ID: 1144581232

View in Genome Browser
Species Human (GRCh38)
Location 17:16460604-16460626
Sequence CCTGTGTCCCGCCCGGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 169}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144581218_1144581232 10 Left 1144581218 17:16460571-16460593 CCCCATGGGCACTGACCACCCAG 0: 1
1: 0
2: 0
3: 20
4: 222
Right 1144581232 17:16460604-16460626 CCTGTGTCCCGCCCGGCTCTGGG 0: 1
1: 0
2: 1
3: 9
4: 169
1144581224_1144581232 -5 Left 1144581224 17:16460586-16460608 CCACCCAGGGACCACCGGCCTGT 0: 1
1: 0
2: 0
3: 20
4: 160
Right 1144581232 17:16460604-16460626 CCTGTGTCCCGCCCGGCTCTGGG 0: 1
1: 0
2: 1
3: 9
4: 169
1144581214_1144581232 21 Left 1144581214 17:16460560-16460582 CCTCCTCCTGCCCCCATGGGCAC 0: 1
1: 0
2: 3
3: 82
4: 569
Right 1144581232 17:16460604-16460626 CCTGTGTCCCGCCCGGCTCTGGG 0: 1
1: 0
2: 1
3: 9
4: 169
1144581209_1144581232 28 Left 1144581209 17:16460553-16460575 CCAGGCCCCTCCTCCTGCCCCCA 0: 1
1: 1
2: 34
3: 242
4: 2020
Right 1144581232 17:16460604-16460626 CCTGTGTCCCGCCCGGCTCTGGG 0: 1
1: 0
2: 1
3: 9
4: 169
1144581226_1144581232 -9 Left 1144581226 17:16460590-16460612 CCAGGGACCACCGGCCTGTGTCC 0: 1
1: 0
2: 5
3: 24
4: 262
Right 1144581232 17:16460604-16460626 CCTGTGTCCCGCCCGGCTCTGGG 0: 1
1: 0
2: 1
3: 9
4: 169
1144581217_1144581232 11 Left 1144581217 17:16460570-16460592 CCCCCATGGGCACTGACCACCCA 0: 1
1: 0
2: 1
3: 24
4: 200
Right 1144581232 17:16460604-16460626 CCTGTGTCCCGCCCGGCTCTGGG 0: 1
1: 0
2: 1
3: 9
4: 169
1144581213_1144581232 22 Left 1144581213 17:16460559-16460581 CCCTCCTCCTGCCCCCATGGGCA 0: 1
1: 0
2: 5
3: 66
4: 537
Right 1144581232 17:16460604-16460626 CCTGTGTCCCGCCCGGCTCTGGG 0: 1
1: 0
2: 1
3: 9
4: 169
1144581215_1144581232 18 Left 1144581215 17:16460563-16460585 CCTCCTGCCCCCATGGGCACTGA 0: 1
1: 0
2: 3
3: 27
4: 354
Right 1144581232 17:16460604-16460626 CCTGTGTCCCGCCCGGCTCTGGG 0: 1
1: 0
2: 1
3: 9
4: 169
1144581212_1144581232 23 Left 1144581212 17:16460558-16460580 CCCCTCCTCCTGCCCCCATGGGC 0: 1
1: 0
2: 7
3: 74
4: 665
Right 1144581232 17:16460604-16460626 CCTGTGTCCCGCCCGGCTCTGGG 0: 1
1: 0
2: 1
3: 9
4: 169
1144581219_1144581232 9 Left 1144581219 17:16460572-16460594 CCCATGGGCACTGACCACCCAGG 0: 1
1: 0
2: 0
3: 14
4: 163
Right 1144581232 17:16460604-16460626 CCTGTGTCCCGCCCGGCTCTGGG 0: 1
1: 0
2: 1
3: 9
4: 169
1144581221_1144581232 8 Left 1144581221 17:16460573-16460595 CCATGGGCACTGACCACCCAGGG 0: 1
1: 0
2: 1
3: 24
4: 253
Right 1144581232 17:16460604-16460626 CCTGTGTCCCGCCCGGCTCTGGG 0: 1
1: 0
2: 1
3: 9
4: 169
1144581225_1144581232 -8 Left 1144581225 17:16460589-16460611 CCCAGGGACCACCGGCCTGTGTC 0: 1
