ID: 1144581232

View in Genome Browser
Species Human (GRCh38)
Location 17:16460604-16460626
Sequence CCTGTGTCCCGCCCGGCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 169}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1144581218_1144581232 10 Left 1144581218 17:16460571-16460593 CCCCATGGGCACTGACCACCCAG 0: 1
1: 0
2: 0
3: 20
4: 222
Right 1144581232 17:16460604-16460626 CCTGTGTCCCGCCCGGCTCTGGG 0: 1
1: 0
2: 1
3: 9
4: 169
1144581212_1144581232 23 Left 1144581212 17:16460558-16460580 CCCCTCCTCCTGCCCCCATGGGC 0: 1
1: 0
2: 7
3: 74
4: 665
Right 1144581232 17:16460604-16460626 CCTGTGTCCCGCCCGGCTCTGGG 0: 1
1: 0
2: 1
3: 9
4: 169
1144581219_1144581232 9 Left 1144581219 17:16460572-16460594 CCCATGGGCACTGACCACCCAGG 0: 1
1: 0
2: 0
3: 14
4: 163
Right 1144581232 17:16460604-16460626 CCTGTGTCCCGCCCGGCTCTGGG 0: 1
1: 0
2: 1
3: 9
4: 169
1144581213_1144581232 22 Left 1144581213 17:16460559-16460581 CCCTCCTCCTGCCCCCATGGGCA 0: 1
1: 0
2: 5
3: 66
4: 537
Right 1144581232 17:16460604-16460626 CCTGTGTCCCGCCCGGCTCTGGG 0: 1
1: 0
2: 1
3: 9
4: 169
1144581216_1144581232 15 Left 1144581216 17:16460566-16460588 CCTGCCCCCATGGGCACTGACCA 0: 1
1: 0
2: 2
3: 29
4: 230
Right 1144581232 17:16460604-16460626 CCTGTGTCCCGCCCGGCTCTGGG 0: 1
1: 0
2: 1
3: 9
4: 169
1144581221_1144581232 8 Left 1144581221 17:16460573-16460595 CCATGGGCACTGACCACCCAGGG 0: 1
1: 0
2: 1
3: 24
4: 253
Right 1144581232 17:16460604-16460626 CCTGTGTCCCGCCCGGCTCTGGG 0: 1
1: 0
2: 1
3: 9
4: 169
1144581225_1144581232 -8 Left 1144581225 17:16460589-16460611 CCCAGGGACCACCGGCCTGTGTC 0: 1
1: 0
2: 0
3: 11
4: 136
Right 1144581232 17:16460604-16460626 CCTGTGTCCCGCCCGGCTCTGGG 0: 1
1: 0
2: 1
3: 9
4: 169
1144581214_1144581232 21 Left 1144581214 17:16460560-16460582 CCTCCTCCTGCCCCCATGGGCAC 0: 1
1: 0
2: 3
3: 82
4: 569
Right 1144581232 17:16460604-16460626 CCTGTGTCCCGCCCGGCTCTGGG 0: 1
1: 0
2: 1
3: 9
4: 169
1144581224_1144581232 -5 Left 1144581224 17:16460586-16460608 CCACCCAGGGACCACCGGCCTGT 0: 1
1: 0
2: 0
3: 20
4: 160
Right 1144581232 17:16460604-16460626 CCTGTGTCCCGCCCGGCTCTGGG 0: 1
1: 0
2: 1
3: 9
4: 169
1144581209_1144581232 28 Left 1144581209 17:16460553-16460575 CCAGGCCCCTCCTCCTGCCCCCA 0: 1
1: 1
2: 34
3: 242
4: 2020
Right 1144581232 17:16460604-16460626 CCTGTGTCCCGCCCGGCTCTGGG 0: 1
1: 0
2: 1
3: 9
4: 169
1144581226_1144581232 -9 Left 1144581226 17:16460590-16460612 CCAGGGACCACCGGCCTGTGTCC 0: 1
1: 0
2: 5
3: 24
4: 262
Right 1144581232 17:16460604-16460626 CCTGTGTCCCGCCCGGCTCTGGG 0: 1
1: 0
2: 1
3: 9
4: 169
1144581217_1144581232 11 Left 1144581217 17:16460570-16460592 CCCCCATGGGCACTGACCACCCA 0: 1
1: 0
2: 1
3: 24
4: 200
Right 1144581232 17:16460604-16460626 CCTGTGTCCCGCCCGGCTCTGGG 0: 1
1: 0
2: 1
3: 9
4: 169
1144581215_1144581232 18 Left 1144581215 17:16460563-16460585 CCTCCTGCCCCCATGGGCACTGA 0: 1
1: 0
2: 3
3: 27
4: 354
Right 1144581232 17:16460604-16460626 CCTGTGTCCCGCCCGGCTCTGGG 0: 1
1: 0
2: 1
3: 9
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1144581232 Original CRISPR CCTGTGTCCCGCCCGGCTCT GGG Intronic