + Intronic
1144581077 17:16459942-16459964 GTGTTGAAGTGGTCTGAGGAAGG + Intronic
1149525368 17:57351366-57351388 GTGTTGATGAGGACTGGGGAGGG - Intronic
1149847293 17:60015562-60015584 GTGTGGCTGTGGCCTGAGGATGG - Intergenic
1150085651 17:62272179-62272201 GTGTGGCTGTGGCCTGAGGATGG - Intergenic
1151251575 17:72839819-72839841 GTGTTGAAGTGGTTAGGTGATGG + Intronic
1151282533 17:73087672-73087694 GTGTAGAAGGGGTGTAAGGATGG + Intronic
1151808740 17:76423178-76423200 GGGTGGATGTGGGCTGAGGAAGG + Intronic
1155994287 18:32313425-32313447 GTTATGATGTGGTCTAAGGAGGG + Intronic
1157054994 18:44217027-44217049 TTGATAAAGTGGTCTGATGAAGG + Intergenic
1157069958 18:44394741-44394763 GGGCTGAAGTGGTTTGAGAAAGG + Intergenic
1159681787 18:71363019-71363041 GTGTGGAAAAGGTCTGAGGTCGG - Intergenic
1161041843 19:2114600-2114622 GTGAGGACGTGGTCTGGGGAAGG + Intronic
1161269643 19:3382751-3382773 GTGATGTGGTGGTCTGAGGGGGG + Intronic
1165407139 19:35637822-35637844 GTGTGGAAGAGGTTTGAAGAGGG - Intergenic
1167418142 19:49387981-49388003 TTGGTGAAATGGGCTGAGGAAGG - Intergenic
1168289067 19:55348150-55348172 GTTTTGAAGGGATGTGAGGAGGG + Intergenic
926840412 2:17073633-17073655 GTGTTCCAGTGTTTTGAGGAAGG + Intergenic
926992045 2:18690450-18690472 CTGTAGAAGGGGTCTGAGTAGGG - Intergenic
927373736 2:22388728-22388750 GTGTTCAAGTGGTTTAAGGCAGG - Intergenic
929273916 2:40005061-40005083 GTGGAGAAGTTGTCTGAGGATGG + Intergenic
929489666 2:42385066-42385088 TTGTTGAATTGATTTGAGGAAGG - Intronic
930058023 2:47266817-47266839 GTGTAGATGGGGTCTGAGGATGG + Intergenic
930809527 2:55525998-55526020 ATGATGGAGTGGTCTGGGGAGGG - Intronic
931027733 2:58132251-58132273 ATGTTGAAGTAGTCTGAGCTTGG + Intronic
933979578 2:87539168-87539190 GTGAGGAAGTGGTCTGAGTGTGG + Intergenic
934949588 2:98567256-98567278 CTGTTAAAGTGGTCAGTGGAAGG + Intronic
936314244 2:111411623-111411645 GTGAGGAAGTGGTCTGAGTGTGG - Intergenic
936933576 2:117815333-117815355 GTGTGGAAGTGGGTAGAGGAAGG - Intronic
936973060 2:118193128-118193150 GTTTGGAGGTGCTCTGAGGAAGG + Intergenic
937541280 2:122957142-122957164 GAGTTGAAGAGGTGTGAAGATGG - Intergenic
937990884 2:127661671-127661693 GTGCTGGAGAGGGCTGAGGAAGG - Intronic
939272183 2:139954193-139954215 TTGTTGCAGTGGCCTGAGCATGG + Intergenic
940275709 2:151938465-151938487 GTGTAGAGGTGGTGTCAGGAAGG + Intronic
940749767 2:157612380-157612402 GTGTTGCAGTGGTATGAGTGAGG + Intronic
944283864 2:197925749-197925771 GTGTAGAGGAGGTCTGAGGGAGG - Intronic
944976789 2:205062545-205062567 GAGTGGAAGTGCACTGAGGATGG + Intronic
948102014 2:235382795-235382817 ATGGTGAAGAGGTCTGAGGCGGG - Intergenic
948282895 2:236761976-236761998 ATGTTTAGCTGGTCTGAGGAGGG + Intergenic
1169616951 20:7458716-7458738 ATCTGAAAGTGGTCTGAGGAAGG - Intergenic
1174137956 20:48393419-48393441 GTGGTGATGGGGTCTGTGGACGG + Intergenic
1175312260 20:58020035-58020057 GTGTTGGCATGGTGTGAGGATGG + Intergenic
1177507224 21:22034662-22034684 GTGTTGAAGTGCTCTCTGGTGGG + Intergenic
1177906599 21:26978977-26978999 GTGTTGAGGTGGTTGGAGGGTGG + Intergenic
1179810804 21:43867946-43867968 ATGATGAAGTGGTTTTAGGAAGG - Intronic
1184005654 22:41706556-41706578 CTGTTGAAGTGGACTGAGCATGG + Intronic