1: 0
2: 0
3: 11
4: 136
Right 1144581232 17:16460604-16460626 CCTGTGTCCCGCCCGGCTCTGGG 0: 1
1: 0
2: 1
3: 9
4: 169
1144581216_1144581232 15 Left 1144581216 17:16460566-16460588 CCTGCCCCCATGGGCACTGACCA 0: 1
1: 0
2: 2
3: 29
4: 230
Right 1144581232 17:16460604-16460626 CCTGTGTCCCGCCCGGCTCTGGG 0: 1
1: 0
2: 1
3: 9
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144581232 Original CRISPR CCTGTGTCCCGCCCGGCTCT GGG Intronic
903462830 1:23531093-23531115 CCTGGGGTCCGGCCGGCTCTGGG + Exonic
904046304 1:27610964-27610986 CCTGTGTCCTGCCCTGTGCTGGG - Intergenic
904751069 1:32741774-32741796 CCTGCGCCCCGCCCGCCGCTCGG + Intergenic
904976668 1:34461873-34461895 CCTGAGTCCCCTCAGGCTCTGGG + Intergenic
905029178 1:34870052-34870074 ACTGTGTCTGGCCAGGCTCTGGG - Intronic
911063714 1:93769298-93769320 CCTGTGTCCAACTTGGCTCTTGG - Intronic
913632583 1:120724186-120724208 CCTGCGTCCCGCTCTGCTGTGGG + Intergenic
918121547 1:181545453-181545475 CCTGTGTCCTGCAGGGCTGTGGG + Intronic
921138632 1:212285294-212285316 GCGGGGTCCCGCCCGCCTCTTGG - Intergenic
922586096 1:226736304-226736326 CCTGTGGCATGCCGGGCTCTGGG - Exonic
1063412594 10:5848011-5848033 CCTGTGTGCCACAGGGCTCTGGG - Intergenic
1063425357 10:5946242-5946264 CCTGTGACCCTCACGCCTCTGGG + Intronic
1063505167 10:6591284-6591306 CCTGTGCCCCTCTCTGCTCTGGG - Intergenic
1066665698 10:37780782-37780804 CCAGGGTCCCGCGCGGCTCGGGG - Intronic
1069881690 10:71597393-71597415 ACTGTTTCCCACCTGGCTCTTGG + Intronic
1070718667 10:78741178-78741200 CCTGTGGCCTCCCCGACTCTGGG + Intergenic
1074700481 10:116087793-116087815 CCTGTTCCCTGCCTGGCTCTAGG + Intronic
1075425620 10:122339604-122339626 CCTGTGTCCCTCCAGGCTCTGGG + Intergenic
1076348939 10:129801640-129801662 CCTGTGTTCCCCTCGGCTTTTGG - Intergenic
1076421407 10:130334930-130334952 CCTGAGGCCCACCTGGCTCTAGG - Intergenic
1077370430 11:2179322-2179344 CCTGTGGCCTGCACGGCCCTGGG + Intergenic
1079968578 11:27008074-27008096 CCTATCTCCCTCCTGGCTCTTGG + Intergenic
1081566373 11:44263600-44263622 TCTGTGTCCCTCCAGGCACTAGG - Exonic
1081907457 11:46678887-46678909 CCTCTGTCCAGCCCGCCTCACGG - Exonic
1081932541 11:46882025-46882047 TCAGTGTCCAGCCCAGCTCTGGG + Intronic
1084216402 11:67649016-67649038 CCTGTATCCGGCCCAGCCCTGGG + Intronic
1084609302 11:70191936-70191958 CCTGTGCCCTCCCAGGCTCTGGG - Intergenic
1085637407 11:78169221-78169243 CCTGTGTCCCAGGGGGCTCTGGG - Intergenic
1086467559 11:87070937-87070959 TATGTGTCCTGCCTGGCTCTGGG + Intronic
1090990032 11:131808844-131808866 CTTTTGTCCCGCCAGCCTCTGGG - Intronic
1091846061 12:3657128-3657150 GTTGTGTCCCGCTCGGCTCAGGG - Intronic
1092226061 12:6749009-6749031 CCTGTGTGCGGCCTGGCTCCTGG + Intronic
1092256223 12:6928041-6928063 CCCGCGGCCCGCCCGGCCCTCGG - Intronic
1096605412 12:52761528-52761550 GCTCTGTTCCGCCCAGCTCTCGG + Intergenic
1096771810 12:53939934-53939956 CCAGCCTCCCGCCGGGCTCTTGG + Intronic
1097030703 12:56087438-56087460 GCTGTGTCCCTCCCTGCCCTTGG - Intronic
1101866576 12:108524824-108524846 CCTGTGTCCCATCCACCTCTTGG - Intronic
1102785169 12:115598955-115598977 CCTGTCTCCAACCCTGCTCTAGG - Intergenic
1103568101 12:121827154-121827176 CTTGTGTCACGTCCTGCTCTTGG - Intronic
1104716420 12:131019212-131019234 CCACTGTCCCACCCGGCTCTAGG + Intronic
1104811717 12:131623524-131623546 CCTGTGTCCCTCCTGGGTCTGGG + Intergenic
1105630077 13:22155054-22155076 CCAGTGTTTCGCCCAGCTCTGGG - Intergenic
1106182298 13:27380265-27380287 CGTGTGTCAGGCCCAGCTCTGGG + Intergenic
1107793103 13:44022546-44022568 CCTGTGCCCTGCTGGGCTCTGGG - Intergenic
1113472926 13:110559514-110559536 CCTGTGTCCCTGCCAACTCTGGG + Intronic
1113899941 13:113791144-113791166 CCTGTGTCCTGCCCAGGGCTGGG + Intronic
1116895623 14:50312408-50312430 CCCTAGTCCCGCCCGGCTCGGGG - Exonic
1121127565 14:91417857-91417879 CCCGCGCCCCGCCCGGGTCTGGG + Intergenic
1121243679 14:92447700-92447722 CCTCTTTCCCGCCCTGCTCTGGG + Intronic
1121645851 14:95516659-95516681 CCTGCGTCCCGGGCGGCTCCGGG + Intronic
1122935907 14:104956103-104956125 CCTGTGTCCTGCAGAGCTCTTGG + Intronic
1125482094 15:40088167-40088189 CCAGTGCCCCTCCCTGCTCTGGG - Exonic
1125849057 15:42886511-42886533 CCTCTGGCCCGCCTGGGTCTAGG - Intronic
1129423934 15:75451494-75451516 CCTGTGCCCCGCGCCGTTCTCGG - Exonic
1132544544 16:527343-527365 TCCGTGTCCCGCGGGGCTCTGGG - Intergenic
1132588806 16:717500-717522 CCTGTGTCCAGCCCAGCCTTGGG + Exonic
1132819155 16:1853755-1853777 CCTGTGTCCTGCCCTGCTCCAGG + Intronic
1132895318 16:2226360-2226382 CCTGTGTCTCACTCGGCTCCAGG - Intronic
1133304776 16:4802144-4802166 CCTGAGTCCCGCCCGGCCTCGGG - Intronic
1134119620 16:11574596-11574618 CCTGGGTCCTTCCCGCCTCTGGG + Intronic
1134225297 16:12385437-12385459 ATTGTGTCCCGCAGGGCTCTAGG + Intronic
1135601612 16:23788509-23788531 CCTGTGTCAAGCACTGCTCTAGG - Intergenic
1137716191 16:50599764-50599786 CCCGTGCCCTGCCTGGCTCTGGG + Intronic
1138474254 16:57261394-57261416 CCTGTGTCCTTCCTGGCTCATGG + Intronic
1142354163 16:89594268-89594290 GCTGTGCCCAGCCTGGCTCTCGG - Intronic
1142602541 17:1061263-1061285 CCTGTTTCCCACCCGCCCCTGGG - Intronic
1142615958 17:1135256-1135278 ACTGAGTCCTGCACGGCTCTCGG - Intronic
1142861560 17:2765264-2765286 CCTGTGTCCAGCCCAGCACCAGG + Intergenic