1185025576 22:48408738-48408760 GTGGTGAAGGGATGTGAGGATGG - Intergenic
1185413283 22:50697139-50697161 GTCTGGGAGTGGTCTGGGGAAGG + Intergenic
949945269 3:9185006-9185028 GTCTTGAACTAGTCTGGGGAGGG - Intronic
950377084 3:12580788-12580810 GTGGTGAAGTTCTCTGAGGACGG - Intronic
952806121 3:37354184-37354206 GAGTGGAAGTGATCTGGGGAAGG - Intronic
954428711 3:50457857-50457879 GTGATGATGGGGACTGAGGAGGG + Intronic
954893837 3:53958336-53958358 CTGTTGAAGAAGACTGAGGAGGG - Intergenic
955204733 3:56885595-56885617 GTGTTGAATTGGTCTGGAGAGGG - Intronic
955568706 3:60278505-60278527 GTGGTGATGAGGTCTCAGGAAGG - Intronic
955651239 3:61196540-61196562 TTGCTGAATTGGGCTGAGGATGG + Intronic
957396915 3:79652316-79652338 GTGTGGAAGAGGTCTGAGAATGG - Intronic
961713144 3:128842361-128842383 CTGTGGAAGTCTTCTGAGGAAGG + Intergenic
962271784 3:133982730-133982752 CTGTTGCAGTGATCTGAGGAGGG - Intronic
964376862 3:156056387-156056409 GTGTTGTAGTGGCCTTTGGAAGG + Intronic
966302831 3:178497956-178497978 GTGTTGGAGGGGTAGGAGGAGGG - Intronic
967272317 3:187741748-187741770 GTGTTGAGGAGGTTTGTGGATGG - Intronic
968555809 4:1245911-1245933 GTGTTGAAGGAGAGTGAGGATGG - Intronic
969333412 4:6492976-6492998 GTGTTGGAATGGAGTGAGGAGGG - Intronic
971601177 4:28594013-28594035 GTGTGCAAGTGTTCTCAGGAAGG + Intergenic
971865216 4:32161268-32161290 CTGTTGAAGTATTCTGAGGTAGG - Intergenic
973118006 4:46485613-46485635 GTGAGTCAGTGGTCTGAGGAAGG + Intergenic
974744784 4:66057838-66057860 GTGTTCAAGTGATTTGTGGAAGG - Intergenic
975012187 4:69370245-69370267 ATGGTGAAGGGGTGTGAGGATGG - Intronic
975134168 4:70857955-70857977 TTGTTGAAGTGGTGTTGGGAAGG + Intergenic
981088743 4:140710733-140710755 GTGGGGGGGTGGTCTGAGGAAGG + Intronic
983077406 4:163343575-163343597 GTCTTGGACTGGTGTGAGGATGG - Intronic
985181584 4:187270781-187270803 TTGTGGAAGTGATCTGAGCAGGG - Intergenic
986144805 5:5067375-5067397 GTGTTGGGGTGGTCGGGGGATGG - Intergenic
987326014 5:16812182-16812204 GTCTTGAAGTGGCCAGAGGAAGG + Intronic
989688537 5:44115452-44115474 GTGGTGAAGTGGTGTCATGAGGG + Intergenic
991400577 5:66246884-66246906 TTGTTTAATTGGTCTGAGGTGGG - Intergenic
993887534 5:93433648-93433670 GTGTTAAAGTGGCCTGAAGTAGG + Intergenic
996440631 5:123486283-123486305 GTGTTTAAGTGGTCAGAATATGG - Intergenic
997228443 5:132226969-132226991 GAGCTGGAGTGGTCAGAGGAAGG - Exonic
999921704 5:156328753-156328775 GTGTTGGGGTGGTGTGGGGAGGG + Intronic
1000287430 5:159838616-159838638 ATGTTCAAGTGATGTGAGGAAGG + Intergenic
1001932161 5:175680916-175680938 GTGTTGAAAAGGACTGAGGAAGG + Intronic
1002136605 5:177111736-177111758 GTGTTTCAGGGGCCTGAGGAGGG + Intergenic
1002693604 5:181069416-181069438 GTGTTGAAGTGGTGAGAGGGGGG - Intergenic
1004460381 6:15829681-15829703 ATGTTGAAGGGGGTTGAGGAAGG + Intergenic
1004525510 6:16403712-16403734 AAGATGAAGTGGTCAGAGGATGG - Intronic
1004917402 6:20344815-20344837 TTGTTGGAGAGTTCTGAGGAGGG - Intergenic
1005274811 6:24205238-24205260 GTGGTGTGGTGGTCGGAGGAGGG - Intronic
1005384849 6:25275802-25275824 GTGTTCAAGTGTTCTGAAGTTGG + Intergenic
1005976198 6:30801627-30801649 GTGGAGAAGTGGGCAGAGGAAGG + Intergenic
1006640257 6:35485975-35485997 GTGGGGAAGGGGACTGAGGAGGG + Intronic