1144581232 17:16460604-16460626 CCTGTGTCCCGCCCGGCTCTGGG + Intronic
1144682443 17:17204853-17204875 CCAGGGTCCCTCCCTGCTCTGGG - Intronic
1144742328 17:17590978-17591000 CCTGTCTCCCAGCCGGCCCTGGG - Intronic
1145278084 17:21447814-21447836 CCTGTGTCCCCACCGTCTATAGG + Intergenic
1145714334 17:27005625-27005647 CCTGTGTCCCCACCGTCTATAGG + Intergenic
1145963716 17:28902527-28902549 TCTGTGTCCCGGCGGGTTCTCGG + Intronic
1146022853 17:29293655-29293677 TGTGTGTCCCCTCCGGCTCTGGG - Intronic
1150409364 17:64930514-64930536 TCTGTCTCCTGCCCGGCCCTGGG + Intergenic
1151517520 17:74606016-74606038 CCTGTGTCCCGCCAAGCTCGAGG - Intergenic
1151714730 17:75825459-75825481 CTGGTGTCCCGCCCTGTTCTGGG + Exonic
1152583727 17:81180105-81180127 CCTGTCTCCAGCCCGGATCTCGG + Intergenic
1152679094 17:81656492-81656514 CCTGAGACCCGCCCTGCACTTGG - Exonic
1157967356 18:52223267-52223289 CCTGTGTCCCTCCAGGGTCGTGG + Intergenic
1160808094 19:1001245-1001267 CCTGGTCCCCACCCGGCTCTGGG + Intronic
1161592409 19:5134746-5134768 CCTGTGCGCCGGCCGGGTCTGGG + Intronic
1162440630 19:10690043-10690065 CCGGTGTCCCACCAGGCTCCAGG + Exonic
1165102831 19:33449026-33449048 CCTCTGTCCCGTCAGGGTCTTGG - Intronic
1165135493 19:33665856-33665878 CCAGTGGCCCACCCAGCTCTGGG + Intronic
1165824267 19:38696775-38696797 CCTGTGTCAGGTCCGGATCTGGG + Intronic
1166781242 19:45344824-45344846 CGTGTGTCCCGACAGGCCCTGGG + Intronic
1167154627 19:47730410-47730432 CCTGTGTCCTGAACGGCACTGGG - Intronic
1167209220 19:48122640-48122662 CCCGTGTCGGGCCAGGCTCTTGG - Intronic
1167876901 19:52421410-52421432 TCTGTCTCCCGCCCGTCCCTGGG - Intergenic
1168154212 19:54464163-54464185 CATGTGTCCCGCCCCGTTCCGGG + Intergenic
926210947 2:10868954-10868976 CCTGTGTCCCGCAGGCCCCTAGG - Intergenic
929014971 2:37484967-37484989 CCTGTCTCCCTCCCCACTCTGGG - Intergenic
931207338 2:60160621-60160643 CCTGTGTCCTCCTCTGCTCTGGG - Intergenic
932277436 2:70462152-70462174 CCTGTGACTTGCCCGGCCCTGGG - Intronic
934156429 2:89205253-89205275 CCAGAGTCCCGGCCGGTTCTGGG - Intergenic
934210889 2:89977507-89977529 CCAGAGTCCCGGCCGGTTCTGGG + Intergenic
935557753 2:104528795-104528817 CCTCTGACCAGCCCGGCACTGGG - Intergenic
941164514 2:162071181-162071203 CCTGTTTCCCACCCTCCTCTGGG + Intronic
946203859 2:218089433-218089455 CCTGTGTCCCTCCCTTCCCTGGG - Intronic
947846818 2:233251475-233251497 CCTCCTTCCCGCCCGGCGCTGGG + Intronic
1170663246 20:18363050-18363072 CCTGTGTCCTGCCCTTCTCTGGG - Intergenic
1171454102 20:25257270-25257292 CCTGTGGCCCGGCAGGCCCTGGG + Intronic
1171877760 20:30594212-30594234 TCTGTGTCCCTGCCGGCTCAGGG + Intergenic
1174448708 20:50607374-50607396 CCTGTGTCCAGCCTTGCACTCGG + Intronic
1174452664 20:50629523-50629545 CCTGTGTCTCCTCCGGCTTTAGG - Intronic
1175515269 20:59566034-59566056 CCTGTGTCCAGCTCAGCACTGGG + Intergenic
1175625351 20:60484662-60484684 CCTGTGTCCCCCTCAGCCCTCGG + Intergenic
1175727893 20:61332011-61332033 CCTGTGCCTGGCCCTGCTCTGGG - Intronic
1176219691 20:63964070-63964092 CCTGTGGCCCACCCAGCTCCAGG - Exonic
1178487974 21:33030813-33030835 GCTGTGTCCAGCCAGGCTTTGGG + Intergenic
1178910074 21:36667195-36667217 CCTGTGGCCCTGCCGGTTCTCGG + Intergenic
1179435717 21:41360805-41360827 CCTCTGTCCGCCCGGGCTCTTGG + Intergenic
1179829110 21:43985025-43985047 CCAGTGTGGCGCCTGGCTCTGGG - Exonic
1180963979 22:19776167-19776189 CCCGTGTCCACCCCAGCTCTGGG + Intronic
1181520839 22:23448561-23448583 CCTGGGCCCCGCCTGGCTGTGGG - Intergenic
1181520854 22:23448594-23448616 CCTGGGCCCCGCCTGGCTGTGGG - Intergenic
1181520881 22:23448660-23448682 CCTGGGCCCCGCCTGGCTGTGGG - Intergenic
1181520896 22:23448693-23448715 CCTGGGCCCCGCCTGGCTGTGGG - Intergenic
1181520971 22:23448858-23448880 CCTGGGCCCCGCCTGGCTGTAGG - Intergenic
1181521001 22:23448924-23448946 CCTGAGCCCCGCCTGGCTGTGGG - Intergenic
1181688446 22:24544720-24544742 ACTGTGCCCAGCCCTGCTCTAGG - Intronic
1182355869 22:29722005-29722027 CCTTTGTCCCCTCCGGCCCTGGG + Intronic
1183146267 22:35995438-35995460 ACTGTCTCCCGGCAGGCTCTGGG - Intronic
1183734440 22:39636045-39636067 CCTGTGCCAAGCCCTGCTCTAGG - Intronic
1184792085 22:46706338-46706360 CCTGTGTGCCGCCGACCTCTCGG - Intronic
1184837857 22:47034612-47034634 CCTGTGCCCCGGCTGTCTCTGGG + Intronic
951901281 3:27660135-27660157 CCTGAGTCCAGCCCTGCTCAAGG - Intergenic
952011271 3:28903354-28903376 CCGGTGGCCCGCCCTGCTGTGGG + Intergenic
956978899 3:74614347-74614369 CCTGTGGCCCGGCCGGCGCCAGG + Intergenic
961688245 3:128650408-128650430 CCTGTGCCCCGCCCGCCGCCCGG + Intronic
962200897 3:133400297-133400319 CGTGTGACCCGCCGGGCCCTCGG + Exonic
966767727 3:183478200-183478222 CCTGTCTCCCCCCAGGCCCTGGG - Intergenic
968285553 3:197506546-197506568 GCTGAGTCCAGCCCAGCTCTGGG + Intergenic
968896252 4:3405527-3405549 CCTGAGTTCCACCCTGCTCTGGG + Intronic
973582605 4:52359023-52359045 CCTGTGTCCCAGCAGGCGCTTGG + Intergenic
973623681 4:52751149-52751171 CCTGTGCCTCGCGCGGCCCTGGG + Intronic
978282621 4:107035943-107035965 CCTTGGTCCCGCCGGGATCTCGG + Exonic
979453475 4:120900224-120900246 CCTGTGTCCCCCTCACCTCTAGG - Intronic
984764350 4:183388211-183388233 CCTGTGGCCCCCCAGCCTCTCGG + Intergenic
985298283 4:188458539-188458561 GCTGTTTCACGCCAGGCTCTGGG + Intergenic