1006741481 6:36312242-36312264 GGGCTGAAGTGGTCTCCGGATGG - Intergenic
1006843709 6:37048505-37048527 GGGTCTCAGTGGTCTGAGGAGGG - Intergenic
1009888442 6:69652877-69652899 GTGCTAAAGTGGGCTGAAGAGGG - Intergenic
1010829120 6:80509281-80509303 GTGCTGAATGGGTCTCAGGAGGG + Intergenic
1012370066 6:98493341-98493363 GTGTTAAGTTGGTATGAGGATGG + Intergenic
1012485133 6:99712613-99712635 GTGCTTAACTGTTCTGAGGAAGG + Intergenic
1013854696 6:114558099-114558121 GTCTAGAAGAGGTCTGAGGGTGG + Intergenic
1016814299 6:148289465-148289487 GCAGTGAAGTGGTCAGAGGAAGG + Intronic
1020409669 7:7877047-7877069 GTGTTTAAGGGGTCTGTGGGTGG + Intronic
1023386077 7:39659165-39659187 GGGATGAAATGGTCTGAGGCAGG + Intronic
1024877991 7:54047502-54047524 ATGTTTAGGTGGTCTGAGGTTGG + Intergenic
1026257854 7:68728001-68728023 ATGTTGAAGGGGTTTGAGGGTGG + Intergenic
1026324249 7:69295142-69295164 GGGCTGAAGTGGTGTGAGGAAGG + Intergenic
1033653872 7:143361193-143361215 GTGGTGAACCGGACTGAGGAGGG + Intronic
1035548589 8:502646-502668 GTGTTGATGTGTGCTGAGGTGGG - Intronic
1035548599 8:502699-502721 GTGTTGATGTGTGCTGAGGTGGG - Intronic
1036697105 8:10982774-10982796 GTGTTGAAGTGACCAAAGGAAGG + Intronic
1037454881 8:19053163-19053185 GTGTTAAAGTCATCTTAGGAAGG + Intronic
1038229870 8:25689924-25689946 GTGTTTCAGGGGTCTGAGGAAGG - Intergenic
1045375981 8:101574575-101574597 GTTCTGAAGTGGTAGGAGGAGGG - Intronic
1045411780 8:101927450-101927472 GTGATGAAGGTGTCTGAGCAAGG + Intronic
1046446179 8:114323004-114323026 GTGTTAAAGTGATCTGAGCTGGG + Intergenic
1048296599 8:133219285-133219307 CTGTGGGAGAGGTCTGAGGAGGG - Intronic
1048949419 8:139483072-139483094 TTGTTGCAGTGCTCTTAGGATGG - Intergenic
1049286690 8:141779658-141779680 GTGTTGGTGTGGTGTGATGATGG + Intergenic
1049400747 8:142425898-142425920 GTGTGCATGTGGTCAGAGGAAGG - Intergenic
1049996492 9:1040063-1040085 GAGTTGAAGAGGTCTTAGGCTGG + Intergenic
1051671157 9:19512064-19512086 TTGTTAAAGTGGTCTGGGGGTGG + Exonic
1055866847 9:80824599-80824621 GTGTGGAACTGGCCTAAGGATGG + Intergenic
1056578231 9:87871910-87871932 ATGTTGAAGTGGGATGAGGCTGG - Intergenic
1057667116 9:97054690-97054712 GGGTGAAAGTGGTCTGGGGATGG + Intergenic
1058915331 9:109559356-109559378 GTGTTGAAGAAGTCCAAGGAAGG - Intergenic
1059741872 9:117159390-117159412 GTGTTGGAGTCTACTGAGGAAGG + Intronic
1186113733 X:6283084-6283106 GTGTTCATGTGAGCTGAGGACGG - Intergenic
1187913080 X:24128560-24128582 AGGTTGAAGTGATGTGAGGAAGG - Intergenic
1188862967 X:35279408-35279430 ATGTGGAGGTAGTCTGAGGAGGG + Intergenic
1189124611 X:38433199-38433221 AAATTGAAGTGGTATGAGGAGGG - Intronic
1190489060 X:50962904-50962926 GGGTGGAAGTGGGGTGAGGATGG + Intergenic
1193834814 X:86329090-86329112 GGATTGAAGTGGTGTGATGAGGG + Intronic
1194513333 X:94821623-94821645 GTGGGGAAGTGGTATGTGGATGG - Intergenic
1197643723 X:128994378-128994400 GTGTGGAAGGGGGATGAGGAGGG + Intergenic
1198456397 X:136821944-136821966 GTTTTGAAATGGTTTTAGGAAGG + Intergenic
1199656432 X:149999616-149999638 GTGCTGAACAGGTCAGAGGAAGG - Intergenic
1200986175 Y:9304967-9304989 GTGGGGAAGTGGTCTGTGAAAGG - Intergenic
1201517311 Y:14832329-14832351 GTGTAGATTTGGTCTGAGAATGG + Intronic