985541472 5:489434-489456 CCTGGGGCCCGTCCGGCTCCAGG - Intronic
986667667 5:10117386-10117408 CCTGTGTCCCTGCTGGCTGTTGG + Intergenic
999081802 5:148851428-148851450 CTTGTGTCCCTCCAGGCTCAGGG - Intergenic
1002383620 5:178849314-178849336 CTAGTGTCCCTCCCTGCTCTTGG + Intergenic
1003421177 6:5959962-5959984 TCTGTGTCCTGCCCGGCTTCTGG + Intergenic
1005806586 6:29478982-29479004 CCTTTCTCCCTCCCAGCTCTTGG + Intergenic
1007420043 6:41713728-41713750 CCTGGGTGCCTCCTGGCTCTGGG - Intronic
1008092740 6:47309336-47309358 CCGGTGACCCGCCCGGCTCCCGG + Intronic
1015925898 6:138310139-138310161 CCTGTGTCCTGCCTGGCTCCAGG + Intronic
1019378289 7:707908-707930 TCTGTGTCTCCCCCGGCTCCAGG - Intronic
1019378314 7:708023-708045 TCTGTGTCTCCCCTGGCTCTGGG - Intronic
1019378341 7:708135-708157 TCTATGTCTCCCCCGGCTCTGGG - Intronic
1019476637 7:1247594-1247616 CGTGTGTCCCGCCCGGGCCCCGG + Intergenic
1019501011 7:1364764-1364786 CCTGTGTCCCACCCAGATGTGGG - Intergenic
1019590366 7:1827620-1827642 CCTGAGCCCCGCCCGGGTGTGGG + Intronic
1021960186 7:25862800-25862822 CCGGTGTCCCGCCTGTCTCCCGG + Intergenic
1026602181 7:71785928-71785950 CCTGTGATCCCCCAGGCTCTTGG + Exonic
1030188835 7:106790787-106790809 GCATTGTCCTGCCCGGCTCTTGG - Intergenic
1034304929 7:150040005-150040027 CCTCTTCCCCGCCTGGCTCTTGG - Intergenic
1036181412 8:6588531-6588553 GCTGTGTCCAGCCGGGCTCCTGG + Intronic
1037826931 8:22165237-22165259 CCTGTCTCCCGCCCCCCGCTCGG - Exonic
1040487716 8:47889556-47889578 CCTGTGGCACGCCAGGCCCTGGG - Intronic
1042094364 8:65196770-65196792 CCTGTCTCCTGCCCAGCTTTTGG + Intergenic
1049266122 8:141668748-141668770 CCAGTGCCCAGCTCGGCTCTAGG + Intergenic
1049308722 8:141921909-141921931 GTTGTGTCCCGCACGGCACTAGG - Intergenic
1049557629 8:143291040-143291062 CCCGGGTCCCGCTCGGCTCACGG - Intronic
1049826228 8:144670581-144670603 CCTGCCTCCCGCCCTGCTCCAGG + Intergenic
1056124557 9:83522418-83522440 CCTGTGCCTCGCACAGCTCTGGG - Intronic
1056567299 9:87785420-87785442 TCTGTGTCCTGCCCGTCCCTGGG - Intergenic
1056943595 9:90975604-90975626 CCTGGGACCCGCCTGGCTCATGG + Intergenic
1057266574 9:93621577-93621599 CCTGTGTGGCTCCAGGCTCTGGG - Intronic
1060183871 9:121552117-121552139 CCTGTGTCCAGCCACCCTCTGGG - Intergenic
1062725137 9:138068799-138068821 CCAGTGCCCAGCCGGGCTCTAGG + Intronic
1190626686 X:52343994-52344016 CCTGTGCCCAGCACTGCTCTCGG - Intergenic
1190701325 X:52991835-52991857 CCTGTGCCCGGCACTGCTCTCGG + Intronic
1197735295 X:129846002-129846024 GCTCTGTCCCTCCCTGCTCTGGG + Intergenic
1198602242 X:138296235-138296257 CCTGTCTCCTGCCCGTCCCTGGG - Intergenic
1200066667 X:153507273-153507295 CCTCCTTCCCGACCGGCTCTGGG + Intronic